ID: 945681482

View in Genome Browser
Species Human (GRCh38)
Location 2:212919127-212919149
Sequence CTGTCCCACTGTAAAATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945681479_945681482 -8 Left 945681479 2:212919112-212919134 CCTAGATCAACAACCCTGTCCCA No data
Right 945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG No data
945681478_945681482 19 Left 945681478 2:212919085-212919107 CCTTTTACTTAAAGCTGTTTGAT No data
Right 945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945681482 Original CRISPR CTGTCCCACTGTAAAATCTT TGG Intergenic
No off target data available for this crispr