ID: 945698091

View in Genome Browser
Species Human (GRCh38)
Location 2:213134327-213134349
Sequence TAGTGGGAAAGGAGATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 405}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945698091_945698097 3 Left 945698091 2:213134327-213134349 CCTTCCAATCTCCTTTCCCACTA 0: 1
1: 0
2: 4
3: 38
4: 405
Right 945698097 2:213134353-213134375 TAAAGTAAAAAGACAACTGAGGG 0: 1
1: 1
2: 6
3: 105
4: 803
945698091_945698096 2 Left 945698091 2:213134327-213134349 CCTTCCAATCTCCTTTCCCACTA 0: 1
1: 0
2: 4
3: 38
4: 405
Right 945698096 2:213134352-213134374 CTAAAGTAAAAAGACAACTGAGG 0: 1
1: 0
2: 3
3: 45
4: 365
945698091_945698098 4 Left 945698091 2:213134327-213134349 CCTTCCAATCTCCTTTCCCACTA 0: 1
1: 0
2: 4
3: 38
4: 405
Right 945698098 2:213134354-213134376 AAAGTAAAAAGACAACTGAGGGG 0: 1
1: 0
2: 6
3: 82
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945698091 Original CRISPR TAGTGGGAAAGGAGATTGGA AGG (reversed) Intronic
902078593 1:13805936-13805958 TGGAGGGAAAGGAGTTTGGGAGG - Intronic
902179438 1:14676758-14676780 GAGTTGGAAAGCAGATTGGTGGG + Intronic
902360057 1:15937462-15937484 GAGTGGGAAGAGAGACTGGAAGG - Exonic
904013589 1:27404179-27404201 TAATGGGACAAGAGATTAGAAGG - Intergenic
904829553 1:33298081-33298103 TTCTGGCAAAGGCGATTGGAAGG + Intronic
904879992 1:33689106-33689128 GAGTGGGAAAGAAGAAGGGAAGG + Intronic
906458345 1:46017948-46017970 TGGTGGGAAGGGAAACTGGAAGG - Intronic
907077989 1:51595333-51595355 TAGAGGGAAGGGAGGATGGAGGG - Intronic
907105593 1:51879458-51879480 AACTGGGAAAGGAGACTTGAAGG - Intergenic
907307822 1:53523335-53523357 CAGTGGGAAAGAAGATGGGAGGG - Intronic
907385339 1:54122139-54122161 TAGTGGGAAGGGAGAGTTCAAGG - Intergenic
907840860 1:58156158-58156180 GAGTGGGAAAGTATATTGTAAGG - Intronic
908075725 1:60515546-60515568 TATTGTTAAAGGAGAGTGGAAGG - Intergenic
908697658 1:66862767-66862789 TAGTGGGAAGGGAGGTGTGATGG - Intronic
909829924 1:80175078-80175100 TAGAGGGAGGGAAGATTGGAAGG + Intergenic
910526772 1:88187790-88187812 TAGTAGGAAAGGAGCCTGTAAGG - Intergenic
912514085 1:110207278-110207300 AAGATGGAGAGGAGATTGGATGG + Intergenic
912582085 1:110729966-110729988 GAGTGGGAAAGGGGATGGGGTGG - Intergenic
912755618 1:112322316-112322338 TAGAGGAAAAGGGGATTGAAAGG + Intergenic
912964211 1:114223326-114223348 TAATGGGTAAGGGGATTCGATGG + Intergenic
915993142 1:160537800-160537822 TAGTTGCAAAGGAGATTGTATGG - Intergenic
917648433 1:177051456-177051478 TAGTTGAAAAAGAGCTTGGATGG + Intronic
918255597 1:182743577-182743599 TAGTGGGAAATGATGCTGGAAGG - Intergenic
918344788 1:183597605-183597627 AAGTGGGAAAGGAGACGGGTGGG - Intronic
918428490 1:184434800-184434822 TCGTGAGCAAGGAGAATGGAGGG + Intronic
919071944 1:192766969-192766991 AAATGGAAAAGGAGATTGTAGGG + Intergenic
919076235 1:192816449-192816471 CAGTGGGAAATAAGATTGGATGG - Intergenic
920204176 1:204279614-204279636 AAGTGGTAAAGGAGATTGTGCGG + Intronic
920652463 1:207849053-207849075 TGGTGAGAGAGGAGATTGGCAGG - Intergenic
921543358 1:216446172-216446194 TAGAGGGAAGGGAGCTTGAATGG - Intergenic
921560278 1:216649462-216649484 GAGATGGAAAGGAGAATGGATGG - Intronic
921715214 1:218410863-218410885 TAGAGGGAAAGAAAATAGGAAGG + Intronic
921976951 1:221213339-221213361 TACTGGGAAAGGAGTCAGGAGGG - Intergenic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
922643451 1:227260470-227260492 TAGGGAGGAAGGAGGTTGGATGG - Intronic
924012837 1:239684862-239684884 GAGTGAGATTGGAGATTGGAGGG + Intronic
924516545 1:244770707-244770729 AAATGGGAAGGGAGATTGAAAGG - Intergenic
1063288422 10:4714938-4714960 CAGAGGAAATGGAGATTGGATGG - Intergenic
1063288463 10:4715193-4715215 TGGTGAGAAAGGAGAGTGGAGGG - Intergenic
1063441059 10:6073608-6073630 GGGTGGGAAGGGAGATGGGAAGG - Intergenic
1065289115 10:24212512-24212534 TAGAGGTCAGGGAGATTGGAAGG + Intronic
