ID: 945693460

View in Genome Browser
Species Human (GRCh38)
Location 2:213071632-213071654
Sequence GTGTGGAAGGAGAAGTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945693457_945693460 -4 Left 945693457 2:213071613-213071635 CCACTACAAGTGTCTGTCTGTGT 0: 1
1: 0
2: 4
3: 30
4: 344
Right 945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG 0: 1
1: 0
2: 1
3: 32
4: 271
945693456_945693460 -3 Left 945693456 2:213071612-213071634 CCCACTACAAGTGTCTGTCTGTG 0: 1
1: 0
2: 0
3: 16
4: 182
Right 945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG 0: 1
1: 0
2: 1
3: 32
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945693460 Original CRISPR GTGTGGAAGGAGAAGTATAA AGG Intronic
900861263 1:5234094-5234116 GTGTGAAAGGAGAAGTGTCAAGG - Intergenic
903957399 1:27034774-27034796 GTCAGGAAGGAGAAGAAGAAGGG - Intergenic
906139047 1:43522551-43522573 ATGTGTAACAAGAAGTATAAAGG + Intergenic
907067299 1:51497995-51498017 GTGTGTATTGTGAAGTATAAAGG + Intronic
908897278 1:68914442-68914464 CTGTGGAATGAGAAAGATAAGGG - Intergenic
909584453 1:77273968-77273990 GTGGGGAAGTAGAAGTAGCAAGG + Intergenic
909738012 1:78990545-78990567 TTTTCAAAGGAGAAGTATAAAGG + Intronic
910085857 1:83401471-83401493 ATGTGGAAGCAGACGTATTATGG - Intergenic
910466154 1:87502423-87502445 GTTTTGAAGGAGAAGTACAAAGG - Intergenic
911175043 1:94810282-94810304 GTGTCCAAGGAGAAGCATTATGG + Intergenic
911268771 1:95775510-95775532 GGGTGGATGGTGAAGTATAGTGG - Intergenic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916422879 1:164652812-164652834 GGGTGGTAAGAGAAGTAAAAGGG - Intronic
917619190 1:176778390-176778412 GTCTGGAAGGAGAAGGGCAAGGG + Intronic
918793715 1:188864149-188864171 GTGTTGAGGGAGAAGTAAAAGGG - Intergenic
919171207 1:193956644-193956666 GTGTGGCAGGAAAACTATGATGG + Intergenic
921823796 1:219648494-219648516 GTGTAGAGGGAGAATTACAAAGG - Intergenic
924694534 1:246384768-246384790 GTTTGGAAGAAAAATTATAATGG + Intronic
1065961080 10:30734852-30734874 GTGTGGAAGGAGCATGATAAGGG + Intergenic
1066062240 10:31734590-31734612 GAGTGGAAGGAGAGTTGTAAAGG - Intergenic
1067659406 10:48223291-48223313 GTGTGGAAGGAGAAGCAGTAGGG + Intronic
1067672911 10:48342039-48342061 ATGTGGCAGGAGAAGTATGCAGG + Intronic
1068275452 10:54790094-54790116 ATGGGGAAGGAGAAGTCTTATGG - Intronic
1069225953 10:65944371-65944393 GTGGAGAAGCAGATGTATAATGG + Intronic
1069569451 10:69485557-69485579 GGGTGGAAGGTGAAGTCGAAAGG + Intronic
1070151745 10:73809489-73809511 GTTAGGAAGGAGAAGTAGAGTGG - Intronic
1071229798 10:83572244-83572266 GTGGGAAAGGAGAAGTCCAAGGG - Intergenic
1071477181 10:86034979-86035001 GGGTGGATGGATAAGTATACAGG + Intronic
1072896076 10:99367938-99367960 GTGGGGAAAGAGAAGGACAATGG + Intronic
1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG + Intronic
1074979327 10:118607013-118607035 GTGTCCAAGGAGAGGGATAAAGG - Intergenic
1075291979 10:121238495-121238517 ATGAGGAAGGAGAAGCATAAAGG - Intergenic
1075497626 10:122939433-122939455 GTGAGAAAGGAGAATAATAAGGG + Intronic
1076140914 10:128077904-128077926 GTGTGTAAGGAGAGGTAGAGAGG - Intronic
