ID: 945709839

View in Genome Browser
Species Human (GRCh38)
Location 2:213282126-213282148
Sequence AAAGCACTTATAACCATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 866
Summary {0: 1, 1: 0, 2: 19, 3: 150, 4: 696}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945709839_945709840 13 Left 945709839 2:213282126-213282148 CCAGACATGGTTATAAGTGCTTT 0: 1
1: 0
2: 19
3: 150
4: 696
Right 945709840 2:213282162-213282184 TTAGTCTTCATACTTTAGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 151
945709839_945709841 17 Left 945709839 2:213282126-213282148 CCAGACATGGTTATAAGTGCTTT 0: 1
1: 0
2: 19
3: 150
4: 696
Right 945709841 2:213282166-213282188 TCTTCATACTTTAGTAAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945709839 Original CRISPR AAAGCACTTATAACCATGTC TGG (reversed) Intergenic
901985764 1:13074131-13074153 AAAGCACTGCTGACCATGCCAGG + Intronic
901996045 1:13152636-13152658 AAAGCACTGCTGACCATGCCAGG - Intergenic
902096683 1:13951384-13951406 AAAGCACTTAGACCCATGCCTGG + Intergenic
902772896 1:18656114-18656136 AATGCGCTTATAACAATGCCTGG + Intronic
902954611 1:19916825-19916847 AAAGCACTTACAACAGTGCCTGG + Intergenic
903142781 1:21349308-21349330 AAAGCACCTGCCACCATGTCTGG - Intergenic
903434564 1:23336951-23336973 AAAGCACTTAGAATAATGCCTGG - Intronic
903683892 1:25116940-25116962 TAAGCACTTAGAAGAATGTCAGG + Intergenic
903872314 1:26445206-26445228 AAAGCACTTAGACCAATATCTGG + Intronic
904865833 1:33578246-33578268 CAAGCACTTAGAACAATATCTGG - Intronic
904960122 1:34326032-34326054 AAAGCACTTAGAACTATCCCTGG - Intergenic
904973049 1:34434158-34434180 GAAGCACTTAGAACAGTGTCTGG + Intergenic
905237412 1:36559692-36559714 AAAGCACTTAGAATCAAGCCTGG - Intergenic
905356637 1:37389424-37389446 AAAGCACTTAGAACAGTGCCCGG - Intergenic
905535288 1:38716441-38716463 TAAGCCCTTAAAACAATGTCTGG - Intergenic
905560279 1:38921105-38921127 AAAGCACTTAAAACAGTATCTGG + Intronic
905588440 1:39140947-39140969 AAAGCATTTATAACAGTGACTGG - Intronic
905751546 1:40469037-40469059 AAAGCACTTATAACAGTGTCTGG - Intergenic
905844650 1:41218702-41218724 AAAGCACTTAATACCATGCCTGG - Intronic
905853613 1:41292495-41292517 AAAGCACTTAGAACAATGCCTGG + Intergenic
905943131 1:41879918-41879940 AAAGCACTTAAGACCATGCTAGG - Intronic
905970707 1:42140152-42140174 AAAGCTCTTGGAACCATGTCTGG + Intergenic
906014113 1:42558463-42558485 CAAGCACTTAGCACAATGTCTGG - Intronic
906275417 1:44511706-44511728 GAACCACTTATAATTATGTCTGG + Intronic
906651290 1:47514802-47514824 AAAGCACTTACAACACTGCCTGG - Intergenic
906840082 1:49128055-49128077 AGAGCAATTATAATTATGTCAGG + Intronic
906883961 1:49624266-49624288 AAAGCATTTAGCACCATGCCTGG + Intronic
907427523 1:54390040-54390062 AAAGCACTTACAACAGTGCCTGG + Intronic
907474750 1:54698289-54698311 AAAGCACTTAGAACAGTGCCTGG + Intronic
907660375 1:56386914-56386936 AAAGCATTTAGAACAATGCCTGG + Intergenic
907668263 1:56451902-56451924 AAAGCACTTAAAATAATGCCTGG - Intergenic
907813159 1:57892411-57892433 AAAGCACTTAGAACAGTGCCTGG - Intronic
907853808 1:58281843-58281865 AAAGCACTTAGAACAATGACTGG + Intronic
907973097 1:59403946-59403968 AAAGCACTTCAAACAGTGTCTGG + Intronic
907985512 1:59525524-59525546 AAAGCACTTAGAATAATGTCTGG + Intronic
908419061 1:63941901-63941923 AAAGTACTTAGAACAGTGTCTGG - Intronic
908443213 1:64176360-64176382 AAAGCACTCAGACCTATGTCTGG - Intronic
908757276 1:67480445-67480467 AAAGTACTTAGAACAATGCCTGG - Intergenic
908822316 1:68101250-68101272 AAAGCACCTAGCACCATGCCTGG + Intronic
909111212 1:71480182-71480204 AAAGAACATACAACAATGTCTGG - Intronic
909700481 1:78516150-78516172 AAAGCACTTAGAATCTTGTCTGG - Intronic
909712777 1:78671982-78672004 AAAGCACTCAGAACCATATTAGG - Intergenic
909905874 1:81193907-81193929 AAAGCATTTAGAACTATGCCAGG + Intergenic
910148276 1:84108560-84108582 AAAGCACTTATAATGGTGTCTGG - Intronic
910241265 1:85088571-85088593 AAAGCACTTAGAAGAATGCCTGG - Intronic
910284083 1:85533833-85533855 AAAGCCCTTAGGACAATGTCTGG + Intronic
910395644 1:86790811-86790833 AAGGCACTTAAAATTATGTCAGG + Intergenic
910538010 1:88322220-88322242 AAAGCATTTAGAACACTGTCTGG + Intergenic
910783938 1:90973507-90973529 AAAGTACTTATAACAGTGCCTGG + Intronic
910863821 1:91769178-91769200 AAAGCACTTAGAACAGTGACTGG + Intronic
911716950 1:101143940-101143962 AAAGCACCTAGAACAATATCTGG - Intergenic
912558144 1:110530966-110530988 AAAACACTTAGAACAATGCCTGG + Intergenic
912945950 1:114084307-114084329 AAAGCACTTAGAACAATGCCTGG + Intergenic