1065909258 10:30287152-30287174 GAGCTGGAAAGGAGATGGGAAGG + Intergenic
1067605194 10:47655591-47655613 TAGTGGAAATGAAGATTGAACGG + Intergenic
1068170464 10:53386913-53386935 TATTTGTTAAGGAGATTGGACGG + Intergenic
1068814444 10:61294008-61294030 TAGTCGGCCAGGAGATAGGAAGG - Intergenic
1070295737 10:75159812-75159834 TAGTGGGTTATGAGATTAGAAGG - Intronic
1070324761 10:75381030-75381052 AAGAAGGAATGGAGATTGGAGGG - Intergenic
1071090196 10:81909403-81909425 TGGTGGTAATGGAGATGGGATGG + Intronic
1071332595 10:84574734-84574756 TAGTGAGAAATGAAAATGGAGGG - Intergenic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1072241398 10:93498182-93498204 TACAGGGAAAGGAGGTTGGTGGG + Intronic
1072256157 10:93622372-93622394 AACTGGGAGAGGAGATTGGGAGG - Intronic
1072861702 10:99012912-99012934 TAATGAGAAAGCAGATTGGAAGG + Intronic
1073560926 10:104496169-104496191 TAGAGGGAAAGTACATTGCAAGG - Intergenic
1073955307 10:108864070-108864092 TAGTGGAAATGGAGAATGCATGG - Intergenic
1074121002 10:110494550-110494572 CAGTGGGAAAGGAAAATGCAGGG + Intergenic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1078707820 11:13762091-13762113 TGGAGACAAAGGAGATTGGAAGG + Intergenic
1079422502 11:20306934-20306956 CAGTAGGAAAGGTGATTGCAGGG + Intergenic
1079822557 11:25148843-25148865 TAGTGGGAGAGAAGATCGAAAGG + Intergenic
1080622667 11:33999769-33999791 TAGTAAGAAACGTGATTGGAAGG + Intergenic
1080782150 11:35439555-35439577 AAGTGGGGAAGGGGAATGGAAGG + Intronic
1081218838 11:40435677-40435699 TAGTGGAAAAACAGATTGGAGGG + Intronic
1084178868 11:67436947-67436969 GGGTGGGAGAGGAGATGGGAGGG + Intronic
1084888734 11:72226084-72226106 CAGTGGGACAGGAGTTTGGGAGG - Intronic
1085704690 11:78776156-78776178 TATTGTGAAAGGAGAATTGAGGG - Intronic
1086241503 11:84699069-84699091 TACTGGGCAAAGACATTGGAAGG - Intronic
1086242279 11:84709727-84709749 AAGTGGGAAAGGAGAAAGGGAGG - Intronic
1086650188 11:89279116-89279138 TTGAAGTAAAGGAGATTGGAAGG + Intronic
1086927296 11:92654200-92654222 TAATGGGAAACCAGATTGAAAGG - Intronic
1087362582 11:97179505-97179527 TAGTTGGAAAAGGGATTGGCTGG + Intergenic
1089096229 11:115922302-115922324 TAGGGGCAAAGGAGGTTGAAGGG - Intergenic
1090102576 11:123815628-123815650 TAGTGGTAAATTAGATAGGATGG + Intergenic
1090315132 11:125779584-125779606 TGGAGAGAAAGGAGATTGGAGGG - Intergenic
1091679688 12:2518169-2518191 TACTGAGACAGGAAATTGGAAGG + Intronic
1091840749 12:3618939-3618961 AAGTGGAAATGCAGATTGGAGGG + Intronic
1091969487 12:4773573-4773595 TGGTGGGAGAGGAGGTAGGATGG + Intronic
1094295004 12:28895984-28896006 TAGGTGGAAAAAAGATTGGAGGG - Intergenic
1095187783 12:39221875-39221897 GAGAGGGAAAGGAGAAGGGAGGG - Intergenic
1095512340 12:42966076-42966098 TAGCAGGAAGGGAGATGGGAAGG + Intergenic
1098027104 12:66215250-66215272 GAGTAGGAAAGTAGACTGGACGG - Intronic
1098088342 12:66872867-66872889 CAGTGGGTCAGGAAATTGGATGG + Intergenic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1098663224 12:73126310-73126332 TGGTGGGAAATGAGTTTGGATGG - Intergenic
1098724324 12:73943807-73943829 CAGTGGGAAAGGAGATTTCAAGG - Intergenic
1100836390 12:98570964-98570986 GGGTAGTAAAGGAGATTGGACGG + Intergenic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101377584 12:104184253-104184275 TGGTTGGAGAGGAGTTTGGATGG - Intergenic
1101814856 12:108138229-108138251 CACTGGGACAGGACATTGGATGG + Intronic
1102585219 12:113918284-113918306 TAGGTGGAAAGGACATTGAAGGG + Intronic
1104054871 12:125221843-125221865 TTGTGGGAAGGGAGATTGGAAGG + Intronic
1104772699 12:131373469-131373491 AAGTGGGAATGGAGATGTGAAGG - Intergenic
1104937500 12:132374390-132374412 AAGTGTGAAAGGAGGCTGGAGGG - Intergenic
1105710246 13:23001041-23001063 TGGGGGGAAAGGATGTTGGAAGG + Intergenic
1106005222 13:25763567-25763589 TAGTGGGAAAGGATAGTGGCAGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106406980 13:29482999-29483021 TAGTGGGAGAGGAGACTCAAGGG + Intronic
