ID: 945688976

View in Genome Browser
Species Human (GRCh38)
Location 2:213008817-213008839
Sequence ATGGCACCTCACTGTTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945688973_945688976 23 Left 945688973 2:213008771-213008793 CCAAGCTACAAAGATCATAAAAG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 945688976 2:213008817-213008839 ATGGCACCTCACTGTTGTGTAGG 0: 1
1: 0
2: 2
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945688976 Original CRISPR ATGGCACCTCACTGTTGTGT AGG Intronic
900412114 1:2517290-2517312 AGGGCGCCTCCCTTTTGTGTGGG - Intronic
906360453 1:45153036-45153058 ATGGCACTTCATTGTAGTTTTGG - Intronic
906940349 1:50250218-50250240 ATGGAGCCTCACTGTTGTCAAGG - Intergenic
909025233 1:70474219-70474241 ATGGCATCTCACTGTGGTTTTGG - Intergenic
910004574 1:82380829-82380851 ATGGTATCTCACTGTGGTTTTGG - Intergenic
911998591 1:104799819-104799841 ATGGCAGCTCAATGTTTAGTGGG - Intergenic
912479532 1:109970543-109970565 GTGGTATCTCACTGTTGTCTTGG - Intergenic
913249433 1:116900240-116900262 ATGCCACCTCACTGTCGCCTGGG - Intergenic
914412109 1:147439718-147439740 ATGGTATCTCACTGTGGTTTTGG + Intergenic
914440692 1:147703538-147703560 ATGGCACCTCAATATTCTGGGGG + Intergenic
921260242 1:213379760-213379782 ACGGGACCTCACTGTGGTTTTGG - Intergenic
921411709 1:214842968-214842990 ATGACATCTCACTGTGGTTTTGG + Intergenic
922179948 1:223225687-223225709 CTGGCACCTCCATGTTGTCTAGG + Intronic
922841598 1:228647264-228647286 TTGGCACCTCACTGTGCTCTTGG + Intergenic
1063044940 10:2382300-2382322 ATGGCAGCCCACTGATGTGGGGG - Intergenic
1068904335 10:62306676-62306698 ATAGCACCTCAAGATTGTGTGGG + Intergenic
1069585475 10:69598120-69598142 ATAGCACCTCACTGTGGACTTGG + Intergenic
1069745575 10:70712922-70712944 ATCCCACCACACTGCTGTGTAGG - Intronic
1071290393 10:84184851-84184873 ATTGCAGCTCACTGCTGTGAAGG - Exonic
1072000726 10:91193347-91193369 TTAGCATCTCACAGTTGTGTAGG - Intronic
1072403938 10:95131963-95131985 ATGGTATCTCACTGTGGTTTTGG + Intergenic
1073699145 10:105905872-105905894 TTGGCAAATCACTTTTGTGTTGG - Intergenic
1073920203 10:108449734-108449756 ATGCCACCTCTCTTTTCTGTGGG + Intergenic
1075230881 10:120676581-120676603 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1075337848 10:121621610-121621632 ATGCCACCTGACACTTGTGTTGG + Intergenic
1075538508 10:123292770-123292792 GTGGTATCTCACTGTGGTGTGGG - Intergenic
1075538573 10:123293345-123293367 GTGGTATCTCACTGTGGTGTGGG - Intergenic
1077215264 11:1392786-1392808 ACGGCACCTCCCTGTCTTGTTGG + Intronic
1079658718 11:23015494-23015516 ATGGAACCCACCTGTTGTGTGGG - Intergenic
1079864463 11:25717615-25717637 ATGGTATCTCACTGTGGTTTTGG + Intergenic
1085758972 11:79225453-79225475 ATGGCACCACACTCTAGTCTGGG - Intronic
1086990154 11:93294057-93294079 ATGGTATCTCACTGTGGTTTTGG + Intergenic
1089299363 11:117489342-117489364 AAAGCACCTCACTGCTCTGTAGG + Intronic
1089690095 11:120181789-120181811 ATGGTTCCTCTCTATTGTGTGGG - Intronic
1089867972 11:121648570-121648592 AGAGTACCTCACTGTTGTGTCGG + Intergenic
1090008937 11:123028772-123028794 ATGGTACTTCATTGTTGTTTTGG + Intergenic
1093807951 12:23457726-23457748 ATGGCACCGAACTGTTTTGGAGG + Intergenic
1095519489 12:43045756-43045778 ATGGTATCTCACTGTGGTGTTGG - Intergenic
1099755028 12:86834769-86834791 ATGTCTCCTCATTGGTGTGTAGG + Intronic
1100087587 12:90930457-90930479 ATGGAATCTCACTGTGGTTTTGG - Intronic
