ID: 945688333

View in Genome Browser
Species Human (GRCh38)
Location 2:213000563-213000585
Sequence CAGTTTTACTACAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945688330_945688333 22 Left 945688330 2:213000518-213000540 CCAAAGAAATGTTATCTTTTAAC 0: 1
1: 0
2: 4
3: 55
4: 487
Right 945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 18
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945688333 Original CRISPR CAGTTTTACTACAGGGACAC AGG Intronic
901612023 1:10506196-10506218 CATGTTTAATACAAGGACACAGG - Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
907273268 1:53303169-53303191 CAGCTTTCCTACAGGGACTTTGG + Intronic
908833699 1:68207745-68207767 CACTTTTACAAAAGGGAAACTGG - Intronic
912211257 1:107559637-107559659 AAGTTTTACTACAGAGAGACAGG - Intergenic
913594959 1:120366455-120366477 CAGTGTGACTACAGGGACAGAGG - Intergenic
914092309 1:144512531-144512553 CAGTGTGACTACAGGGACAGAGG + Intergenic
914306222 1:146421339-146421361 CAGTGTGACTACAGGGACAGAGG - Intergenic
914595828 1:149151469-149151491 CAGTGTGACTACAGGGACAGAGG + Intergenic
918385612 1:184004745-184004767 CAGTCTCACTACAGAGCCACAGG + Intronic
921012958 1:211161259-211161281 CAGTTTTACTACAGAGGCAGTGG + Intergenic
922432851 1:225572604-225572626 CAGTATTGCTGCATGGACACTGG + Intronic
923211227 1:231806280-231806302 CCCTTTTACTACAGGTACACTGG - Intronic
1068595522 10:58899195-58899217 CAGTTTCTCTACAAGGACTCAGG - Intergenic
1068627440 10:59264465-59264487 CAGTTTGACTGCAGGGGCACTGG - Intronic
1070870590 10:79748289-79748311 CAGTTCTACTGCAGAGACAGTGG - Intergenic
1071637508 10:87270501-87270523 CAGTTCTACTGCAGAGACAGTGG - Intergenic
1071657737 10:87467450-87467472 CAGTTCTACTGCAGAGACAGTGG + Intergenic
1072628760 10:97131435-97131457 CAGGAGTACTACAGGCACACAGG + Intronic
1076531771 10:131149717-131149739 CAGTTTTACTACTGCGACATTGG + Intronic
1077197595 11:1289065-1289087 CAGTTCCACTTCAGGGACACTGG + Intronic
1085213482 11:74804720-74804742 CAGTTTTACCACAGGCTAACTGG - Intronic
1088054401 11:105557609-105557631 CAGTTTCACTATGGGAACACAGG + Intergenic
1096424244 12:51487688-51487710 CAGTTGTATTACAGGGGCATTGG + Intronic
1097330428 12:58327417-58327439 TAGTTTTACTAGAGTGACAGGGG - Intergenic
1098192043 12:67959805-67959827 AAGTTGAAATACAGGGACACAGG + Intergenic
1098599544 12:72314565-72314587 CATTTTTCCTTCAGTGACACTGG - Intronic
1099184894 12:79505492-79505514 CAGTTTCACTACAGGGGTAATGG - Intergenic
1099214008 12:79831881-79831903 CTTTTTTACTACATGAACACTGG - Intronic
1101502021 12:105312999-105313021 CAGTTTCATTACAGGAATACGGG - Intronic
1101566051 12:105906568-105906590 CAGTTGGCCTACAGGCACACAGG - Intergenic
1106529671 13:30577966-30577988 AAGTTCCACTACAGGAACACAGG + Intronic
1106537595 13:30661195-30661217 TAATTTTACTGCAAGGACACTGG - Intergenic
1106620023 13:31364013-31364035 CACATTTAGTACAGGGACACAGG + Intergenic
1110042499 13:70781430-70781452 TATTTTTACTTGAGGGACACTGG + Intergenic
1110380081 13:74840350-74840372 CAGTTCTAATACAGGGATTCTGG - Intergenic
1113748496 13:112762654-112762676 GAATTTTACCACAGGGACATGGG - Intronic
1118491762 14:66267983-66268005 CAGTTCTACAACAGAGACCCTGG - Intergenic