913003751 1:114607885-114607907 AAGGCACTTAGAACAGTGTCTGG - Intronic
913163682 1:116167097-116167119 AAAGCACTTGGAACAATATCTGG + Intergenic
913261361 1:117000828-117000850 AAAGCACTTAGAACAATATCTGG - Intergenic
913277042 1:117148429-117148451 AAAGCACTTAGAACAGTGTCTGG + Intronic
913678723 1:121167585-121167607 AAAGCACTTAGAACAGTGTCTGG + Intergenic
913967268 1:143386980-143387002 AAAGAACTTATAACAATATGGGG - Intergenic
914030554 1:143955229-143955251 AAAGCACTTAGAACAGTGTCTGG + Intronic
914061647 1:144212587-144212609 AAAGAACTTATAACAATATGGGG - Intergenic
914117503 1:144753782-144753804 AAAGAACTTATAACAATATGGGG + Intergenic
914158893 1:145112732-145112754 AAAGCACTTAGAACAGTGTCTGG - Intergenic
914205937 1:145529151-145529173 AAAGCCCTTAGGACAATGTCTGG - Intergenic
914433172 1:147638241-147638263 AAAGCATTTAGAACAATGGCTGG - Intronic
915576553 1:156782733-156782755 AAAGCACTTAGAACAGTGCCTGG - Intronic
915587286 1:156851038-156851060 AAAGCACATAAAACAATGCCTGG - Intronic
915718752 1:157968098-157968120 AATGCACTGAGCACCATGTCTGG + Intergenic
915996859 1:160572509-160572531 AAAGCACTTAGCACAATGCCTGG + Intronic
916125163 1:161563748-161563770 AAAGCACTTAGCACCATGTCTGG + Intergenic
916135053 1:161645094-161645116 AAAGCACTTAGCACCATGTCTGG + Intronic
916170842 1:162000454-162000476 AAAGCACTTAGAACAGTGCCTGG - Intronic
916294466 1:163202280-163202302 GAAGCACTCAGAACCATGTCTGG - Intronic
916506735 1:165434991-165435013 AAAGTGTTTAGAACCATGTCTGG - Intronic
916513440 1:165493919-165493941 AAAGCACTTAGAACAGTGCCTGG - Intergenic
917091309 1:171356161-171356183 AAAGTGCTTAGAACAATGTCTGG - Intergenic
917138535 1:171811240-171811262 AAAACACTTACCACAATGTCTGG - Intronic
917719306 1:177771048-177771070 AAAGCACTTAGAACACTGTCTGG - Intergenic
917722364 1:177797809-177797831 AAAGCACCTAGAACCATTTCTGG + Intergenic
917756726 1:178108435-178108457 AAAGCACTTAGAACTGTGCCAGG - Intronic
918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG + Intergenic
918188327 1:182147424-182147446 AAAGCACTTATGACAGTGCCTGG + Intergenic
918256761 1:182755559-182755581 AAAGCACTTAAAATGATGTCCGG + Intergenic
918568484 1:185958619-185958641 AAAACACTTAGAACAATGCCTGG - Intronic
918599800 1:186342986-186343008 GAAGCATTTAGAAGCATGTCTGG - Intronic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
919045758 1:192449696-192449718 AAAGCACTTCCATCAATGTCAGG - Intergenic
920466021 1:206186121-206186143 AAAGCACTTAGAACAGTGTCTGG + Intergenic
920712309 1:208306945-208306967 GAAGCAATTATTACCATGCCTGG - Intergenic
920868862 1:209776317-209776339 AAAGCACTTAGCACAATGCCTGG + Intronic
920892715 1:210007922-210007944 AAAGCAATTACAACAATATCTGG + Intronic
921025270 1:211273018-211273040 AAAGCACTTAAATACATGACAGG - Intronic
921253780 1:213321403-213321425 AAAGCACTTACCACAATGCCTGG + Intergenic
921450789 1:215303147-215303169 ACAGCAATTATTACCATCTCAGG + Intergenic
921775508 1:219095581-219095603 CAAGCACATATAACCAAGTTGGG + Intergenic
921999619 1:221462715-221462737 AAAGTGCTCATAACAATGTCTGG + Intergenic
922276582 1:224084582-224084604 AAAGTACTTAGAACCATGCCTGG - Intergenic
922353796 1:224757362-224757384 TAAGCACCTGCAACCATGTCTGG + Intergenic
922433393 1:225578995-225579017 AAAGCACATAGAACCATATATGG - Intronic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
923249208 1:232163830-232163852 AAAGCACTTAAAACAGTGGCTGG + Intergenic
924574041 1:245262958-245262980 AAAGCACTTAGAACCATACCTGG + Intronic
924790178 1:247238968-247238990 AAAGCACTTAAATCAGTGTCAGG + Intergenic
1063143781 10:3277833-3277855 AAAGCACTTAGAAAACTGTCAGG + Intergenic
1063540818 10:6932061-6932083 AAAACACTCAAAACCATGCCTGG + Intergenic
1063934068 10:11058921-11058943 CAAGCATTTATCACCATGTCCGG + Intronic
1063987602 10:11522457-11522479 AAACCACTAGTAACAATGTCTGG + Intronic
1064274730 10:13895034-13895056 AAAGCACTTAGAACAGGGTCTGG + Intronic
1064294167 10:14063091-14063113 AAAGCTCTTAATATCATGTCTGG - Intronic
1064408720 10:15087239-15087261 AAAGCATTTAAAACAATGTTTGG - Intronic
1065213964 10:23432075-23432097 CAGGCACTTATCACCATGTCCGG + Intergenic
1065400673 10:25296671-25296693 AAAGCACTTAGAATCACATCTGG - Intronic
1065508140 10:26450234-26450256 AAAGCACTTAGAATAATGCCTGG + Intronic
1065820212 10:29518243-29518265 CAAGCACTTACTACCATGCCTGG - Intronic
1065992763 10:31029282-31029304 AAAGTACTTAAAACCCTGCCTGG + Intronic
1066127143 10:32352454-32352476 AAAGCACTTAGAATCATCCCTGG + Intronic
1066179655 10:32947882-32947904 AAAACATTTAAAACAATGTCTGG + Intronic