1077954609 11:7002009-7002031 GTGTGGAAGGAGAACACCAAAGG - Intronic
1080005410 11:27400889-27400911 GTGTCGAAGCAGAACTATAAAGG - Intronic
1083556906 11:63636842-63636864 GTGGGGAAGGAGAAAAATGAAGG - Intronic
1084038555 11:66528505-66528527 GTGTGGATGCAGAAATAGAATGG + Intronic
1085190242 11:74614372-74614394 TTGGGGATGGAGAAGTATGAAGG + Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1087131735 11:94674566-94674588 TTGATGAAGGAGAAGAATAAAGG + Intergenic
1087269532 11:96097426-96097448 GGGAGAAAGGAGAAGTATTAGGG + Intronic
1091250292 11:134138599-134138621 ATTTTGAAGGAGAAGTAGAAGGG + Intronic
1091485338 12:881261-881283 TTGTGAAAGGACAAGAATAATGG - Intronic
1091983817 12:4890752-4890774 GAGAGGAAGGGGAGGTATAATGG + Intergenic
1092649602 12:10619601-10619623 GGGTTGGAGGAGAACTATAACGG - Exonic
1092738194 12:11603857-11603879 TGGTGGAAGGAGAAAGATAATGG + Intergenic
1092951804 12:13510556-13510578 GTGAGGAAAGAGAAGGATCAGGG + Intergenic
1093326009 12:17774764-17774786 GTGAGCAAGGAGAAGAATCATGG - Intergenic
1094046216 12:26169836-26169858 ATGTGGAAGCAGAAGGATATTGG + Intronic
1094180847 12:27591169-27591191 GAGAGGAAGGAGAGGGATAAGGG + Intronic
1094229968 12:28091798-28091820 GTGAGGAAAGAGAACTAGAATGG + Intergenic
1094846771 12:34364787-34364809 TTGTGGAAGGAAAAGAAAAAGGG - Intergenic
1094848092 12:34370185-34370207 GTGTGGAAGGAAAACAAAAACGG - Intergenic
1094848436 12:34371688-34371710 TTGTGGAAGGAAAAGAAAAACGG - Intergenic
1094854862 12:34398431-34398453 GTGTGGAAGGAAAACAAAAACGG + Intergenic
1104456019 12:128913132-128913154 GGGAGGAAGGAGGAGTATGAAGG - Intronic
1104709773 12:130977384-130977406 GTGTGGAGTGAGAATTTTAAAGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106870576 13:34014552-34014574 GCGTGGAAAGAGAAGGAAAATGG + Intergenic
1107066597 13:36220101-36220123 GTTTGTAAGGAGAAATAAAAGGG + Intronic
1107152712 13:37130332-37130354 ATAAGGAAGGAGAAGTATGATGG - Intergenic
1108140766 13:47418760-47418782 GAGTGGAAGTAGAAGTTTAGTGG - Intergenic
1108640819 13:52380865-52380887 GTGTTGAGGGAGGAGTAGAACGG - Intronic
1108997908 13:56758744-56758766 ATGAGGAAGAAGAAATATAATGG - Intergenic
1109680343 13:65744198-65744220 GTTTGAAAGGAGAAGCAAAAGGG - Intergenic
1111206413 13:85017362-85017384 GAGCGGAAGGAGAAGTTGAACGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1114136712 14:19860725-19860747 GTGGGGAGGGAGAGGTAAAAAGG - Intergenic
1114262599 14:21048961-21048983 GAGTTGAAGGAGAAGTAAAAGGG + Intronic
1114749027 14:25182876-25182898 GAGTGGAAGGAGTAGGATAAGGG + Intergenic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1116444179 14:44989507-44989529 TTTTGGAAGGAGAAGAGTAAAGG + Intronic
1117859138 14:60071559-60071581 GTGTAGAAGCAAAAGTATAAGGG + Intergenic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118130573 14:62958402-62958424 GTGTCTGAGGAGAAGTAGAAAGG - Intronic
1124343001 15:28901958-28901980 GTGGGGGAGGGGAAGAATAAAGG + Intronic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125530334 15:40409013-40409035 GGATGTAAGGAGAAGTATATTGG - Intronic
