ID: 945675772

View in Genome Browser
Species Human (GRCh38)
Location 2:212853864-212853886
Sequence ATAATTCATTTGGCCAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945675772_945675775 14 Left 945675772 2:212853864-212853886 CCTAACTTGGCCAAATGAATTAT No data
Right 945675775 2:212853901-212853923 ATATTTGTGATTCTCCTTTGTGG No data
945675772_945675777 18 Left 945675772 2:212853864-212853886 CCTAACTTGGCCAAATGAATTAT No data
Right 945675777 2:212853905-212853927 TTGTGATTCTCCTTTGTGGGAGG No data
945675772_945675776 15 Left 945675772 2:212853864-212853886 CCTAACTTGGCCAAATGAATTAT No data
Right 945675776 2:212853902-212853924 TATTTGTGATTCTCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945675772 Original CRISPR ATAATTCATTTGGCCAAGTT AGG (reversed) Intergenic
No off target data available for this crispr