ID: 945673926

View in Genome Browser
Species Human (GRCh38)
Location 2:212832958-212832980
Sequence CGCCAACAGACGTGCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945673918_945673926 17 Left 945673918 2:212832918-212832940 CCCGCCGCGAAGCCGTGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG No data
945673920_945673926 16 Left 945673920 2:212832919-212832941 CCGCCGCGAAGCCGTGGACGGGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG No data
945673922_945673926 13 Left 945673922 2:212832922-212832944 CCGCGAAGCCGTGGACGGGTGGC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG No data
945673924_945673926 5 Left 945673924 2:212832930-212832952 CCGTGGACGGGTGGCTCAGGCAT 0: 1
1: 0
2: 3
3: 8
4: 159
Right 945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG No data
945673914_945673926 22 Left 945673914 2:212832913-212832935 CCTGCCCCGCCGCGAAGCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG No data
945673916_945673926 18 Left 945673916 2:212832917-212832939 CCCCGCCGCGAAGCCGTGGACGG 0: 1
1: 0
2: 1
3: 3
4: 42
Right 945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945673926 Original CRISPR CGCCAACAGACGTGCAGCCC CGG Intergenic
No off target data available for this crispr