ID: 945703181

View in Genome Browser
Species Human (GRCh38)
Location 2:213197532-213197554
Sequence ACAGGGAAGCAAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945703172_945703181 16 Left 945703172 2:213197493-213197515 CCTATATTGGAATGTCAACCCCA No data
Right 945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG No data
945703177_945703181 -4 Left 945703177 2:213197513-213197535 CCAAGGAGCAAGCACTAGGACAG No data
Right 945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG No data
945703176_945703181 -3 Left 945703176 2:213197512-213197534 CCCAAGGAGCAAGCACTAGGACA No data
Right 945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG No data
945703175_945703181 -2 Left 945703175 2:213197511-213197533 CCCCAAGGAGCAAGCACTAGGAC No data
Right 945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG No data
945703170_945703181 30 Left 945703170 2:213197479-213197501 CCACATGGGTGAGTCCTATATTG No data
Right 945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945703181 Original CRISPR ACAGGGAAGCAAAATGAGGA AGG Intergenic
No off target data available for this crispr