1106450140 13:29873825-29873847 TAGTAAGAAAGGGGATTTGAAGG - Intergenic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1106977233 13:35234561-35234583 CAGTGGGAAATGAGACTAGATGG + Intronic
1107448013 13:40485300-40485322 CATTTGGAAAGGAGATGGGAGGG + Intergenic
1107559901 13:41549624-41549646 TAGTGGGGAAGGTGATGAGAGGG + Intergenic
1107767849 13:43756501-43756523 GAGAGGGAAAGGAGAGGGGAGGG + Intronic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1107867387 13:44716039-44716061 CTGTGGGAAAGGAGATTAGCTGG - Intergenic
1110545204 13:76748341-76748363 TAGGGAGAAAGGAGATAGAAAGG - Intergenic
1111477484 13:88771497-88771519 AAGGGGGAAAGGAGAGTGAAGGG - Intergenic
1112681828 13:101775725-101775747 TAATGTGAAATGAAATTGGAAGG + Intronic
1112728146 13:102328904-102328926 TAAGGGGAGAGGAGAATGGAGGG - Intronic
1112763399 13:102715403-102715425 TGGTGGGGAAGGAGAATGGAGGG + Intergenic
1112796893 13:103066932-103066954 TACTGGGAGTGGAAATTGGATGG - Intergenic
1114038291 14:18650244-18650266 TAATGGGAAAGGAGAGAGGCGGG - Intergenic
1114120330 14:19664798-19664820 TAATGGGAAAGGAGAGAGGCGGG + Intergenic
1114297222 14:21340822-21340844 TAGTGGAATAGGAGAATGCATGG - Intronic
1114700076 14:24668226-24668248 TATTGGGAAAGGAAAAAGGAAGG + Intergenic
1114805641 14:25833296-25833318 TATGGGGAAAGGAGCCTGGAGGG + Intergenic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1119310903 14:73645329-73645351 GAGTGGGAAGGGTGATGGGAAGG + Intronic
1121025585 14:90613791-90613813 TAGAGCGAAAGGAAACTGGAAGG + Intronic
1121463069 14:94096936-94096958 CCATGGGAAAGGAGAGTGGATGG + Exonic
1122874489 14:104657390-104657412 TTGTGGGATAGGAGATGGCACGG - Intergenic
1125182626 15:36895066-36895088 CAGTGGGATAGTAGAGTGGATGG + Intronic
1125253024 15:37728045-37728067 TGGTGGGAGATGAGGTTGGAAGG - Intergenic
1125532590 15:40423327-40423349 GAGTGGGAATGGGGATAGGAGGG - Intronic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125767256 15:42144047-42144069 CAGTGGGAACGGAGAGTTGATGG + Exonic
1127011874 15:54640132-54640154 TAGTGGGAATACAGATTAGATGG - Intergenic
1127210565 15:56770510-56770532 TTGAGAGAAAGGATATTGGAGGG - Intronic
1127647373 15:60971980-60972002 GAATGGGAGAGGAGAGTGGATGG + Intronic
1127743535 15:61938755-61938777 TAATGGGAAACGAGATCTGAAGG - Intronic
1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG + Intergenic
1128383297 15:67129086-67129108 TAGGGGGACAGGAGTGTGGAAGG - Intronic
1128466234 15:67914910-67914932 GAGAGGGAGAGGAGATAGGAAGG - Intergenic
1128550741 15:68596518-68596540 TGGTGGGAAAGGAGATTGAAGGG + Intronic
1128596559 15:68956984-68957006 TAGTGCGGATGGAGATTGGATGG + Intronic
1128750190 15:70143258-70143280 GGGTGGGAATGGAGATTGGAGGG + Intergenic
1129475013 15:75779252-75779274 TGCTGTGAAAGGAGGTTGGAGGG - Intergenic
1129838791 15:78730846-78730868 TGCTGTGAAAGGAGGTTGGAGGG - Intergenic
1130427372 15:83814774-83814796 TATTGGGAGAGGGGATTGGGAGG + Intronic
1130560060 15:84951077-84951099 TAGTTGGAATGCAGATGGGAAGG + Intergenic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1131081379 15:89539130-89539152 GAGTGGGAAAGAAGGATGGAGGG + Intergenic
1131649065 15:94379097-94379119 TGGAGAGCAAGGAGATTGGAAGG + Intronic
1132142227 15:99405580-99405602 TAGTAGGAAAGGAGAATGGAGGG + Intergenic
1132212729 15:100036327-100036349 TAATGGGAAAGGACAGAGGAAGG + Intronic
1133886517 16:9833522-9833544 TGTTGGGAAAGCAGATTTGAAGG - Intronic
1135765362 16:25173008-25173030 AGGCGGGTAAGGAGATTGGAAGG + Intronic
1136238336 16:28928652-28928674 TAGTGAGAAAGGAGAATAAAAGG + Intronic
1137284619 16:47004876-47004898 ATGTGGTAAAAGAGATTGGAAGG + Intergenic
1137688220 16:50401766-50401788 GAGTGGGGAAGGACATGGGAGGG - Intergenic
1138272575 16:55706348-55706370 CTATGGAAAAGGAGATTGGAAGG + Intergenic
1138383249 16:56618054-56618076 AAGTGGGAAAGGAGCTCTGAGGG + Intergenic
