ID: 945674015

View in Genome Browser
Species Human (GRCh38)
Location 2:212833357-212833379
Sequence GACTCAGTAGTAGCCAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945674012_945674015 -9 Left 945674012 2:212833343-212833365 CCGAGAACACCCAGGACTCAGTA No data
Right 945674015 2:212833357-212833379 GACTCAGTAGTAGCCAGACCTGG No data
945674005_945674015 25 Left 945674005 2:212833309-212833331 CCAGCGAAGCCGCACACGCACAC No data
Right 945674015 2:212833357-212833379 GACTCAGTAGTAGCCAGACCTGG No data
945674011_945674015 -8 Left 945674011 2:212833342-212833364 CCCGAGAACACCCAGGACTCAGT No data
Right 945674015 2:212833357-212833379 GACTCAGTAGTAGCCAGACCTGG No data
945674008_945674015 16 Left 945674008 2:212833318-212833340 CCGCACACGCACACACAGAGGGG No data
Right 945674015 2:212833357-212833379 GACTCAGTAGTAGCCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945674015 Original CRISPR GACTCAGTAGTAGCCAGACC TGG Intergenic
No off target data available for this crispr