1126160032 15:45602675-45602697 GTGAGGAAGATGAAGTATCAAGG - Intronic
1126681837 15:51209796-51209818 ATGTCGAGGGAGAAGGATAAGGG + Exonic
1126951554 15:53887175-53887197 GTGTGGAAGGAGAAGGGTTATGG + Intergenic
1127235733 15:57049097-57049119 GGATGGAGGGAGAGGTATAAAGG + Intronic
1128179943 15:65593303-65593325 GTGTGGCAGGAAAAGGAAAAAGG + Intronic
1128773975 15:70304662-70304684 ATGTAGAAAGAGAATTATAAAGG - Intergenic
1130555659 15:84920824-84920846 GTGTGGAAGAAGAAGATGAATGG + Intronic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1131458400 15:92601321-92601343 CTCTGGAAGGAGAATTCTAAAGG - Intergenic
1131539062 15:93260871-93260893 GGAAGGAAGGAGAAGAATAAAGG - Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132187506 15:99814451-99814473 GGATGGAAGGAGAAGGACAAGGG + Intergenic
1133717929 16:8467066-8467088 GGGAGGAAGGAGAAGAAGAAAGG + Intergenic
1134261185 16:12652252-12652274 GTGTGGATGGAGCAGTTTCACGG - Intergenic
1135357025 16:21777507-21777529 GTTTGGGAGTAGAAGTAGAAAGG - Intergenic
1135455528 16:22593621-22593643 GTTTGGGAGTAGAAGTAGAAAGG - Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136654474 16:31701728-31701750 ATGTGGATGGAGTAGAATAAAGG - Intergenic
1137813431 16:51375210-51375232 GTGTGGATGATGAAGTATGATGG + Intergenic
1138721996 16:59092908-59092930 GAGTGAAAGGGGAAGTAGAAGGG - Intergenic
1142157156 16:88537798-88537820 GTGTGGAGGGAGAACTTCAAGGG - Intergenic
1142494547 17:299394-299416 GTCTGGAAGGAGAGGGCTAAAGG + Intronic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1145281637 17:21472201-21472223 GTATGGAAGTAGAACTAAAAAGG + Intergenic
1145923022 17:28625656-28625678 GGTTGGAAGGAGGAGTTTAAGGG - Intronic
1146592754 17:34142284-34142306 GTGAGGAAGGGGAAATACAAGGG + Intronic
1147203846 17:38822776-38822798 GTGAGAAAGGAGCAGAATAAGGG + Intronic
1147228729 17:39001816-39001838 GTTTGGAAGGAGAAGAGAAAAGG - Intergenic
1147359788 17:39923421-39923443 GTATGGCAGGAGAAGAACAAGGG + Intronic
1148111478 17:45147047-45147069 GTGGCGAAGGAGAAGTGGAAAGG + Intergenic
1148587927 17:48794102-48794124 GAGTGGATGGAGAAGTACAGTGG + Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149198803 17:54157798-54157820 GTGTGGAAGTAGAAAAATGAAGG + Intergenic
1150202554 17:63372368-63372390 GTGTGGAAGGGTAAGGATCAGGG + Intronic
1150808886 17:68340695-68340717 TTGAGGAAGGAGAAGTACCAGGG - Intronic
1151146140 17:72043195-72043217 GTAAGGAAAGAGAAGGATAAAGG - Intergenic
1151449616 17:74190301-74190323 GGGTGTAAGGAGATGTGTAAAGG - Intergenic
1151518858 17:74614374-74614396 GAGGGGAAGGAGGAGTCTAAAGG + Intronic
1153328628 18:3848836-3848858 GAGTGGAAGGAGAAGGACAGTGG - Intronic
1155563251 18:27103414-27103436 GTGTGGAAGCACAAGGTTAATGG + Intronic
1155670258 18:28362097-28362119 CTGTGGAAGGAGAAAGGTAATGG - Intergenic
1156246318 18:35302685-35302707 TTCTGGAAGAGGAAGTATAAGGG + Intergenic
1156734945 18:40244983-40245005 GTGTGGCAGAAGAAGGATAATGG + Intergenic
1157881598 18:51326047-51326069 TGGAGGAAGGAGAAATATAAGGG - Intergenic
1158463154 18:57664898-57664920 CTTTGGAAGGAGAAGAACAATGG - Intronic