1067289466 10:44930756-44930778 AAAGCACTTAGGACCATGCTTGG - Intronic
1067743566 10:48915178-48915200 AAAGCACTTATAACAGTGCCTGG + Intronic
1068068233 10:52160937-52160959 AAAGCACTTATAGCAATGCCTGG + Intronic
1068489554 10:57705935-57705957 AAAGCAGATATAACCATTACAGG + Intergenic
1068515961 10:58025852-58025874 AAAGCACTTAGAATGATGCCTGG + Intergenic
1068541749 10:58302551-58302573 AAAGCACGTAGCACAATGTCTGG + Intergenic
1068742651 10:60491913-60491935 AAAGCACTTTGAACAGTGTCTGG + Intronic
1068823872 10:61411017-61411039 TAAGCACTTGTGACCATGACTGG - Intronic
1068831632 10:61502485-61502507 AAAGAACTTAAAACCTAGTCAGG + Intergenic
1068920017 10:62473651-62473673 AAAGCTCTTAGAACCATGCCTGG + Intronic
1069419847 10:68237479-68237501 AAAGCACTTAGATCTATGCCTGG + Intergenic
1069627849 10:69879318-69879340 AAAGTACTTAAAACAATGCCTGG - Intronic
1069688145 10:70332286-70332308 AAAGCACTTTTAACAAGGTCTGG + Intronic
1069762221 10:70819423-70819445 AAAGAACCAATAACCATGGCTGG + Intronic
1069993759 10:72330203-72330225 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1070404030 10:76078691-76078713 CAAGCACCTACCACCATGTCCGG - Intronic
1070684687 10:78471938-78471960 AGAGCACTTAGAGCCATTTCTGG + Intergenic
1071144937 10:82557744-82557766 ACAGGACTTAGAAACATGTCTGG - Intronic
1071178750 10:82958361-82958383 AAAGCACTTAAAACCATGTGTGG + Intronic
1071328219 10:84537200-84537222 AAAGCGCTTAGAACAATGCCTGG - Intergenic
1071797999 10:89026497-89026519 AAAGCACCTAGAACAGTGTCTGG + Intergenic
1072089597 10:92114582-92114604 AAGGCACTTAGAACAGTGTCTGG - Intronic
1072907693 10:99469929-99469951 AAAGCACTTAAAACAGTGCCTGG - Intergenic
1073182138 10:101590238-101590260 AAACCACCTATAACTATGTCAGG + Intronic
1073791080 10:106941139-106941161 AAAGCACTTGAAGCCATGCCTGG + Intronic
1074224052 10:111466408-111466430 ATAGCACTTATTACCATGTAGGG + Intergenic
1074315023 10:112353333-112353355 AAAGTGCTTAGCACCATGTCTGG - Intergenic
1074319182 10:112385138-112385160 AAAGTGCTTAGAACCATGGCTGG - Intronic
1074423658 10:113331603-113331625 AAAACACTTAGAACCATGCCTGG - Intergenic
1074486858 10:113892915-113892937 AAAGCACTTAGAACAGTGTCTGG + Intronic
1074765924 10:116700015-116700037 AAAGCTCTTAGAGCCATGCCTGG - Intronic
1074790831 10:116886306-116886328 AAAGGACTTCCAAACATGTCAGG + Exonic
1075008721 10:118850409-118850431 AAAGTACTTAAAACAATGACTGG + Intergenic
1077004449 11:345944-345966 AAAGCACTTAGTACCATGCTTGG - Intergenic
1077651542 11:3977591-3977613 AAAGCACTTAATACAATGCCTGG + Intronic
1077669999 11:4148443-4148465 AAAACACTTGGAACCATGTCTGG - Intergenic
1077897028 11:6460823-6460845 GAAGCACTTAGAATCATGCCTGG - Intronic
1078086727 11:8237967-8237989 GAAGTACTTATAACAATGTTTGG + Intronic
1078537122 11:12184201-12184223 AAAGCACTTAGAACAGTGGCCGG + Intronic
1078599538 11:12717963-12717985 GAAGGGCTTAGAACCATGTCTGG + Intronic
1078662942 11:13301759-13301781 AAAGCTCTTAGAACCATGCCTGG - Intronic
1079100477 11:17538584-17538606 AAAGCACGTATGACAATGCCTGG + Intronic
1079328590 11:19515202-19515224 AAAGCACATAGCACAATGTCTGG + Intronic
1079494386 11:21025159-21025181 GATGCACAAATAACCATGTCAGG - Intronic
1080376923 11:31723579-31723601 AAAGTGCTTAGAACAATGTCTGG - Intronic
1080901951 11:36502901-36502923 AAAGCACTTAGAACAGTGCCAGG + Intronic
1080984705 11:37447806-37447828 AAAGCACTTTGAACAATGCCTGG - Intergenic
1080988746 11:37504753-37504775 AAAGCACTTATCACAGTGTTTGG + Intergenic
1081417825 11:42836848-42836870 AAAGCATTTAGAACCATGCCTGG + Intergenic
1081496504 11:43616529-43616551 GAAGCACTTAGAACAATGCCTGG - Intronic
1083704208 11:64502133-64502155 AAAGTACTTGAAACAATGTCTGG - Intergenic
1084902040 11:72316957-72316979 AGAGAGCTTATAACAATGTCTGG + Intronic
1085304833 11:75479441-75479463 AAAGCACTTGGAACAATGCCTGG - Intronic
1085737442 11:79051187-79051209 AAAGCACTTAGAATCGTGTCTGG - Intronic
1085786838 11:79459720-79459742 AAAGCACTTAAAACAATGCTGGG - Intergenic
1086110366 11:83192638-83192660 AAAGCACTTAGTACAATGCCAGG + Intergenic
1086425873 11:86682104-86682126 AAAGCACTGGAGACCATGTCTGG - Intergenic
1087026760 11:93657714-93657736 AAAGCTCTTGAAACAATGTCTGG - Intergenic
1087069223 11:94060452-94060474 AAAGCACTTATCACAGTGCCTGG - Intronic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087211369 11:95448784-95448806 AAAGCTCTTATAACCCTTTAGGG - Intergenic
1087218812 11:95523653-95523675 AAAGCATTTAGAACAATGTTTGG + Intergenic
1087564957 11:99843630-99843652 AGAGCACATATAACAATGTCTGG + Intronic
