ID: 945675841

View in Genome Browser
Species Human (GRCh38)
Location 2:212854807-212854829
Sequence GCAATTTACTAGTAGAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945675841_945675842 13 Left 945675841 2:212854807-212854829 CCAGGGTTCTACTAGTAAATTGC No data
Right 945675842 2:212854843-212854865 CAGCTCTGTGTTAAGTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945675841 Original CRISPR GCAATTTACTAGTAGAACCC TGG (reversed) Intergenic
No off target data available for this crispr