1158695331 18:59697952-59697974 GTGAGGAAGGAGGAGTTGAAAGG + Intergenic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159392401 18:67809834-67809856 CTGTGGATGGAGGAGTATAGGGG - Intergenic
1159579273 18:70217105-70217127 GTAAGGAAGGAGAAGCATGAGGG - Intergenic
1160273589 18:77409753-77409775 GTGTGGAAGCAGGTGTATGATGG + Intergenic
1160582796 18:79896490-79896512 GTGTGGGAGCAAAAGTGTAATGG - Intronic
1163448991 19:17364565-17364587 ATGTGGATGGAGAAGTTTATTGG - Intronic
925332738 2:3071411-3071433 GTGTGGAAGGGGAAGTCCAGAGG - Intergenic
931426987 2:62180219-62180241 GTGGGGAAGGAGATGAAAAATGG - Intergenic
931628980 2:64282667-64282689 CTGTGGAAGGAGAGGTAGAGGGG + Intergenic
932767345 2:74479404-74479426 ATGGGGAAGAAAAAGTATAATGG + Intronic
933146474 2:78860133-78860155 GTGTGGAGGGTGATGTATCAAGG - Intergenic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
936525628 2:113239697-113239719 GAGTGGTTGGAGAAGTTTAATGG + Intronic
936646664 2:114379844-114379866 GTGTGAAAAGAGATTTATAAGGG + Intergenic
937470114 2:122167362-122167384 GTCTGGAAGGAGAATTCTCAGGG - Intergenic
937768388 2:125688857-125688879 TGGTGGAAGGAGAAAAATAAAGG + Intergenic
940273730 2:151917883-151917905 ATATGGAAGGAGAAGTTTAGGGG - Intronic
940657443 2:156506092-156506114 TTGTTGAATGAGAAGTAGAAAGG - Intronic
941012978 2:160322310-160322332 GTATGGAAGAAGAAGGGTAATGG + Intronic
941105096 2:161343210-161343232 GGGTGGAAGATGAAGTATTATGG - Intronic
942417397 2:175773293-175773315 GTGGGGAAGGAGAAGAAAAAAGG + Intergenic
942483414 2:176414126-176414148 GTTTGGAAGAAGAGGTATAAGGG - Intergenic
943536874 2:189163142-189163164 GTGGAGAAGGAGCAGAATAATGG - Intronic
943753523 2:191535003-191535025 GTGTGGGAGGAAAAGTATGGTGG + Intergenic
945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG + Intronic
946835424 2:223767827-223767849 GTGGGGAAGGGGAAGTATGTTGG - Intronic
947114553 2:226755055-226755077 GTGTGGCAGGAGAGCTAAAAGGG - Intronic
947207332 2:227673832-227673854 TGGTGGAAGGAGAAGTCAAAAGG - Intergenic
947274403 2:228373889-228373911 GTGAGGGAGGAGAATTATACAGG - Intergenic
948509301 2:238452813-238452835 GTGTGGAATGGGGAGTCTAACGG - Intergenic
1168965716 20:1896683-1896705 GGGTGGAAGGAGAAGTATGGGGG + Intronic
1172304097 20:33869446-33869468 CTGTGGAAGGAAGAGAATAAAGG - Intergenic
1172479781 20:35264216-35264238 GTGTGGAAGGGGAGGGGTAAAGG - Intronic
1173201093 20:40955558-40955580 GTGTGGGAGGAGAAGAAAATAGG + Intergenic
1174603973 20:51747028-51747050 GAGTGGAAGGAAAGGTATGAAGG + Intronic
1175447561 20:59033952-59033974 GTGGGGAAGAACAAGCATAATGG - Exonic
1175568512 20:60000236-60000258 GTGTGGAAACAGAATTAGAAAGG + Intronic
1177534502 21:22406391-22406413 TTGTTGAAGGACAAGTATAAAGG + Intergenic
1177735491 21:25083883-25083905 GAGAGCAAGAAGAAGTATAAGGG - Intergenic
1178249424 21:30987640-30987662 GGGTGGGAGGGGAAGTAGAAAGG + Intergenic
1181175919 22:21035508-21035530 GTGTGGGAGCAGAAGTATATGGG - Intergenic
1184103997 22:42356999-42357021 CTGAGGAAGGAGAAGCTTAAGGG + Intergenic
1184308655 22:43626940-43626962 GTGTGGAAGGAAAAGAAAAGTGG - Intronic
1184377774 22:44125356-44125378 GTGAAGAAAGAGAAGTATTATGG + Intronic
