ID: 945689126

View in Genome Browser
Species Human (GRCh38)
Location 2:213010514-213010536
Sequence ACTGTGTAGTCCCTAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945689126_945689128 -10 Left 945689126 2:213010514-213010536 CCTGCTTCTAGGGACTACACAGT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 945689128 2:213010527-213010549 ACTACACAGTCCTCTTCATAGGG 0: 1
1: 0
2: 1
3: 14
4: 132
945689126_945689131 22 Left 945689126 2:213010514-213010536 CCTGCTTCTAGGGACTACACAGT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 945689131 2:213010559-213010581 CTTCATACCAACTGTGCTACTGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945689126 Original CRISPR ACTGTGTAGTCCCTAGAAGC AGG (reversed) Intronic