1138384407 16:56626343-56626365 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138385506 16:56633217-56633239 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138386064 16:56636316-56636338 GAGTGGGAAAGGAGCTCTGAGGG + Intergenic
1138388451 16:56652448-56652470 GAGTGGGAAAGGAGCTCTGATGG + Intronic
1138389309 16:56658549-56658571 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138390548 16:56667477-56667499 GAGTGGGAAAGGAGCTCTGAGGG - Intronic
1138391109 16:56670383-56670405 GAGTGGGAAAGGAGCTCTGACGG + Intronic
1138615494 16:58162115-58162137 GGGTGATAAAGGAGATTGGAGGG + Intronic
1138637423 16:58352191-58352213 GAGTGGAGAAGGAGGTTGGATGG - Intronic
1139109353 16:63869947-63869969 TAATGAGAAGGGATATTGGATGG + Intergenic
1140767212 16:78171382-78171404 TAGTGTCAAAGGAGATTGCATGG - Intronic
1140858031 16:78994999-78995021 TAATGGGAAAGGAGAGAGGCTGG - Intronic
1141065173 16:80908424-80908446 TAGTTGGTAAGGACAATGGAAGG - Intergenic
1141259492 16:82439879-82439901 TGGTGGAAAAGGAGACAGGAAGG - Intergenic
1143216847 17:5231611-5231633 GTGTGGGGAAGGTGATTGGAGGG - Intronic
1143504156 17:7354787-7354809 CAGTGGGGGAGGAGATGGGAAGG + Exonic
1143767828 17:9149228-9149250 TCTAGGGAAAAGAGATTGGAAGG + Intronic
1144355522 17:14442501-14442523 GAGAGGGAAAGGAGAGTTGAGGG - Intergenic
1145863638 17:28226973-28226995 TGGTGGGAAACTGGATTGGAGGG + Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146541462 17:33699353-33699375 TAGTGGGGAAGGAGACATGAGGG - Intronic
1147369826 17:39984697-39984719 TAGTGGGAAATGAGTTTGGCTGG - Intronic
1147653643 17:42076245-42076267 GAGTGGGAAAGGGCATGGGAAGG - Intergenic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148720874 17:49752355-49752377 TAGTGGGAAAGAAGCCTGGGGGG - Intronic
1148816124 17:50329385-50329407 AAGTGGGAGAGGAGAAGGGAGGG - Intergenic
1148898355 17:50854482-50854504 TTTTGGGAAAAGAGATTTGAGGG + Intergenic
1149059167 17:52401521-52401543 TATGGGGAAAGGAGATATGACGG - Intergenic
1150415644 17:64986336-64986358 TTGTGGGAAAGAAGCTTTGAGGG - Intergenic
1151488777 17:74419394-74419416 TCCTGGGAAAGGAGGTTTGATGG - Intergenic
1151851093 17:76690228-76690250 TCTTGGGAAAGGAGCTTGGGGGG + Intronic
1152119748 17:78411230-78411252 TGGTGGGCACTGAGATTGGAGGG + Intronic
1152298644 17:79482935-79482957 TAGTGGGAAAGGCGATGGGGAGG - Intronic
1152430292 17:80245125-80245147 TGGAGGGAAAGGAGATGGGGAGG - Intronic
1153745787 18:8178345-8178367 TAATGAAAATGGAGATTGGAGGG - Intronic
1153851421 18:9098890-9098912 TAATCAGAAAGGAGAATGGAAGG - Intergenic
1155120755 18:22816581-22816603 CACTGGGAAAGGAGAAGGGAGGG + Intronic
1155965177 18:32028847-32028869 TAGTGGTAAAGAAAATTGGCTGG - Intronic
1156077990 18:33303813-33303835 TTGTGAGAAAGGAAATTGGGAGG + Intronic
1156291042 18:35748727-35748749 AAGAGGAAAAGGAGATGGGAGGG - Intergenic
1156718294 18:40039300-40039322 TAGGGGGAAAGGAGAAAGAAAGG - Intergenic
1156718936 18:40046421-40046443 TAATTGGAGAGGAGATTGCATGG + Intergenic
1156869508 18:41929196-41929218 TAGTGAGAAAGGAAATGAGATGG - Intergenic
1157197159 18:45628962-45628984 GTGAGGGAAAGGAGACTGGAAGG + Intronic
1157268490 18:46249761-46249783 TGGAGGAAAAGGAGATAGGATGG - Intronic
1157418289 18:47524299-47524321 TTGTGGGAAAATGGATTGGAAGG - Intergenic
1157420959 18:47547133-47547155 TAGAGGGAGAGGAATTTGGAGGG + Intergenic
1157434869 18:47659833-47659855 AAGTGGAAAAGGGAATTGGAAGG - Intergenic
1158119078 18:54028491-54028513 TGGTTAGGAAGGAGATTGGATGG - Intergenic
1159194208 18:65090837-65090859 GAGTGGGGAAGGAGAAGGGAGGG - Intergenic
1159679068 18:71325040-71325062 TTGTATGAAAGGAGATTGAATGG + Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1161939086 19:7391465-7391487 TAGTGGGAGAGAAGCGTGGAGGG - Intronic
1163823864 19:19511924-19511946 GAGAGGGAAAGGAGATGGCAAGG - Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1165662903 19:37597779-37597801 TAGTTGCAATGGAGATTGTATGG - Intronic