1184951581 22:47846517-47846539 ATGTGGAAGAAGATGTATCATGG + Intergenic
949818378 3:8087346-8087368 GTGTGGAATGAGAAGAAAATAGG - Intergenic
951553146 3:23895452-23895474 GGGTGGAAGGACAATGATAAAGG - Intronic
951665937 3:25123614-25123636 GTTTGCAAGGAGAAACATAAGGG - Intergenic
952134232 3:30399015-30399037 GTTTGCAAGCAGAAGTAGAAAGG - Intergenic
952324012 3:32304409-32304431 GGGGGAAAGGAAAAGTATAAAGG + Intronic
952700015 3:36317708-36317730 GTGTACAAAGACAAGTATAAAGG + Intergenic
952726827 3:36595314-36595336 GGGTGAAAGGAGAAGGAGAAAGG - Intergenic
953789425 3:45936166-45936188 GTGTGGGAGGAATATTATAAAGG + Intronic
954358404 3:50102610-50102632 GGGGGGAAGGAGAAATGTAAAGG + Intronic
954784477 3:53082802-53082824 GTGGGGGTGGGGAAGTATAATGG + Intronic
955203667 3:56875966-56875988 GGCTGGAGGGAGAGGTATAAAGG + Intronic
956411025 3:68979688-68979710 GTCTGGAAGGAAAAGTAAATGGG + Exonic
959751256 3:109838474-109838496 TTGTAGAAGGAGCAGTATAAGGG + Intergenic
960317609 3:116197311-116197333 GTTTGGAAGGAGAAGTGACAAGG - Intronic
960573963 3:119211292-119211314 GTGGGGAAGGAGAATTTGAAAGG - Intergenic
965962557 3:174445605-174445627 GTGAGGAAAGAGAGGTAGAAGGG - Intronic
967197652 3:187042776-187042798 GTGTGGAAGGAAAAGAAGAAAGG + Exonic
967476729 3:189929993-189930015 TTGTGAAAGGAGAAGTAAAGGGG - Intergenic
970072309 4:12174859-12174881 GACTGAAAGGAGAAGTGTAAAGG - Intergenic
970499490 4:16662821-16662843 GTAAGGAAAAAGAAGTATAATGG - Intronic
970520205 4:16875877-16875899 GAGTGGAAGGAGAAGGATAGAGG - Intronic
971812391 4:31442867-31442889 GTGTGGCAGGAGAAAAATTAAGG - Intergenic
972039683 4:34577240-34577262 ATATGGCAGGAGAAGAATAATGG - Intergenic
973264461 4:48197791-48197813 GTGTGGAACTAGAACTATCAAGG - Intronic
974933348 4:68385362-68385384 GTGTGGAAAGATAAATAAAAGGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976575659 4:86667915-86667937 GTGTGGAAGATGAAAAATAAGGG + Intronic
976763583 4:88576238-88576260 GAGTGGTAGTAGAATTATAAAGG - Intronic
977051687 4:92136186-92136208 GTGGGGAAGGGGATGTAGAAAGG + Intergenic
977912833 4:102557739-102557761 GTGGGAAAAGAGAAGTACAAGGG + Intronic
978540546 4:109812383-109812405 ATGTGGAAGGAGATTTATATGGG - Intergenic
979781413 4:124655185-124655207 GTATGGAAGGTGAAGTTGAATGG + Intergenic
980098477 4:128517989-128518011 GTGTGGAATGGGAAGTGAAAGGG - Intergenic
982433414 4:155351066-155351088 CTGTGAAAGAAGAACTATAAAGG + Intronic
982535023 4:156599939-156599961 CTGTGATAGGAGAAGTATACAGG + Intergenic
983865589 4:172761535-172761557 GTGTTGAAGGAGGAGTCTCATGG + Intronic
984483685 4:180337960-180337982 GTGGTGAAGTAGAAGGATAATGG - Intergenic
984737472 4:183123556-183123578 GTGGGGAAGGAAGAGTGTAAGGG + Intronic
984848107 4:184125136-184125158 GTGTGGTATGTGAAGTCTAAAGG + Intronic
987571541 5:19668992-19669014 GTGTTGAAGTTGAAGTATCATGG - Intronic
987699810 5:21382662-21382684 GTGTTGAAGGAGGAGTCTAGTGG - Intergenic
988787619 5:34579138-34579160 GGGAGGAAGGAGAAGGAGAAAGG + Intergenic
988927380 5:36003312-36003334 GTGTGGAAGGAAAGATAAAATGG - Intergenic