1087658828 11:100961404-100961426 AAAGCACTTAGAAGCATGCTAGG + Intronic
1088304771 11:108395969-108395991 AAAGCATTTAGAACAATGACTGG + Intronic
1089130163 11:116205996-116206018 AAAGCATTTAAAACAGTGTCTGG - Intergenic
1089426701 11:118382900-118382922 AAAGCACTTATCATCAAGCCTGG - Intronic
1089873778 11:121700425-121700447 AAAGCACCTAGTACAATGTCTGG - Intergenic
1090327163 11:125898971-125898993 AAAGCACATAGAACAATGGCAGG + Intronic
1090804277 11:130193077-130193099 AAAGCACCGAGAACCATGCCAGG + Intronic
1091337115 11:134780558-134780580 AAAGCACTTAGAACCTTGTCTGG + Intergenic
1091352595 11:134909037-134909059 AAAGCAATTATAATCAGGGCTGG + Intergenic
1091544024 12:1488549-1488571 GAGGCAATAATAACCATGTCAGG - Intronic
1091578680 12:1765516-1765538 AAAGCACTTAGTACAATGTCTGG + Intronic
1092016848 12:5166509-5166531 AAAGCACTTAAAATAATATCTGG + Intergenic
1092078716 12:5694986-5695008 AAACCACTCAGAACCGTGTCTGG + Intronic
1092531301 12:9347844-9347866 AATGCACTAAGCACCATGTCAGG + Intergenic
1092899170 12:13042716-13042738 AAAGCACTTACAACAGTGCCTGG - Intergenic
1093291506 12:17329838-17329860 AATGCACTTATAACTGTGGCTGG + Intergenic
1093384804 12:18539314-18539336 AAAGCACTTAGCACAATGCCTGG - Intronic
1093485228 12:19644964-19644986 AAAGCACTTAGCACAATTTCTGG - Intronic
1093650551 12:21639596-21639618 AAAGTACTTAGTACAATGTCAGG - Intronic
1093873424 12:24319642-24319664 AGAGCACTCAGAACCATGTGTGG - Intergenic
1093906193 12:24694607-24694629 AGAGCACTTGGAACAATGTCTGG - Intergenic
1093928523 12:24932610-24932632 AAAGCACTTATAACAGGGTCTGG - Intronic
1094147981 12:27250546-27250568 AAAGTACTTAGCACTATGTCTGG - Intronic
1094198679 12:27776251-27776273 AAAGCACTTACAACAGTGCCTGG + Intergenic
1094265733 12:28557493-28557515 AAAGCAATTAAAACCGTGTCTGG + Intronic
1094402504 12:30077120-30077142 AAATTACTTATAACAGTGTCTGG - Intergenic
1095204982 12:39429586-39429608 AAAGCACTCAGAATAATGTCTGG - Intronic
1095508991 12:42928872-42928894 ACAGAACTTAGAACCATGCCTGG - Intergenic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1095870536 12:47022632-47022654 AAATACTTTATAACCATGTCAGG + Intergenic
1096470220 12:51870951-51870973 AAAGGACTTAGAATGATGTCTGG - Intergenic
1097198362 12:57257339-57257361 AAAGCATTTATAGCAATGCCTGG + Intronic
1097793271 12:63837764-63837786 AAAGCACTTAGCACCAAGTCTGG - Intergenic
1097982695 12:65750742-65750764 AACACTCTTAGAACCATGTCTGG + Intergenic
1098016872 12:66114505-66114527 AAAGCACTTATAACTAAATTTGG + Intergenic
1098541815 12:71665200-71665222 AAAGCACTTTGAACAATGCCTGG + Intronic
1098693590 12:73522365-73522387 AAAGGACTAATACACATGTCTGG + Intergenic
1098929190 12:76390759-76390781 AAAACACTTAGAACACTGTCTGG - Intronic
1099160218 12:79232138-79232160 AAAGTGCTTAAAACAATGTCTGG + Intronic
1099170773 12:79361185-79361207 AAAGCATTTAGAACAGTGTCTGG - Intronic
1099234477 12:80067620-80067642 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1099420418 12:82451500-82451522 AAAGTACTTACAACAATGCCTGG + Intronic
1099468098 12:83011412-83011434 AAGGCACTTAGAACAATGTCTGG + Intronic
1099622271 12:85018883-85018905 AAAGCACTTACAAAAAAGTCTGG + Intronic
1099784590 12:87244708-87244730 AAAGCCCTTTTTACCATGTAAGG - Intergenic
1100003252 12:89862760-89862782 AAAGCACTTTTAACAATGGCTGG + Intergenic
1100012116 12:89966184-89966206 TAAGCACTCAGAACAATGTCTGG - Intergenic
1100270281 12:93018168-93018190 AAAACACTTAGCACAATGTCTGG + Intergenic
1100405194 12:94266788-94266810 AAAGCACTTAGAACATTGCCAGG + Intronic
1100511741 12:95281686-95281708 CAAGCACATACCACCATGTCTGG + Intronic
1100601847 12:96118469-96118491 AAAGCACTTAAAACAATGCCTGG - Intergenic
1100797158 12:98194580-98194602 AGAGCACTTAGCACCATGCCTGG + Intergenic
1100914312 12:99401518-99401540 AAAGCAGTTAGAACCATGGGTGG - Intronic
1101146841 12:101848807-101848829 AAAGTACTTAGAACAGTGTCAGG - Intergenic
1101320259 12:103667340-103667362 AAAGCATTTAGAACAATGTCTGG - Intronic
1101406498 12:104433538-104433560 AAAGCACTTAGCATGATGTCTGG - Intergenic
1101430546 12:104623351-104623373 AAAACACTAATAACCAAATCAGG - Intronic
1101615411 12:106331571-106331593 AAAACACTTAGAACCGTTTCTGG - Intronic
1101726787 12:107394726-107394748 AAAGCATTTAGAACAATGCCTGG + Intronic
1101736089 12:107464451-107464473 CAAGCACATGTCACCATGTCTGG + Intronic
1102465037 12:113124727-113124749 AAAGCGCTTAGCACCATGCCTGG + Intronic
1102483795 12:113242549-113242571 AAAGCCCTTTCAACCGTGTCTGG + Intronic