1167013680 19:46825565-46825587 GAGGGGGGAATGAGATTGGAGGG - Intergenic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
926078532 2:9963615-9963637 TAGGTGGAAAGGACTTTGGAAGG - Intronic
927974411 2:27327134-27327156 TGGGGGGAAATGAGAGTGGAGGG + Intronic
928360957 2:30661995-30662017 TAATGAGAAAGGAGCTAGGAAGG - Intergenic
928456724 2:31429046-31429068 TAGTGGGAAATGAGGCTGGAAGG - Intergenic
929077090 2:38086786-38086808 TCATGGGCAACGAGATTGGAAGG - Intronic
929654428 2:43716268-43716290 TAGTGGGAAGGCACACTGGAAGG + Intronic
931050436 2:58407671-58407693 CAGTGGCAATGGAGATGGGATGG - Intergenic
931120971 2:59219349-59219371 GATTGGGAAAGGAAATAGGATGG + Intergenic
931719614 2:65057402-65057424 GGGTGGGAAAGGGGAATGGAGGG - Intronic
932093409 2:68826290-68826312 GAGAGGGAAAGGACATTTGAGGG + Exonic
934137777 2:89014711-89014733 TATTTGAAAAGGAGCTTGGATGG - Intergenic
934231471 2:90185916-90185938 TATTTGAAAAGGAGCTTGGATGG + Intergenic
935354621 2:102187309-102187331 CAGCGGGAAAGGAGAAAGGAAGG - Intronic
935677595 2:105609371-105609393 GAGTGTGAATGGAGATAGGATGG + Intergenic
936647535 2:114388992-114389014 TGGTTGGAAAGGAGTTTGGCTGG + Intergenic
938272671 2:129988856-129988878 TAATGGGAAAGGAGAGAGGCAGG + Intergenic
938443565 2:131357259-131357281 TAATGGGAAAGGAGAGAGGCGGG - Intergenic
939013314 2:136872712-136872734 TAGAAGAAAAGGAGATTGGGAGG + Intronic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939741297 2:145910564-145910586 TAAAAGGAAAGGAAATTGGAAGG - Intergenic
940322385 2:152390678-152390700 GAGTGGGAAAGAAGGTTGGATGG - Intronic
940984452 2:160038676-160038698 GAATCAGAAAGGAGATTGGAAGG + Intronic
941139196 2:161756597-161756619 CAGTGGGCAAGGAGATTAGGTGG - Intronic
941474813 2:165937887-165937909 TAGTGTGAAATGATATTTGAAGG - Intronic
942207229 2:173631242-173631264 AAGTTGGAAAGGAGATTCGTGGG + Intergenic
943904794 2:193485666-193485688 TAATGGGAAAATAGTTTGGATGG + Intergenic
944682380 2:202088849-202088871 TAGAGGGAATGGAGAGTGCATGG - Intronic
945157981 2:206859359-206859381 CAGTTAGAAAGTAGATTGGAAGG - Intergenic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
945743790 2:213695810-213695832 TAGTGGGAGATGAGATTAGAAGG + Intronic
946077985 2:217091596-217091618 TAGAAGGAAGGGAGAATGGAAGG + Intergenic
946286048 2:218703655-218703677 TAGTAGGAAATGAGACAGGAAGG + Intergenic
946916552 2:224528799-224528821 TATTCTGAAAGGAGATTAGAGGG - Intronic
947737271 2:232462355-232462377 TACTTGGTAAGGAGATTGGGTGG - Intergenic
947940854 2:234053905-234053927 GAGAGGGAAAGGAGATGGGGAGG + Intronic
1169023248 20:2346372-2346394 TTGCAGGAAAGGAGATTGGGAGG - Intergenic
1169318679 20:4613304-4613326 AAGTGGGAAAGACCATTGGAAGG + Intergenic
1169986346 20:11449372-11449394 TAGTGGGAAAAGAAGTTGTAAGG + Intergenic
1170102182 20:12714531-12714553 TAGAGGGAAAGGCCATAGGAAGG - Intergenic
1170307827 20:14959471-14959493 TAGTGGGACAGAGGACTGGATGG - Intronic
1170686234 20:18571929-18571951 TAGTGGTAAAGGGAATGGGAAGG - Intronic
1171879705 20:30609551-30609573 TAGTGGGAAAGGAATATGGATGG + Intergenic
1172050927 20:32117386-32117408 TTATGGGAAAGGAGATTGCAAGG + Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173562105 20:44013309-44013331 GAGAGAGAAAGGAGATTGGAGGG - Intronic
1173796147 20:45861525-45861547 CAGCAGGAAAGGAAATTGGAGGG + Intronic
1173946566 20:46955894-46955916 TAGTTGAAATGGAGATTGCATGG - Intronic
1173978734 20:47206872-47206894 ATGTGGGAAGGGGGATTGGAGGG + Intergenic
1174707504 20:52671314-52671336 TAGAAAGAAAGGAAATTGGATGG + Intergenic
1175527814 20:59647602-59647624 TAGTGGGGAAAGAGATGGAAAGG - Intronic
1175532321 20:59682483-59682505 TAGTGGGAGAGGACAATGAACGG + Intronic
1178202639 21:30425450-30425472 TAGGTGGAAAATAGATTGGATGG + Exonic
1179064720 21:38014445-38014467 TCTTGGGAAGGGAGGTTGGAGGG + Intronic
1179430404 21:41317207-41317229 TACTTGGAAAGTAGATTGGTGGG + Intronic
