ID: 945684622

View in Genome Browser
Species Human (GRCh38)
Location 2:212953917-212953939
Sequence GCACACTCCCTGGCCACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945684617_945684622 23 Left 945684617 2:212953871-212953893 CCTGGCAGCTGATCAGCAAGGCC No data
Right 945684622 2:212953917-212953939 GCACACTCCCTGGCCACCATAGG No data
945684619_945684622 2 Left 945684619 2:212953892-212953914 CCTTTGTTAGAGAGAGGCTCAGG No data
Right 945684622 2:212953917-212953939 GCACACTCCCTGGCCACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945684622 Original CRISPR GCACACTCCCTGGCCACCAT AGG Intergenic
No off target data available for this crispr