1102525317 12:113508562-113508584 AAGGCACTTATCACTGTGTCTGG + Intergenic
1102640599 12:114363083-114363105 AAAGCACCTAGAACAGTGTCTGG - Intronic
1103254068 12:119525025-119525047 AAAGCTCTTACATCCATGACTGG - Intronic
1103294389 12:119873962-119873984 AAAGCACTTAGCACCTTGCCTGG - Intronic
1103640335 12:122346325-122346347 AAAGCACTTAGAATAGTGTCTGG + Intronic
1104184739 12:126419684-126419706 AAAACACTTATCACAGTGTCTGG - Intergenic
1104778081 12:131403041-131403063 AGAGCACTGAAAGCCATGTCTGG + Intergenic
1106298571 13:28440795-28440817 AAAGCACTTAGAATGATGCCTGG + Intronic
1106305215 13:28503713-28503735 AAAGCATTTATAATAGTGTCTGG + Intergenic
1106567038 13:30895243-30895265 AAAGCACTGAGAACCAAGACTGG - Intergenic
1106714118 13:32369897-32369919 AAAGCGCTTAACACCATGCCAGG + Intronic
1106924465 13:34599851-34599873 AAAGCCCTTAGATCCATGCCTGG - Intergenic
1107501298 13:40979275-40979297 AAAGCTTTTAGAACTATGTCTGG - Intronic
1107675070 13:42787282-42787304 AAAGCTCTTAGCACAATGTCTGG - Intronic
1108067421 13:46592461-46592483 AAAGGACTTAGCACCATGTGTGG - Intronic
1108343261 13:49518558-49518580 AAAGCACTTAGAACTATGCCTGG - Intronic
1109574656 13:64238637-64238659 AAACTACTTAGAAACATGTCTGG - Intergenic
1110193247 13:72756057-72756079 AAAAAACTTATATCCATGTTGGG + Exonic
1110391746 13:74982537-74982559 AAAGCACATAAAACAATGTTTGG + Intergenic
1111212309 13:85095282-85095304 GAAGCACTTAGGACAATGTCTGG + Intergenic
1111226775 13:85283950-85283972 AAAGCACTCATAACAATGTCAGG + Intergenic
1111388084 13:87556025-87556047 ACAGCACTTATAAGAATGTCTGG - Intergenic
1112725133 13:102294895-102294917 ATAGCACTTAGAACAATGTCTGG + Intronic
1113111390 13:106827840-106827862 CAGGCACATATCACCATGTCTGG - Intergenic
1114168386 14:20245634-20245656 AGAGCACTTAGAACTATGCCTGG + Intergenic
1114306039 14:21423775-21423797 AAAGCACATATAACAGTGTTTGG - Intronic
1114622751 14:24106957-24106979 AAAGCACTCAGAACTATGCCTGG + Intronic
1115273015 14:31575467-31575489 AAAGCACTTAGCACGGTGTCTGG + Intronic
1115324380 14:32122274-32122296 AAAGCACTTAAAAAGATGTTCGG - Intronic
1115364211 14:32538683-32538705 AAAGTGCTTATCACAATGTCTGG - Intronic
1116473266 14:45309929-45309951 AAAGCTCTTAAAACAATGCCTGG - Intergenic
1117283438 14:54263217-54263239 AAAGCACTTAGAACAGTATCTGG + Intergenic
1117511298 14:56454283-56454305 AAAGTGCTTAGAACCATGCCTGG + Intergenic
1117551951 14:56845438-56845460 AAAGCTCTTAGAACAGTGTCTGG - Intergenic
1117558900 14:56915822-56915844 AAAGCACTTATAGCACTATCTGG - Intergenic
1117993857 14:61460509-61460531 AAAGCACTTAGAACAATGTGTGG - Intronic
1118492581 14:66275800-66275822 AAAGCACTTTAAACAGTGTCTGG + Intergenic
1118638544 14:67770683-67770705 AAAGCACTTAGTATCATGCCTGG + Intronic
1118711610 14:68524055-68524077 AAAGCCCTTAGAACAGTGTCTGG - Intronic
1119192636 14:72693586-72693608 AAAGTACTTAAAACAATATCAGG + Intronic
1119276998 14:73366482-73366504 AAAGCATTTACAACAATGCCTGG - Intronic
1119427365 14:74544447-74544469 AAAGCACTTAGCACCGTGCCTGG + Intronic
1119575903 14:75721721-75721743 AAAGCACTTGACACAATGTCTGG + Intronic
1119646701 14:76353533-76353555 AAAGCACTTAGAACAGTGCCTGG - Intronic
1120048782 14:79840726-79840748 AAAGCATTTAACACGATGTCTGG + Intronic
1120152328 14:81050570-81050592 GAAGCACTTATAACAATGTTAGG - Intronic
1120237279 14:81906447-81906469 AAAGCACTTAGCACAATGCCTGG + Intergenic
1120821033 14:88912074-88912096 AAAGCATTTAGAACAGTGTCTGG - Intergenic
1121044086 14:90775283-90775305 AAAGCACTTAGCACAATGCCCGG - Intronic
1121173672 14:91874661-91874683 AAAGCACTTAGAATAGTGTCTGG + Intronic
1121428244 14:93868692-93868714 AAAGCACATATAAATATGACTGG - Intergenic
1121819991 14:96958512-96958534 AAAGCACTCAGAACAGTGTCTGG - Intergenic
1124809219 15:32917533-32917555 AAAACACTTAGAACAATGCCTGG - Intronic
1125215936 15:37274434-37274456 AAAGCACTTAGTACCATGTTGGG + Intergenic
1125224880 15:37384569-37384591 AAAGTACTTAGAACAATGCCTGG + Intergenic
1125439297 15:39684811-39684833 AAAGCACTTAGAACAGTGTCAGG - Intronic
1125882099 15:43203892-43203914 AAAGCACTTAACACCATTTTGGG + Intronic
1126347746 15:47715037-47715059 AAAGCACTTATGCCCATGGTAGG + Intronic
1127044879 15:55015057-55015079 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1127345654 15:58095150-58095172 AAAGCACTTAAAATAATGCCTGG - Intronic
1127683940 15:61323514-61323536 AAAGCACTCACCACCATGTCTGG + Intergenic
1127824954 15:62695013-62695035 AAAGCACATAAAACAATGCCTGG + Intronic
1128168648 15:65490560-65490582 AAAGCACTTAGAACAAAGCCTGG + Intronic