1100297152 12:93273789-93273811 ATGACACCTCTCTGTGGTATTGG - Intergenic
1100539232 12:95542274-95542296 TTGCCACCTAACTGTTGGGTAGG + Intronic
1100664845 12:96739824-96739846 ATGGCACCTAACAGTTTTGGGGG + Intronic
1100943916 12:99757379-99757401 ATGGCATCTCATTGTGGTTTTGG - Intronic
1102256326 12:111417608-111417630 ATGCCAACTCATTTTTGTGTTGG + Intronic
1102412645 12:112733511-112733533 ATGGGAGCTCCCTGTTGGGTGGG - Intronic
1102766502 12:115438212-115438234 ATTCCACCCCACTCTTGTGTAGG + Intergenic
1103538391 12:121649389-121649411 AAGACACCTCACTGTTGTCGGGG + Intergenic
1103726413 12:122999487-122999509 ATGTCACCTCCCTGTCGTGAAGG - Intronic
1104113975 12:125731221-125731243 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1104577237 12:129978967-129978989 ACATCACCTCTCTGTTGTGTTGG + Intergenic
1106702675 13:32246683-32246705 ATGGCCCCTTACTGGTGTCTTGG - Intronic
1106846388 13:33742135-33742157 ATGGCAACTCAATGTGTTGTGGG - Intergenic
1107059195 13:36137827-36137849 ATGGCATCTCATTGTGGTTTGGG - Intergenic
1107690870 13:42951770-42951792 AAGGCCCCTCACTGTTAAGTAGG + Intronic
1112117180 13:96369051-96369073 ATGGCATCTCACTGGTGTTGTGG + Intronic
1114460114 14:22881061-22881083 ATGGCCCAGCCCTGTTGTGTGGG - Exonic
1115056619 14:29135668-29135690 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1115920711 14:38370092-38370114 ATGGCCCCAAACTGTAGTGTTGG + Intergenic
1117973877 14:61279834-61279856 ATGGCAACTCAGTGTCGTGAAGG + Exonic
1118953942 14:70462336-70462358 ATGGAACTTCTCTGTGGTGTTGG + Intergenic
1119051222 14:71370562-71370584 ACTGCCCCTTACTGTTGTGTTGG - Intronic
1120576084 14:86182653-86182675 ATGGCATCTCACTGTGGTTTTGG + Intergenic
1124239383 15:28017330-28017352 ATGGCACCTCCCTGCTCTCTTGG - Intronic
1126780213 15:52133336-52133358 ATGCCACCTCTCTGTTCTGCCGG - Intronic
1127307993 15:57727026-57727048 ATGAGACCTCACTGTCATGTGGG - Intronic
1130125549 15:81091197-81091219 ATGGTATCTCATTGTGGTGTTGG - Intronic
1130951805 15:88596844-88596866 AAGGTACATCAGTGTTGTGTGGG - Intergenic
1131095318 15:89650955-89650977 ATGGCATCTCACTGTTGCCCAGG + Intronic
1131409036 15:92190376-92190398 AAGGCACATAACTTTTGTGTTGG + Intergenic
1135499226 16:22979262-22979284 ATGCCACCTTACTGTGGTTTGGG - Intergenic
1142791566 17:2270580-2270602 ATGGTTCCTCTCTGTTGTGCAGG - Intronic
1143710482 17:8731193-8731215 ATGGTATCTCACTGTGGTTTTGG - Intronic
1156022180 18:32612327-32612349 ATGGTACCTCATTGTGGTTTTGG + Intergenic
1156108504 18:33694438-33694460 ATTGAACCTCACTGATGAGTAGG + Intronic
1158372274 18:56821801-56821823 AGGGTATCTCCCTGTTGTGTAGG - Intronic
1158667396 18:59444759-59444781 ATGGCATCTCACTGTAGTTTTGG + Intronic
1158812368 18:61052533-61052555 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1160275531 18:77430258-77430280 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1166776190 19:45314274-45314296 TTGGAACCTTTCTGTTGTGTAGG - Intronic
925134480 2:1516617-1516639 ATGGAACCTCACTGTGGGTTCGG - Intronic
925516978 2:4693478-4693500 ATGGCCCCTCAGAGCTGTGTGGG + Intergenic
932079716 2:68701947-68701969 ATGGTATCTCACTGTGGTTTTGG - Intronic
936003444 2:108859109-108859131 ATGGCATCTCATTGTGGTTTTGG + Intronic
936826176 2:116584143-116584165 ATCTCACCTCACTATTGTGTAGG - Intergenic
938630302 2:133159436-133159458 ATGGCATCTCACCATTCTGTAGG - Intronic
938777302 2:134553326-134553348 AAGGCACAACACAGTTGTGTGGG - Intronic