1180099043 21:45575827-45575849 TGGTGGGAAAGGAGCTTCGTGGG - Intergenic
1180462413 22:15577285-15577307 TAATGGGAAAGGAGAGAGGCAGG - Intergenic
1180901414 22:19376142-19376164 AAGTGGGAAAGGTGAGTGGCTGG - Intronic
1181711133 22:24690620-24690642 TAATGAGAAAGCAAATTGGAAGG - Intergenic
1182218956 22:28742604-28742626 TAGAGGGGAGGGAGATTTGAGGG + Intronic
1182662159 22:31932943-31932965 TCGTGGGAAAATAGACTGGAGGG + Intergenic
1184131275 22:42518145-42518167 TAGCTGGAAAGGAAATGGGAGGG + Exonic
1184141497 22:42580357-42580379 TAGCTGGAAAGGAAATGGGAGGG + Intergenic
1184306535 22:43606874-43606896 ATGTGGGAAATGAGAGTGGACGG - Intronic
1185020874 22:48374113-48374135 AAGTGGGGAAGGGGATTGGAAGG - Intergenic
949903496 3:8839051-8839073 GAGTGGGCCAGGAGATGGGAAGG + Intronic
951364317 3:21762249-21762271 TAGTGGAAAGGAAGAATGGACGG - Intronic
951837366 3:26998039-26998061 GAGAGGGAAGGGGGATTGGATGG - Intergenic
952200207 3:31118364-31118386 TACTGGGGGAGGAGAATGGAGGG + Intergenic
952219789 3:31313533-31313555 TGGGGGTAAAGGAGAGTGGAGGG - Intergenic
955546426 3:60035717-60035739 TAGTGAGAAACAAAATTGGAAGG - Intronic
956138893 3:66126114-66126136 AATTGGGAAAGGAGATGGAAAGG + Intergenic
957895529 3:86416909-86416931 TAGTAGGAAAGGAGATACAAAGG - Intergenic
958901653 3:99894174-99894196 TAATAGAAAAGGAGATAGGATGG + Intronic
962055878 3:131871067-131871089 TAGGGGGAAAAGAGATATGAAGG + Intronic
962237374 3:133718080-133718102 TGGTGGGAAGGGAGAGTGGTGGG + Intergenic
962614155 3:137107765-137107787 TTCTGGGAAAGGAGAAAGGAAGG - Intergenic
962838780 3:139214761-139214783 TAGTGGGATAGGACTTTGGCTGG + Intronic
963625583 3:147668294-147668316 TAGTGGGTGAGAAAATTGGAGGG - Intergenic
963859870 3:150298001-150298023 TTGAGGGAGTGGAGATTGGACGG + Intergenic
964877906 3:161390170-161390192 TAGTGGCAAAGGGGAAAGGATGG + Intergenic
965103642 3:164333634-164333656 TAGTTGGAAAGGAGATTATGAGG + Intergenic
965301106 3:167005951-167005973 TAGTAGGAAAGAAGATGGGGAGG + Intergenic
965505869 3:169514082-169514104 TAGGGGGAAAGGAGTTGAGATGG + Intronic
966300746 3:178476869-178476891 TAGAGGAGAAGGAGAGTGGAAGG + Intronic
966457428 3:180133675-180133697 CAGTGAGAAAGGAGAGCGGAAGG - Intergenic
968395457 4:232599-232621 TAGGAGGAAAGGAGATTGTAAGG - Intergenic
968414284 4:416724-416746 TAGGAGGAAAGGAGATTGTAAGG - Intergenic
972007072 4:34122902-34122924 TTGGGGGAAAATAGATTGGATGG - Intergenic
972078808 4:35123063-35123085 TAGTTGGAATGGAGACTGTATGG + Intergenic
972787504 4:42340943-42340965 TAGAGGTAAAGGAGATAGGGCGG + Intergenic
974203960 4:58675299-58675321 AAGGGGGAAATGAGATTGGCAGG + Intergenic
974586208 4:63881598-63881620 TAGTGAGAAAGAGGATTGGCTGG + Intergenic
975119691 4:70715156-70715178 TTCTGGGAAAGGAGGTGGGAGGG + Intronic
975284775 4:72604581-72604603 CAGTGAGAAATAAGATTGGATGG - Intergenic
975350218 4:73337936-73337958 GAGAGGAAAAGGAGATTGTAGGG - Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976650907 4:87433633-87433655 AAGTGGGAAAGGAGATTCTGAGG - Intronic
977992973 4:103466843-103466865 TTGAGGGAAAGGAGAAAGGAAGG + Intergenic
978003204 4:103582461-103582483 TAGTGCTAAAGGAGAGAGGAAGG - Intergenic
978682014 4:111392707-111392729 TAGTGGGAAAGGAGACTCCAGGG + Intergenic
979188114 4:117824302-117824324 GAGCTGGAAAGGAGATAGGAAGG - Intergenic
981227675 4:142315787-142315809 TGGAGAGAAAGGGGATTGGAGGG + Intronic
982818408 4:159916069-159916091 TAATGGGAGAGGAGGTTGAAGGG + Intergenic
982913149 4:161171419-161171441 AAATTGGAAAGGAGATTAGAAGG - Intergenic
984898983 4:184567717-184567739 GAGGGGAAAAGAAGATTGGAGGG + Intergenic
985701892 5:1378468-1378490 TGGTGCGAAATGAGATTGCAGGG - Intergenic
990051498 5:51507083-51507105 TTGTGGGGAAGGGGGTTGGAGGG - Intergenic
990718365 5:58664843-58664865 TAGTAGGAAATGAGCTGGGAAGG - Intronic
991343747 5:65640498-65640520 TAGTTGAAACGGAGATTGTATGG + Intronic
992019281 5:72606375-72606397 AAGTGGGAATGAAGAGTGGATGG - Intergenic