1128645937 15:69379088-69379110 CAAGCTCTTCTAACCATGGCAGG + Intronic
1129049840 15:72771570-72771592 AAAGCACTAAAGACAATGTCAGG + Intronic
1129238095 15:74235658-74235680 AAAGCACTTAGGACCCTGCCTGG + Intergenic
1129887456 15:79048546-79048568 AAAGCTCTTAAAATAATGTCTGG + Intronic
1130021590 15:80235922-80235944 AAAGCACTTAGAAGAGTGTCGGG + Intergenic
1130046096 15:80446049-80446071 AAAGCACTTAGAATGATGCCTGG - Intronic
1130125901 15:81094054-81094076 TAAGCACTTCCAACCATGTGGGG - Intronic
1130271311 15:82450484-82450506 AAAGCATTTATAACAATATGTGG - Intergenic
1130463650 15:84177820-84177842 AAAGCATTTATAACAATATGTGG - Intronic
1130489023 15:84416963-84416985 AAAGCATTTATAACAATATGTGG + Intergenic
1130500615 15:84495722-84495744 AAAGCATTTATAACAATATGTGG + Intergenic
1130508106 15:84565773-84565795 AAAGCATTTATAACAATATTTGG + Intergenic
1131310905 15:91289179-91289201 CAAGCACCTAGAACAATGTCTGG + Intronic
1131433911 15:92408102-92408124 AAACCATTTATAACTGTGTCTGG + Intronic
1131527774 15:93166346-93166368 AAAGCACTTAGGACAATGCCAGG - Intergenic
1131706834 15:95005685-95005707 AAAACACTTAGAACAGTGTCTGG + Intergenic
1132271991 15:100534397-100534419 AAAGCACTTAGAACAATACCTGG + Intronic
1132272029 15:100534839-100534861 AAAGCACTTAGAACAATACCTGG - Intronic
1132428400 15:101740782-101740804 AAAGCATTTATAACAATATGTGG + Intronic
1133707497 16:8369130-8369152 AAAGCACATAGTACCATATCTGG + Intergenic
1133867426 16:9657398-9657420 AAAGCATTTATAACAGTGTCTGG - Intergenic
1134266382 16:12696414-12696436 AAGTCACTTAGCACCATGTCTGG - Intronic
1134413563 16:14023740-14023762 AAAGCACTTAGAACTGTGCCTGG + Intergenic
1135397337 16:22141341-22141363 AAAGCACTTAGCACAATGCCAGG + Intronic
1135463972 16:22669583-22669605 AAAGCACCTAGAACAGTGTCTGG + Intergenic
1135467859 16:22702552-22702574 AAAGTGCTTAGAGCCATGTCTGG - Intergenic
1135626386 16:23998668-23998690 AAAGCACTTAGGACAGTGTCTGG + Intronic
1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG + Intergenic
1136616057 16:31399279-31399301 AAAGCACTTGGAACCCTGCCTGG + Intronic
1137398302 16:48132789-48132811 AAAGCATGTAGAACCATCTCAGG - Intronic
1137475026 16:48800267-48800289 AAAGTACTTAGTACAATGTCTGG + Intergenic
1138293349 16:55866903-55866925 AAAGCCCTTAGAACAGTGTCTGG - Intronic
1138853088 16:60654006-60654028 AAATGCCTGATAACCATGTCAGG + Intergenic
1140611723 16:76607872-76607894 AAAACATTTAGAATCATGTCTGG - Intronic
1140836078 16:78795180-78795202 AAAGCACTTAGCACAATATCTGG - Intronic
1141101623 16:81201724-81201746 AAAGCACTTAGAACAGTGCCTGG + Intergenic
1141477852 16:84285703-84285725 AAAGCCCTCAAAACCATGTATGG + Intergenic
1141943612 16:87295212-87295234 AAAGCACTTTTAACAGTGCCTGG - Intronic
1143441415 17:6977348-6977370 AAAGCACTTAGAAAAATGTCTGG + Intronic
1143832402 17:9662784-9662806 AAAACACTTAGAAACATGTCTGG - Intronic
1143913825 17:10274399-10274421 AAAGCACCTAGAACTGTGTCCGG - Intergenic
1144168095 17:12632192-12632214 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1144394587 17:14832039-14832061 AAAGCACTTCAAACAATGTCTGG - Intergenic
1145028779 17:19488870-19488892 ACAGCACTTACCACCATGCCTGG - Intergenic
1146013428 17:29213895-29213917 AAAGCGCTTATCACAATGCCTGG - Intergenic
1146483862 17:33227665-33227687 AAAGCTCTTAGAACAATGCCTGG - Intronic
1146524401 17:33553687-33553709 AAAGCACATAGTACCATGCCTGG - Intronic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1146772647 17:35582871-35582893 AAAGCACTTAGAACTATGGCTGG - Intronic
1146841240 17:36156189-36156211 AAAGCACTTAGAATAATATCTGG - Intergenic
1147539823 17:41347885-41347907 AAAGCACTTAGCACAATGTTTGG + Intronic
1148235896 17:45968847-45968869 AAAGCACTTTGTACCATGCCTGG - Intronic
1149085676 17:52712871-52712893 AAAGAACTTAAAACAATGCCTGG - Intergenic
1150511077 17:65753742-65753764 AAAGCACTTAGAACAGTGCCTGG - Intronic
1150556751 17:66261593-66261615 AAAGCACTTAGCACGATGCCTGG - Intergenic
1151022707 17:70636961-70636983 TGTGCACTTATATCCATGTCTGG - Intergenic
1153194335 18:2577126-2577148 AAAGCACTTAAAACAATGTCTGG - Intronic
1153336232 18:3928556-3928578 GAAGCACTTGGAACCATGCCTGG - Intronic
1153342258 18:3987509-3987531 AAAGCACTTGGAACGATGCCTGG - Intronic
1153456852 18:5292430-5292452 AAAGCACATAGAACAATGCCTGG - Intronic
1156013367 18:32520168-32520190 AAAGCACTTATCACAGTGGCTGG + Intergenic
1156066799 18:33151818-33151840 AAGGGACTTAGAACCATGACTGG + Intronic
1156104308 18:33639173-33639195 AAAGCACTTAGAACTGTGTCTGG - Intronic
1156559292 18:38104152-38104174 AATGCACATATTATCATGTCAGG + Intergenic