939498804 2:142955150-142955172 ATTGTACATCACTGTTTTGTAGG - Intronic
941554108 2:166954352-166954374 ATGGTATCTCACTGTGGTTTTGG - Intronic
943085795 2:183309419-183309441 ATGGTATCTCACTGTAGTTTTGG + Intergenic
945050972 2:205824122-205824144 ATGGTATCTCACTGTGGTTTTGG - Intergenic
945257692 2:207815831-207815853 ATGGCACCTCACTTTTCCCTCGG - Intergenic
945688976 2:213008817-213008839 ATGGCACCTCACTGTTGTGTAGG + Intronic
1172051156 20:32119390-32119412 GTGGTACCTCACTGTGGTTTTGG + Intronic
1174728098 20:52886155-52886177 ATCTCACCTCTCTGTTGTGTTGG + Intergenic
1175515638 20:59568229-59568251 ATGGCTCCTCACTGAGGTTTTGG + Intergenic
1177270042 21:18835832-18835854 ATGGTATCTTACTGTTGTTTCGG + Intergenic
1183621436 22:38975190-38975212 ATGGCTCCTCACTGTGGGGTTGG - Intronic
955513505 3:59704981-59705003 TTGTCACCTCACAGTTCTGTAGG + Intergenic
957511372 3:81191964-81191986 GTGGCACCTCACTTTTATATCGG - Intergenic
958158631 3:89788136-89788158 ATGTTACCTCACTGTGGAGTTGG + Intergenic
963570460 3:146988480-146988502 ATGGCATCCCATTGTTCTGTGGG + Intergenic
963697959 3:148585900-148585922 ATGGAATCTCACTGTTGCCTGGG - Intergenic
967165529 3:186776393-186776415 AGGCCACCTCATTGTAGTGTCGG - Intergenic
967508888 3:190287114-190287136 ATGGTATCTCACTGTGGTTTTGG + Intergenic
967937136 3:194738256-194738278 ATGCCACCTCACTGGGGTGAGGG + Intergenic
971978414 4:33721331-33721353 ATGGCACCTGAATGTGGTGTAGG + Intergenic
972813984 4:42623129-42623151 ATGGCATCTCATTGTGGTTTTGG - Intronic
974402475 4:61424898-61424920 GTAGCACCTCCCAGTTGTGTGGG + Intronic
976513507 4:85937275-85937297 ATGGCACTTCAATGTTTTGGGGG + Intronic
977882930 4:102226779-102226801 ATGGTATCTCACTGTGGTTTTGG - Intergenic
980468897 4:133224156-133224178 ATGGCAACTTACTGTTCTATAGG + Intergenic
981062870 4:140445229-140445251 ATGGTATCTCACTGTGGTTTGGG + Intronic
982682731 4:158451446-158451468 ATGGCATCTCATTGTTGTTTTGG - Intronic
985839169 5:2292960-2292982 ATGGTACCTCATTGTAGTTTTGG - Intergenic
987509479 5:18816999-18817021 ATAGCACCTTCCTGTGGTGTTGG + Intergenic
987533426 5:19150790-19150812 ATGGTATCTCACTGTGGTTTTGG + Intergenic
987966738 5:24887078-24887100 ATGGTATCTCACTGTGGTTTTGG - Intergenic
988320908 5:29695495-29695517 ATGGAATCTCACTGTTATGTAGG + Intergenic
992765293 5:79992896-79992918 ATGGAACCTCCCTGTTTTGAGGG + Intronic
994368744 5:98945915-98945937 ATGGAACATCATTCTTGTGTGGG + Intergenic
994907139 5:105855639-105855661 ATGGTATCTCACTGTGGTTTTGG - Intergenic
995194944 5:109356192-109356214 TTAGCACCTCACTTTTCTGTTGG - Intronic
997355446 5:133259917-133259939 ATGGGACCTCAATGTTGTGTGGG - Intronic
998631628 5:143904858-143904880 ATGGTATCTCATTGTTGTTTTGG + Intergenic
999886987 5:155935407-155935429 ATGGAACTTCATTGTTGTGGGGG + Intronic
1004248371 6:14002200-14002222 ATGGGACCTCACTGTTCTCGGGG - Intergenic
1004949283 6:20650270-20650292 ATGGTACCTCATTGTGGTTTTGG + Intronic
1005253491 6:23973667-23973689 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1005273929 6:24196461-24196483 ATGCCACCTCACTGTAGTGTGGG - Intronic
1005351931 6:24944792-24944814 ATGGCAAGTCACTTTTGTTTGGG - Intronic
1006985562 6:38173322-38173344 CTGCCACTTCCCTGTTGTGTGGG - Exonic
1009783257 6:68297329-68297351 AGGGAACCTCACTGCTGTGAAGG + Intergenic
1012560808 6:100579035-100579057 ATGGTATCTCACTGTGGTTTTGG + Intronic
