ID: 945705752

View in Genome Browser
Species Human (GRCh38)
Location 2:213229307-213229329
Sequence AAGTGGTATTTTTAAATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945705750_945705752 -10 Left 945705750 2:213229294-213229316 CCTGGATAATAGTAAGTGGTATT No data
Right 945705752 2:213229307-213229329 AAGTGGTATTTTTAAATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945705752 Original CRISPR AAGTGGTATTTTTAAATGGT AGG Intergenic
No off target data available for this crispr