1121163321 14:91766555-91766577 CATTTTTATTACAGGGTCACTGG + Intronic
1121163438 14:91768357-91768379 CATTTTTATTGCAGGGTCACTGG - Intronic
1128674692 15:69600050-69600072 CAGTTATACTACACGCACCCAGG + Intergenic
1132351975 15:101145398-101145420 CTGTTCTACTTCAGGGACATGGG - Intergenic
1137946089 16:52734472-52734494 CAGTTTTTCTACAAGGACTGAGG + Intergenic
1138230667 16:55333290-55333312 CAGTGTCACTAGATGGACACTGG + Intergenic
1138662463 16:58530914-58530936 AAATTTTGCTACAGGTACACAGG - Intronic
1138967664 16:62105051-62105073 CAGTTTTTTTGGAGGGACACTGG - Intergenic
1142713786 17:1737259-1737281 CAGTTTCTCTCCAGGGAGACAGG - Intronic
1143688047 17:8535069-8535091 CAGTTGTAATCCAGGAACACTGG - Intronic
1146470957 17:33124569-33124591 GCTTTTTACTACAGAGACACTGG - Intronic
1149133379 17:53336034-53336056 GGGTTTTACTCCAGGGATACAGG - Intergenic
1150471727 17:65443200-65443222 CAGCTTTACTCCAGAGAAACTGG + Intergenic
1157142665 18:45126345-45126367 CAGTTTTGCTGAAGGGACAATGG + Intergenic
1158734526 18:60064477-60064499 CAGATTTACCCCAGGCACACTGG - Intergenic
1160565599 18:79784999-79785021 CTGTTTGTCCACAGGGACACAGG - Intergenic
1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG + Intronic
1167089312 19:47332463-47332485 CAGTCTTATTACAGCCACACTGG + Intronic
1168592098 19:57645229-57645251 AAGTTTTACACCAGGGAAACTGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
930508320 2:52312760-52312782 GAGTTTTACTACATGGACCTTGG - Intergenic
930716354 2:54597292-54597314 CAACTTTACTACAGTGACTCAGG - Intronic
931457124 2:62419171-62419193 CATTTTCACTAAAGGGAAACAGG + Intergenic
932656369 2:73614162-73614184 CAGACTTACTACACTGACACAGG - Intergenic
935065188 2:99641206-99641228 CAGTGTCACTGGAGGGACACAGG - Intronic
935507302 2:103921534-103921556 CAGTTTTTCTACAGGGCCAGAGG - Intergenic
937300496 2:120836548-120836570 AAGTTCTCCCACAGGGACACAGG - Intronic
939715841 2:145582832-145582854 CAGTAGTACTTCAGGGACATTGG - Intergenic
940235898 2:151510373-151510395 CAGCCTTTGTACAGGGACACTGG + Intronic
941761002 2:169243330-169243352 CAGTGTTAACACATGGACACAGG - Intronic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
947938158 2:234025203-234025225 GAGGCTTCCTACAGGGACACAGG + Intergenic
948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG + Intergenic
1174570178 20:51495845-51495867 CAGGTTTCCCACAGGGACAGAGG - Intronic
949413145 3:3787281-3787303 CAGTTTGCCTACAGGGTCTCTGG - Intronic
949959743 3:9302220-9302242 CAGTTTGACTCCAGGGGCCCTGG + Intronic
953658826 3:44875560-44875582 CAGTTTTACTTCAGGGAGTCCGG + Intronic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
960067580 3:113391087-113391109 AAGTTATACTACAGAGATACAGG + Intronic
961064395 3:123862244-123862266 CAGATGAACTACAGGGACACAGG - Intronic
962709000 3:138070008-138070030 CTTTTTTACTACAGGAACAAAGG + Intronic
970247181 4:14075735-14075757 CAGTTTTATTACAGAGTAACTGG - Intergenic
970500574 4:16672750-16672772 CAGTGTTACTGCAGGGAAAGAGG - Intronic
971454434 4:26830767-26830789 CAGTTTGAGGACAGGAACACAGG - Intergenic
973238002 4:47926892-47926914 CAGTTTTCGTACGGGGAAACGGG + Intronic
984134221 4:175915593-175915615 CAGTTTTTCTACAGGGTGATTGG - Intronic
984593142 4:181638642-181638664 CATTTTTACTACAGAGAAAATGG - Intergenic
