ID: 945675301

View in Genome Browser
Species Human (GRCh38)
Location 2:212849081-212849103
Sequence TTTCTTTTATCCAGCTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945675301_945675304 13 Left 945675301 2:212849081-212849103 CCAGCGGAGCTGGATAAAAGAAA No data
Right 945675304 2:212849117-212849139 CTCTTGGAGGACAACAGCCTTGG No data
945675301_945675305 25 Left 945675301 2:212849081-212849103 CCAGCGGAGCTGGATAAAAGAAA No data
Right 945675305 2:212849129-212849151 AACAGCCTTGGTGCAATGAAAGG No data
945675301_945675303 0 Left 945675301 2:212849081-212849103 CCAGCGGAGCTGGATAAAAGAAA No data
Right 945675303 2:212849104-212849126 GTTTAATATAAAACTCTTGGAGG No data
945675301_945675302 -3 Left 945675301 2:212849081-212849103 CCAGCGGAGCTGGATAAAAGAAA No data
Right 945675302 2:212849101-212849123 AAAGTTTAATATAAAACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945675301 Original CRISPR TTTCTTTTATCCAGCTCCGC TGG (reversed) Intergenic
No off target data available for this crispr