ID: 945676680

View in Genome Browser
Species Human (GRCh38)
Location 2:212863470-212863492
Sequence GTTCAGCAGCATCACCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945676680_945676681 -7 Left 945676680 2:212863470-212863492 CCTACAGGGTGATGCTGCTGAAC No data
Right 945676681 2:212863486-212863508 GCTGAACAACCACTCTGCTTTGG No data
945676680_945676683 5 Left 945676680 2:212863470-212863492 CCTACAGGGTGATGCTGCTGAAC No data
Right 945676683 2:212863498-212863520 CTCTGCTTTGGCGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945676680 Original CRISPR GTTCAGCAGCATCACCCTGT AGG (reversed) Intergenic
No off target data available for this crispr