985687195 5:1288890-1288912 CCATTTTGCTACGGGGACACGGG - Intronic
986734248 5:10656448-10656470 CAGATGAACTAAAGGGACACTGG + Intergenic
987990415 5:25201882-25201904 GAGTTTTACTTCAAGGACACAGG + Intergenic
992053645 5:72965178-72965200 CAATTTTTCTACAGGTATACGGG - Intronic
994133174 5:96254664-96254686 GAATTTTACTCCAGGGACAGTGG + Intergenic
998936901 5:147238456-147238478 CAGTTTTAGGACTGGAACACAGG + Intronic
1000051041 5:157563162-157563184 CAGGTCTATTCCAGGGACACAGG + Intronic
1005675590 6:28151636-28151658 CAGTCTGACTTCAGGGACATCGG + Intronic
1007636323 6:43301943-43301965 CCGTTTTACAGAAGGGACACTGG - Intronic
1016719440 6:147277717-147277739 TAGTTTTTCTATTGGGACACTGG + Intronic
1019126674 6:169845361-169845383 CATGGTTACTTCAGGGACACAGG + Intergenic
1020450034 7:8310626-8310648 GAGTTTTACTCCAGGGATGCAGG - Intergenic
1021297635 7:18928105-18928127 CTATTTTACTACAGGGAGGCAGG + Intronic
1023886372 7:44360134-44360156 CAGTTCTACTACAGAGGCAGTGG + Intergenic
1027433358 7:78136921-78136943 GAGTTTCACTTCAGGGACACAGG - Intronic
1028189677 7:87831460-87831482 CAGTGTCACTTCAGGGACAAAGG + Exonic
1030357674 7:108560461-108560483 CAGGTTTACTACAGACCCACTGG + Intronic
1039115474 8:34087573-34087595 CAGGTTAACTACAGGGAGAAAGG - Intergenic
1042401670 8:68355908-68355930 CAATTATACTACAGAGAAACAGG - Intronic
1043265816 8:78266609-78266631 CAGTTTTATAAAAGGGAAACGGG + Intergenic
1044320558 8:90796165-90796187 TAGTTTTACTACCAGGCCACTGG - Intronic
1046830176 8:118737029-118737051 AACATTTACTACAGTGACACAGG - Intergenic
1051044373 9:12855790-12855812 AAGTATTACTACAGGGAAGCAGG + Intergenic
1052085755 9:24263673-24263695 CAGTTTTACCACAGAAACTCAGG - Intergenic
1062227012 9:135457931-135457953 CAGTTTCCCTACAGGCACAGTGG - Intergenic
1062342828 9:136101320-136101342 CAGTTTCACTACAGGGCAAACGG - Intergenic
1062351753 9:136142999-136143021 CAGTTTTACAACCTGGAGACAGG - Intergenic
1185947991 X:4399364-4399386 CAGTTTTCCTACCCTGACACTGG - Intergenic
1191865474 X:65700248-65700270 CAGTTTTCCTACAGGTAAAATGG - Intronic
1193137506 X:77988559-77988581 CAGTTTAGATACTGGGACACTGG + Exonic
1193242835 X:79193024-79193046 CAGTGAGACTACATGGACACAGG - Intergenic
1195285199 X:103376820-103376842 CTGTTTTCCTGCAGGGACTCGGG - Intronic
1197131771 X:123013989-123014011 CACTTTTACTGAAGGGACAGGGG + Intergenic
1197176183 X:123487876-123487898 TACTTTTACTACAGGGCCAGTGG + Intronic
1197355901 X:125437252-125437274 CAGTCATACTACAGGGAAAGGGG + Intergenic
1197535713 X:127687022-127687044 CACTTTTACTAGAGGAAGACAGG - Intergenic
1198441273 X:136665689-136665711 CAGTTTAATTACAGGGCAACAGG + Exonic
1200857899 Y:7959006-7959028 CTGTTCCACTACAGGGAAACCGG - Intergenic
1200877216 Y:8170277-8170299 AAGTTTTGTTGCAGGGACACAGG + Intergenic
1200893948 Y:8354701-8354723 CAGTTTTAGGACAAGAACACAGG - Intergenic
1201621671 Y:15965955-15965977 CAATTTTACAACTGGGCCACTGG + Intergenic
1201735370 Y:17254691-17254713 CAGTTTTCCTGCACTGACACTGG - Intergenic
1202266226 Y:23021814-23021836 CAGTTCTACTGCAGGGGCAGTGG + Intergenic
1202419219 Y:24655557-24655579 CAGTTCTACTGCAGGGGCAGTGG + Intergenic
1202451567 Y:25014527-25014549 CAGTTCTACTGCAGGGGCAGTGG - Intergenic