993007281 5:82442209-82442231 TATTGGGAGGGGAGATGGGAAGG + Intergenic
993618833 5:90144748-90144770 TATGGTGAAAGGAGCTTGGAAGG - Intergenic
993707308 5:91185800-91185822 AAGTGGGAAAGCAGAAAGGAGGG - Intergenic
993713632 5:91252822-91252844 CAATTGGAAATGAGATTGGATGG - Intergenic
995867363 5:116706055-116706077 TTGAGGGAAAGGAAAGTGGAAGG - Intergenic
995996445 5:118306344-118306366 TAGTCGGTCTGGAGATTGGAGGG - Intergenic
996422410 5:123277449-123277471 TAGTTGGGAAGGGGATAGGATGG - Intergenic
996695105 5:126385759-126385781 TACTGGGAAAGTAGAGTAGAAGG + Intronic
998839715 5:146240200-146240222 TAGTAGGAAAGAAGATTGGGGGG - Intronic
1002942993 6:1733983-1734005 TAGTGGGACAGGGGAAAGGAGGG + Intronic
1003425423 6:5995496-5995518 CCGTGGGAAAGGAAATCGGACGG - Intergenic
1004697501 6:18047410-18047432 CAATGGGAAAGGAGGCTGGAGGG - Intergenic
1006378511 6:33684722-33684744 TGGTGTGACAGGAGAGTGGAAGG - Intronic
1007395287 6:41574223-41574245 TAGGGGGAAGGCAGATTTGAAGG + Intronic
1007408110 6:41646317-41646339 TAGGGGGCCAGGAGGTTGGATGG + Intronic
1008095590 6:47336400-47336422 GAGTGAGAAAGGAGATTGGCAGG - Intergenic
1009732420 6:67626007-67626029 TAGTAGAAAAGGGGTTTGGAAGG - Intergenic
1010359323 6:74974277-74974299 TTGCGGGAAAGGAGGTTTGATGG - Intergenic
1010767753 6:79795792-79795814 CTGTGGGAAAGGGGATTTGAGGG - Intergenic
1011166890 6:84458564-84458586 TAGGAGCAAAGGTGATTGGAGGG + Intergenic
1011340560 6:86308304-86308326 TAGGAGAAAAAGAGATTGGAAGG + Intergenic
1012606294 6:101161920-101161942 TTGTGGGAAAGGAAATTTAAGGG + Intergenic
1012961801 6:105630141-105630163 AATTGGGAGAGGACATTGGAAGG + Intergenic
1014489837 6:122048662-122048684 TATGGGGGAAGGAGAATGGATGG - Intergenic
1017274235 6:152547306-152547328 AATAGGGGAAGGAGATTGGAAGG + Intronic
1018456820 6:163960799-163960821 GAGTGGGAAAGGAGATGACAGGG - Intergenic
1019184052 6:170210609-170210631 TGGTGGGAAAGGAGAGTGAAGGG + Intergenic
1019883631 7:3884966-3884988 AAATTGGAAAGGAGATAGGAAGG + Intronic
1020488546 7:8749603-8749625 CAGTGTGGAAGGAGACTGGAGGG + Intronic
1021182913 7:17529223-17529245 GAGTGGGAAAGGAGATTAGGAGG - Intergenic
1022251027 7:28608575-28608597 TGGTGGGGAGGGAGATTGGGAGG - Intronic
1022465950 7:30653359-30653381 TCGTGGGGCAGGAGATGGGAGGG - Exonic
1023867664 7:44245948-44245970 AAGGAGGAAAGGAGATTGGAAGG + Intronic
1023993520 7:45144960-45144982 TAGCGGGAAAGATGGTTGGAGGG + Intergenic
1024159891 7:46663427-46663449 GAGTGGGGAAGGGGAGTGGAAGG - Intergenic
1027927141 7:84480292-84480314 TACTAGGAATGGAGAATGGAAGG + Intronic
1028167673 7:87556975-87556997 TGGTGGGAACAGAGATGGGATGG - Intronic
1028837880 7:95395116-95395138 TTTTGGGAAAGCAGTTTGGAAGG - Intronic
1029681573 7:102114920-102114942 GAGTGGGAAAGAAGAAAGGAAGG + Intronic
1030223105 7:107118760-107118782 GGCTTGGAAAGGAGATTGGAGGG + Intronic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031422836 7:121569829-121569851 GAGTGGGGAAAGAGGTTGGAGGG - Intergenic
1032504529 7:132425414-132425436 TGGTGGGAAAGGGGAGGGGAAGG + Intronic
1033021895 7:137733901-137733923 TAATGGAGAAGTAGATTGGAGGG - Intronic
1034213158 7:149382695-149382717 AAGTGGGAAAGGATGTTGGATGG + Intergenic
1034576702 7:152006063-152006085 AACTGGCAAAGGAGATGGGAAGG + Intronic
1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036556851 8:9867629-9867651 GAGTAGGGAAGGAGATTGCATGG + Intergenic
1036716985 8:11134607-11134629 TTTTTGGAAAAGAGATTGGATGG + Intronic
1037479304 8:19289197-19289219 GAGCGGGGAAGGGGATTGGAGGG + Intergenic
1037654198 8:20868873-20868895 AGGTGGGAAGGGAGAATGGATGG - Intergenic
1037702276 8:21285933-21285955 TAGTGGGAAAATACACTGGATGG + Intergenic
1039306621 8:36270124-36270146 TAGTGGGTAAGGGGAATTGAGGG + Intergenic
1039612055 8:38927933-38927955 TGGTGGGAATGGAGAGTGGGGGG + Intronic
1040057318 8:43070420-43070442 TAATGGGAAAAGAGATTAAATGG + Intronic
1040097856 8:43465027-43465049 TAGAGAGACAGGAAATTGGAAGG - Intergenic