1156704131 18:39859411-39859433 AACCCACATATAACCATGTTGGG + Intergenic
1157401689 18:47393947-47393969 AAGGCACCTAACACCATGTCCGG - Intergenic
1157656466 18:49394322-49394344 AAAGCACTTAGAACAGTGCCTGG + Intronic
1158724989 18:59962851-59962873 AAAACACTTATAACTGTGCCTGG - Intergenic
1158809843 18:61019916-61019938 AAAGCACTTAAAGCAGTGTCTGG - Intergenic
1159228652 18:65574980-65575002 AAAGCTCTTAGAGCAATGTCTGG - Intergenic
1159452227 18:68617157-68617179 AAAGAACTGCTAACCATTTCAGG + Intergenic
1159842140 18:73411679-73411701 AAACTACTTATAACCTTGTTGGG + Intergenic
1161743696 19:6041844-6041866 TAGGCACTTGTCACCATGTCTGG + Intronic
1162508005 19:11098859-11098881 AAAGCACTCACCACCATGCCAGG - Intronic
1162943742 19:14030153-14030175 AAAAAACTTAGAACAATGTCTGG - Intronic
1163615308 19:18323621-18323643 AAAGCACTTAAAACAGCGTCTGG + Intergenic
1164647121 19:29867159-29867181 AAAGTACTTAGAACCTTGGCTGG - Intergenic
1164707346 19:30330020-30330042 AAAGCACTTATTTTCATGCCTGG + Intronic
1164829659 19:31310814-31310836 AAAGCACTTAGCACCATGCCTGG + Intronic
1164963565 19:32458858-32458880 AAAGCACTTAAAATAGTGTCTGG + Intronic
1165217146 19:34283502-34283524 AAAGCACTTAGAATGATGTCTGG - Intronic
1165478870 19:36049689-36049711 AAAGCACTTAGAACAGTGCCTGG + Intronic
1166164093 19:40974656-40974678 AAAGCACTTAGAACAATGGCTGG + Intergenic
1166186748 19:41144680-41144702 AAAGCACTTAGAACAATGGCTGG - Intergenic
1167444881 19:49531770-49531792 AAAGCACTTAGGACAATGCCTGG - Intronic
1167637442 19:50662989-50663011 AAAGCACTTAGAACAATGCCTGG - Intronic
1168289603 19:55351162-55351184 AAAGCAGTTAGAACAGTGTCTGG - Intronic
1168351248 19:55677326-55677348 AAAGCACTTAAAACAGTGCCTGG + Intronic
1202701054 1_KI270712v1_random:164474-164496 AAAGAACTTATAACAATATGGGG - Intergenic
925887856 2:8408869-8408891 AAACCACTTGTGACCATGTTCGG - Intergenic
926547774 2:14263161-14263183 AAAGCACTTAAAATAGTGTCTGG + Intergenic
927093569 2:19730386-19730408 AAAGCACTTAGAACAATGACTGG - Intergenic
927144823 2:20156381-20156403 AAAGCACTTAGATCAGTGTCTGG - Intergenic
927335809 2:21922994-21923016 CAAGCACGTACCACCATGTCCGG - Intergenic
927500335 2:23578476-23578498 AAAGCACTTACATCAGTGTCTGG + Intronic
927507300 2:23622792-23622814 AAAGGACTTAGAACCATGCCTGG - Intronic
927528782 2:23774305-23774327 ACAGGACTTACAACCATGCCTGG - Intronic
927728307 2:25446003-25446025 AAAGCACTTAGAATAATGACTGG + Intronic
928123956 2:28603454-28603476 AAAGCACTTGAAACAATGCCTGG - Intronic
928563487 2:32517196-32517218 AAGGCACGTATCACCATGCCCGG - Intronic
928584455 2:32744752-32744774 AAAGCACATACATCCATGGCCGG + Intronic
928656447 2:33456879-33456901 AAAGCACTTAGCACAATGCCTGG - Intronic
928697994 2:33870165-33870187 AGAGCACATGTAACAATGTCAGG + Intergenic
929870879 2:45758292-45758314 AAAGTATTTAGAACCATGCCTGG + Intronic
930290600 2:49488619-49488641 AAAGCACTTAAAACAGTGTCTGG - Intergenic
930803746 2:55469453-55469475 CAAGCACTTCTTACCATGGCAGG - Intergenic
930847042 2:55917548-55917570 AAAGCACTTAGCATGATGTCTGG + Intronic
931228684 2:60355728-60355750 AAAGCACTTAGAATTGTGTCTGG + Intergenic
931506914 2:62938976-62938998 AAAACACTTAGAACAATGTATGG - Intronic
931773116 2:65516526-65516548 AAAGCACTTACAATAATGCCTGG - Intergenic
932119639 2:69086755-69086777 AAAGCACTTAAGAGAATGTCTGG - Intronic
932258194 2:70304677-70304699 AAGGCACTTAAAACACTGTCTGG - Intergenic
932629413 2:73325657-73325679 AAAGTACTTAGAACAATGTCTGG - Intergenic
932785719 2:74601000-74601022 AAAGCACTTATAACAGTGCCTGG - Intronic
934059608 2:88281967-88281989 AGAGCACATAGAACTATGTCTGG + Intergenic
934171981 2:89547951-89547973 AAAGAACTTATAACAATATGGGG - Intergenic
934282289 2:91622269-91622291 AAAGAACTTATAACAATATGGGG - Intergenic
935615362 2:105074522-105074544 GAAGCACTTAGAACTATGCCTGG - Intronic
937019360 2:118636021-118636043 AAAGCACTTACAACAATGCGGGG + Intergenic
937453192 2:122019254-122019276 AAAGCACTTAGAACAATCGCTGG + Intergenic
938733248 2:134162758-134162780 GAAGCACTTAGCATCATGTCTGG - Intronic
938736144 2:134188493-134188515 GAAGGTCTTAGAACCATGTCTGG + Intronic
938991417 2:136633704-136633726 AAAGAACTTGTAACAGTGTCTGG + Intergenic
939575581 2:143891224-143891246 AAAGCACAAATAACTAAGTCAGG + Intergenic
939599481 2:144171150-144171172 AGAGAGCTTAAAACCATGTCTGG + Intronic
939831580 2:147078958-147078980 AAGGAAATAATAACCATGTCAGG + Intergenic
939846603 2:147254520-147254542 ACAGGACTTGTAAGCATGTCTGG + Intergenic