989664705 5:43840732-43840754 GTGTGGAAATATAAGGATAAGGG + Intergenic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
996467570 5:123821375-123821397 GTGTGGAAGGAAGAGTATATGGG - Intergenic
999336850 5:150727060-150727082 GTGGGGAAGAACAAGGATAATGG + Intronic
999687907 5:154118720-154118742 ATGTGGAAAGAGAAATAAAAAGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004853274 6:19722968-19722990 GTGTGCCAGGAGATGTAGAAGGG + Intergenic
1005277370 6:24234201-24234223 ATGAGGAAGGAGAATTTTAAAGG + Intronic
1005965044 6:30721124-30721146 GGGTGGAAGGAGAATAAGAACGG + Intronic
1006749382 6:36367011-36367033 GTGTGGAAGGAGCAGGACATGGG - Intronic
1008592709 6:53010055-53010077 GGGAAGAAGGAGAAGGATAAAGG - Intronic
1008966609 6:57319180-57319202 GGGTGGATGGAGAAGTATGGAGG + Intronic
1009424573 6:63500244-63500266 GTTATGAAGGAGAAGTATAATGG + Intergenic
1011170028 6:84495131-84495153 GAGTGGAAGAAAAAGTAGAATGG + Intergenic
1011831559 6:91378258-91378280 GTGGGAAAAGAGAAATATAATGG + Intergenic
1012401599 6:98846051-98846073 GTGAGGAAGGAGAGGAGTAAGGG - Intergenic
1012527259 6:100192947-100192969 GTATGGAAGGAGAATTTTCAAGG + Intergenic
1013201635 6:107903372-107903394 GTATGGAAGGAAAAGAATGAGGG - Intronic
1014031977 6:116716489-116716511 GTGTGTGAGGAAAAGTACAAGGG - Intronic
1014963257 6:127713798-127713820 GTGAGAAAGGAGAAGTAGAGAGG + Intronic
1015974071 6:138771689-138771711 GTACTGAAGGAGAAGTATCAGGG - Intronic
1016403832 6:143709380-143709402 GTGTGGAAGGAGAACTCATAAGG + Intronic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1022260738 7:28702542-28702564 GTCTGGATGGAGAAGCAGAAAGG - Intronic
1022413839 7:30161238-30161260 GGGTGGGAGGAGATGAATAAGGG + Exonic
1022556884 7:31306871-31306893 ATGTGGCTGGAGAAGTATGAGGG + Intergenic
1022637768 7:32153453-32153475 GTGTGGATGGAGAAGAATGAAGG + Intronic
1023493763 7:40772151-40772173 GTGTGGAAAGTGAAGAAGAAGGG - Intronic
1024920145 7:54546285-54546307 GTGGGGAAGGAGAGGGAGAAAGG + Intronic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1026424531 7:70276946-70276968 GTGGGGAAGGGGATGTAAAATGG + Intronic
1027302739 7:76857940-76857962 ATGTGGAAGCAGACGTATTATGG - Intergenic
1028837879 7:95395103-95395125 GTTTGGAAGGAAAAGTTCAAAGG - Intronic
1029105267 7:98169881-98169903 GTTTGGAAGGAAATGTATGAAGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030858991 7:114599923-114599945 GAGTGGAAGAGGGAGTATAAGGG - Intronic
1031730862 7:125299191-125299213 ATGTGGATGGGGAAGGATAAGGG - Intergenic
1032294387 7:130622690-130622712 GTGGGGAAGGAAATGTAGAATGG - Intronic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1032872123 7:135997407-135997429 GTTCGGAAGGAAAAGAATAATGG + Intergenic
1033039127 7:137902334-137902356 GTATAGAGGGAGAAGTATGATGG - Intronic
1034158166 7:148972538-148972560 GTGGGGTAGGAGATGTATCAAGG - Intergenic
1034384785 7:150731971-150731993 GTGTGGAAGGGAAAGGAAAAAGG - Intronic
1035845133 8:2855210-2855232 GGCAGGAAGGAGAAGAATAAAGG - Intergenic
1036288349 8:7464085-7464107 GTGAGGAAGGAGAAGTGGAGGGG - Intergenic
1036333126 8:7847443-7847465 GTGAGGAAGGAGAAGTGGAGGGG + Intergenic