1016398350 6:143651124-143651146 ATGGCATCTCAATGTGGTTTCGG - Intronic
1018837361 6:167494976-167494998 ATGGGACCTCACTGCTGTACTGG - Intergenic
1018870877 6:167781232-167781254 ATGGCACATCACTGTGGGGAGGG - Intergenic
1019574288 7:1728874-1728896 ATCGCATCTCACTGTCGTGATGG + Intronic
1022126568 7:27363368-27363390 TTAGCACCTCACAGATGTGTAGG - Intergenic
1024235688 7:47395884-47395906 ATGGCTCCTCTCTGTTGTCCTGG - Intronic
1024563780 7:50665434-50665456 ATGGGCCCTCACTGGTGTTTGGG - Intronic
1024727313 7:52212622-52212644 ATGGTACCTCATTGTGGTCTTGG - Intergenic
1025714957 7:63947026-63947048 ATGGTATCTCATTGTGGTGTTGG - Intergenic
1027979801 7:85202776-85202798 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1028458871 7:91069345-91069367 ATGGCATCTCACTGTTGCTCAGG - Intronic
1030390789 7:108925752-108925774 ATGGTATCTCATTGTTGTTTTGG + Intergenic
1030427094 7:109392011-109392033 ATGGGACCTCCCTATTGTCTGGG + Intergenic
1031106639 7:117551778-117551800 ATGGCATCTCACCAGTGTGTGGG + Intronic
1031498032 7:122475813-122475835 ATGGCAGCTTATTGATGTGTAGG + Intronic
1033827850 7:145213867-145213889 ATGGCATCTCATTGTGGTTTTGG + Intergenic
1036808846 8:11853501-11853523 AGGACACCTCTCTGTTATGTGGG + Intronic
1037660613 8:20923396-20923418 ATGACACATCACTATTGTGGGGG - Intergenic
1038240366 8:25802610-25802632 ATGGAGTCTCACTGTTGTCTAGG + Intergenic
1038877920 8:31572297-31572319 ATGGTATCTCACTGTGGTATTGG - Intergenic
1042293192 8:67191254-67191276 ATGTCACCTCCTTGTTGAGTAGG + Intronic
1045283342 8:100768826-100768848 ATGACACCTCATTGTGGTTTTGG - Intergenic
1046024737 8:108708574-108708596 ATGGTATCTCACTGTGGTATTGG + Intronic
1046859356 8:119072640-119072662 ATGGCACCTCAGTGTTTTATGGG + Intronic
1047243982 8:123121977-123121999 GTGGCATCTCACTGTGGTTTTGG - Intronic
1048935048 8:139348131-139348153 ATGCCATCTCACTGTGGTATGGG - Intergenic
1050689618 9:8210719-8210741 GTGGCACATCCCTTTTGTGTAGG + Intergenic
1051594802 9:18814091-18814113 ATGATACCTCACTGTGGTTTTGG + Intronic
1055238400 9:74152912-74152934 ATGGTATCTCACTGTGGTTTTGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056439543 9:86606760-86606782 ATGGTATCTCATTGTTGTTTTGG + Intergenic
1059984960 9:119812840-119812862 TGGGCACCACTCTGTTGTGTGGG - Intergenic
1060858766 9:126936668-126936690 ATGGCACCTCACTGACATCTTGG - Intronic
1185576245 X:1174920-1174942 ATGGCACCTTCCTGGTGTCTGGG - Intergenic
1188278456 X:28232278-28232300 GTGGCACCTCATTGTGGTTTTGG + Intergenic
1189077939 X:37937631-37937653 TTAGTACCTCACAGTTGTGTAGG - Intronic
1190293587 X:49010166-49010188 ATGGTATCTCACTGTGGTTTTGG + Intergenic
1190326505 X:49210094-49210116 CTGCCCCCTCACTGTTGGGTGGG + Intronic
1190920541 X:54847520-54847542 ATGGTACCTCATTGTGGTTTTGG - Intergenic
1190930813 X:54948453-54948475 ATGACATCTCATTGTTGTTTGGG + Intronic
1191086808 X:56576929-56576951 ATGGCATCTCATTGTGGTTTTGG + Intergenic
1192115978 X:68411476-68411498 ATGGTATCTCACTGTGGTTTTGG + Intronic
1193303343 X:79919746-79919768 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1193554879 X:82941244-82941266 ATGGTATCTCACTGTAGTTTTGG + Intergenic
1196779648 X:119372100-119372122 ATGGTACCTCATTGTGGTTTTGG + Intergenic
1197548515 X:127858371-127858393 ATGGTATCTCACTGTGGTTTTGG - Intergenic
1198717569 X:139575757-139575779 ATAGCACCGCACTTTTGTGTTGG + Intergenic
1200035363 X:153324399-153324421 ATGGAACCTCAGTGGTCTGTGGG - Intergenic