1040986314 8:53297603-53297625 TAGAGGAAAAGGAGATTTGGAGG - Intergenic
1042490603 8:69393411-69393433 TAGGGGGAGGGGAGATTGAAAGG - Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1044465272 8:92495774-92495796 TATAGGAAAAGGAGATTAGATGG - Intergenic
1046328928 8:112688035-112688057 TAGTTGCAAAGGAGATCGTATGG - Intronic
1046427399 8:114072894-114072916 TAGTGTGCAAAGACATTGGATGG + Intergenic
1046803605 8:118455728-118455750 TGGTGGGAGAGCAGATTTGAGGG - Intronic
1046958661 8:120086978-120087000 TAGAACTAAAGGAGATTGGAAGG + Intronic
1048236873 8:132699581-132699603 AAATGGGAAAGGATATTTGAAGG - Intronic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1051443973 9:17120798-17120820 TACTGGGAAAGGAAACTGAAGGG - Intergenic
1052109928 9:24569004-24569026 GTGTGGGAATGAAGATTGGAAGG - Intergenic
1055165124 9:73182335-73182357 TAGTAGGAAAAGACATTGGTGGG + Intergenic
1055418471 9:76110036-76110058 TAGTGTAAGAGGAGATTGCAAGG - Intronic
1055652419 9:78419335-78419357 AAGTGGCAAAGGAGGATGGATGG + Intergenic
1055905000 9:81283225-81283247 TAGAGGGAAAGTAAAATGGAGGG + Intergenic
1057562834 9:96141375-96141397 TAGTGAGAAATGAGAAGGGAAGG - Intergenic
1058321416 9:103636264-103636286 TAGTCAGAAAGGAGTTTGGCTGG + Intergenic
1059405617 9:114097080-114097102 GGGTGTGAAAGGAGTTTGGAAGG + Intronic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1060151267 9:121289801-121289823 TAGTGGGCAATGAGACTGCAAGG + Intronic
1060716958 9:125940827-125940849 TTGGGGGAATGGTGATTGGAAGG + Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG + Intronic
1185511473 X:667888-667910 GAGGGGGAAAGGAGATGGGATGG - Intergenic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1186020571 X:5251065-5251087 AAGAGGGAAAGAAGAATGGAAGG + Intergenic
1186269305 X:7867481-7867503 TAGTTGGAAAGGAGAATTGTGGG - Intergenic
1186576599 X:10772889-10772911 TAGTGAAAAGGGAGTTTGGAAGG + Intronic
1186589635 X:10916503-10916525 TACAGGGACAGGAGATTGGGTGG + Intergenic
1186818373 X:13260586-13260608 AGGTGGGAAGGGAGGTTGGAGGG - Intergenic
1187492028 X:19761098-19761120 GAGTGGAACAGGAGGTTGGAAGG + Intronic
1187514775 X:19959065-19959087 TAGAGGGAAAGGAGACTGAAAGG - Intronic
1188257546 X:27981035-27981057 TAGTGGGAGAGGAGACAGAAAGG - Exonic
1188580415 X:31705155-31705177 TAATTGGAGAGTAGATTGGAGGG + Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189362265 X:40362080-40362102 AAGTGGGAAGGCAGATTGGTGGG + Intergenic
1190009507 X:46771976-46771998 TAGAAGAAAAGGATATTGGAGGG - Intergenic
1190088459 X:47416903-47416925 TAGAGGGAAAGTAGGTTGCAAGG + Intergenic
1190434579 X:50410791-50410813 AAGTGGGAAAAGAGAGTTGAAGG + Intronic
1192139548 X:68636037-68636059 ATGTTGGAAAGCAGATTGGAGGG + Intergenic
1192157740 X:68759015-68759037 TAGAGGAGAAGGAGATGGGAGGG + Intergenic
1192424040 X:71060070-71060092 ATGGGGGAAAGGAGAATGGAAGG + Exonic
1192837055 X:74811290-74811312 TATTTGGAGATGAGATTGGAAGG - Intronic
1193379878 X:80806969-80806991 AAGTGGCAAAGGAGATTAAAAGG - Intronic
1193445524 X:81597087-81597109 TAGTGGGAGAGCAGGTTGGAAGG + Intergenic
1193586142 X:83323860-83323882 TTGTGAGAGAGGAGATTGAAAGG - Intergenic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1195455735 X:105067284-105067306 TAGGTGGAAAGGAGATGGAAAGG - Intronic
1195455773 X:105067853-105067875 TAGGTGGAAAGGAGATGGAAAGG - Intronic
1196759232 X:119186184-119186206 TAATGAGAAAGCAAATTGGAAGG + Intergenic
1197311824 X:124914773-124914795 TAGAGGGTAACAAGATTGGATGG - Intronic
1198229738 X:134677620-134677642 TAGTGAGTAAGGAGAGTGGTAGG + Intronic
1198591451 X:138187752-138187774 CAATGGGAAAGAAGAATGGATGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1201512454 Y:14780238-14780260 TAGAGGCAGTGGAGATTGGAGGG - Intronic
1201614472 Y:15881978-15882000 TAGTGGGAAAGTAAATTAGTTGG - Intergenic
1201615896 Y:15897797-15897819 TAGTGGGAAAGTAAATTAGTTGG + Intergenic