1036815636 8:11900982-11901004 GAGTGAAATGAGAAATATAAAGG + Intergenic
1037293622 8:17377896-17377918 GTATGGGAGGAGAAAAATAAGGG + Intronic
1037938120 8:22928606-22928628 GTGGGCAGGGAGAAGAATAAAGG + Intronic
1039647456 8:39303399-39303421 ATGTGGAGGGAAAAGTAAAAAGG - Intergenic
1041413942 8:57587017-57587039 GGGTGGAAGGGGAAGTAGAAAGG + Intergenic
1042865989 8:73357185-73357207 GTGCGGAAGGATAAGTTAAATGG - Intergenic
1043066884 8:75583902-75583924 GTGTGGAAGTAGGAATATAAGGG + Intergenic
1044787642 8:95811640-95811662 GGGTGGAAGGCAAAGTAAAAAGG - Intergenic
1045985239 8:108242312-108242334 ATGTGGATGGAGAAGCATATAGG - Intronic
1046640362 8:116722479-116722501 GTCTGGAAGGGGAGGTATAGAGG - Intronic
1046773048 8:118135906-118135928 GTGTGGAAGGAGATGTGGAAAGG - Intergenic
1047595841 8:126377171-126377193 GTGTGGATGGAGATGTATTTTGG - Intergenic
1047681286 8:127257165-127257187 GTGTGGAATGAGATGTATATAGG + Intergenic
1047753597 8:127900995-127901017 GTGTGGAAGGAGCAACATAATGG + Intergenic
1047881823 8:129202995-129203017 GTGTAGAAAGAAAAGCATAAAGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1048652977 8:136501396-136501418 GTGTTGAAGGTGAAGCCTAATGG + Intergenic
1050580077 9:7044796-7044818 GTGTGGAGAGAGAAGTAATAGGG + Intronic
1052152597 9:25136833-25136855 GTTTGGAAGTAGATGTATTAAGG + Intergenic
1056224274 9:84480208-84480230 GTGGTGAAGTAGAAGAATAAGGG + Intergenic
1057078051 9:92150359-92150381 GTGTGGAGAGAGAAATATACTGG - Intergenic
1057241802 9:93417916-93417938 GTGGGGAAAGAGTAGAATAAGGG - Intergenic
1058088415 9:100776628-100776650 GTGGGGAGGGAAAAGTATAGTGG + Intergenic
1058331824 9:103771109-103771131 GTCTGGGAAGAGAAGAATAAAGG - Intergenic
1058958676 9:109972421-109972443 GTCTGGAAGCAGAAGCAGAAGGG + Intronic
1060365039 9:123003030-123003052 GTGGGAAAGGAGAGGTAGAATGG + Intronic
1062196101 9:135275040-135275062 GAATGGTAGGAGATGTATAAAGG - Intergenic
1185906491 X:3938739-3938761 GTGTGCAAGGGCAAGTGTAAAGG + Intergenic
1186463477 X:9766084-9766106 AAGTGGAAGGAGAAGCAGAAAGG + Intronic
1186705214 X:12133631-12133653 GTGGGGAAAGAGAGGAATAAGGG - Intergenic
1187708997 X:22035283-22035305 GAGGGGAAGGAGAAGAAGAAAGG - Intronic
1188003268 X:25001422-25001444 GTTTGGAAGGAGAAGAAAATTGG + Intergenic
1188376296 X:29432774-29432796 AAGTAGAAGGAGAAGTATTATGG - Intronic
1189198288 X:39169786-39169808 GTGTGGAAAGTGAATTATAAGGG + Intergenic
1189681832 X:43525230-43525252 TTATGAAAGGAGAAGTAGAAAGG + Intergenic
1192136069 X:68601882-68601904 GTGTGGGGGGATAAGTAAAAAGG + Intergenic
1194336079 X:92647729-92647751 GTGTGGAAGATGAAGGATACCGG - Intergenic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1196679341 X:118455137-118455159 GTGAGGAAGGAGAAGTGTTAGGG + Intergenic
1196696063 X:118613320-118613342 CAGTGGCAGCAGAAGTATAAAGG + Intronic
1199241275 X:145550392-145550414 GTGTGGAAGGAGACCTAGACTGG + Intergenic
1200644511 Y:5764472-5764494 GTGTGGAAGATGAAGGATACCGG - Intergenic
1201777758 Y:17685145-17685167 GTTTGTAAGGAGAAAAATAAAGG - Intergenic
1201823800 Y:18220847-18220869 GTTTGTAAGGAGAAAAATAAAGG + Intergenic