ID: 945676683

View in Genome Browser
Species Human (GRCh38)
Location 2:212863498-212863520
Sequence CTCTGCTTTGGCGTCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945676680_945676683 5 Left 945676680 2:212863470-212863492 CCTACAGGGTGATGCTGCTGAAC No data
Right 945676683 2:212863498-212863520 CTCTGCTTTGGCGTCTCCTTTGG No data
945676677_945676683 21 Left 945676677 2:212863454-212863476 CCTGTGTAAAGTACTTCCTACAG No data
Right 945676683 2:212863498-212863520 CTCTGCTTTGGCGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945676683 Original CRISPR CTCTGCTTTGGCGTCTCCTT TGG Intergenic
No off target data available for this crispr