940008143 2:149028582-149028604 AAAGCATTTAAAACAGTGTCTGG - Intergenic
940070033 2:149676584-149676606 AAAACACTTAAAACAGTGTCTGG - Intergenic
940206182 2:151204143-151204165 AAAGTACTTACAAACTTGTCTGG + Intergenic
940234051 2:151490614-151490636 AAAGTACTTAAAACCATGCTTGG - Intronic
940487201 2:154310886-154310908 AAATCACTTAAGACAATGTCTGG + Intronic
940539032 2:154986948-154986970 AAAGCACTTAGAACAATGCCTGG + Intergenic
940567232 2:155382377-155382399 AAAACACTTATTACAATGTCTGG - Intergenic
940747909 2:157590983-157591005 AAAGCCCTTAGACCAATGTCTGG + Intronic
941022355 2:160422452-160422474 AAAATACTTAAAACAATGTCTGG - Intronic
941414796 2:165206546-165206568 AAAGTGCTTAGAACAATGTCTGG - Intergenic
941597359 2:167494783-167494805 AAAGCAGTGATACCCATATCTGG + Intergenic
942150236 2:173069234-173069256 AAACTACTTTTAACTATGTCAGG - Intergenic
942501304 2:176593624-176593646 AAAGTACTTAGAACAGTGTCTGG + Intergenic
942608247 2:177714374-177714396 AAAGCTCTTAGAACAATGTATGG - Intronic
942681935 2:178485835-178485857 AAAGCATTTCTAACCACGTAGGG + Intronic
942736103 2:179115236-179115258 AGAGCACTTATGACTATGGCAGG - Exonic
942842209 2:180376318-180376340 AAAGCACTTATGACAATGTTTGG + Intergenic
943145604 2:184040893-184040915 TAAGCACTTATCACAATGTAAGG - Intergenic
943325383 2:186491287-186491309 AAAACACTGAGAACCTTGTCTGG - Intronic
943540284 2:189205276-189205298 AAAGCACTTAGCACAGTGTCTGG - Intergenic
943553384 2:189370009-189370031 AAAGCACATAGAACAATGCCTGG - Intergenic
944515841 2:200510659-200510681 AAAGCACTTAGCACAGTGTCAGG - Intronic
944719483 2:202408571-202408593 AAAGCACTTCTCACTGTGTCTGG + Intronic
944906936 2:204271131-204271153 AAAGCACTTAGAACAGTGGCTGG - Intergenic
945183761 2:207118737-207118759 AAAACATTTAGAACAATGTCTGG + Intronic
945359125 2:208874969-208874991 AAAGCTCTTGGAACAATGTCTGG - Intergenic
945709839 2:213282126-213282148 AAAGCACTTATAACCATGTCTGG - Intergenic
946275543 2:218629071-218629093 AAAGCACACATCACCATGCCTGG - Intronic
946502820 2:220267710-220267732 AAAGTACTTACAACAGTGTCTGG + Intergenic
947186559 2:227460529-227460551 ACAGCACTTAGAACAGTGTCTGG + Intergenic
947186693 2:227461737-227461759 AAAGCACTTAAAACAATGTCTGG - Intergenic
947238807 2:227972247-227972269 ACAGCACTTCAAATCATGTCTGG + Intergenic
947813142 2:233017222-233017244 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1168769165 20:403452-403474 AAAGCACTCAAAGCCATGTCTGG - Intergenic
1168802044 20:649903-649925 AAAGCACTTCAAACCATGCTTGG + Intronic
1169026591 20:2376680-2376702 AAAGCACTTAGAACACTGCCTGG - Intergenic
1169188136 20:3637321-3637343 AAAGCACTTAAAACCGGGGCTGG - Intronic
1170762134 20:19260373-19260395 AAAGTACTCAAAACCATGCCCGG + Intronic
1171988326 20:31676238-31676260 GAAGCACTTAGCACCATGCCTGG - Intronic
1171993164 20:31712423-31712445 AAAGCACTTTGAACAATGGCTGG + Intronic
1172193457 20:33076327-33076349 AAAGCACTTAGAACAGTGTCTGG - Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172714512 20:36952653-36952675 AAAGCCCTTAGAACCGTGCCTGG - Intergenic
1172840428 20:37899942-37899964 AAAGCACTTAGAACAATGCCAGG - Intergenic
1173089306 20:39955073-39955095 AAAGCACTTAGAACAGAGTCTGG - Intergenic
1173692032 20:44967879-44967901 AAAGCACTTAGAACAGTGCCTGG - Intronic
1173741289 20:45404353-45404375 AAAGCACTTATAATAGTGACTGG + Intronic
1173944513 20:46940256-46940278 AAAGCACTTACAGCTATGCCTGG - Intronic
1173948800 20:46974156-46974178 AAGGCACTTAAAACAATGTCTGG + Intronic
1174109872 20:48191580-48191602 AAAGCACTTAGCACAATGCCAGG - Intergenic
1174195767 20:48771747-48771769 AAAGCACTTGGAACCGTGTCCGG - Intronic
1174203672 20:48824573-48824595 AAAGCACTTAGAACAGTGTCTGG - Intronic
1174280828 20:49437958-49437980 AAAGCACTTAGAACAGTGCCTGG + Intronic
1175332814 20:58176664-58176686 AAAGCACTTAGAGCAATGCCTGG - Intergenic
1178356757 21:31916020-31916042 AAAGCACTTAGTACAATGTCTGG - Intronic
1178499097 21:33110923-33110945 AAAGGACTTAGAACCCTGCCTGG - Intergenic
1179150034 21:38802124-38802146 CAAGCACTTAGAACAGTGTCTGG - Intergenic
1181149690 22:20874406-20874428 CAAGCACGTACCACCATGTCCGG - Intronic
1181507918 22:23374183-23374205 AAAGCCCTTAGAACAGTGTCCGG - Intergenic
1181673705 22:24438399-24438421 AAAGCACTAAGAACAGTGTCCGG + Intronic
1181742836 22:24935093-24935115 AAAGCACTTTGCACCATGTCTGG - Exonic
1181813072 22:25416359-25416381 AAAGCGCTTAGAACTGTGTCTGG - Intergenic
1181831051 22:25560551-25560573 AAAGCACTTAGAACTGTGTCTGG - Intergenic
1182070628 22:27461303-27461325 AAGGCACTTAGAACAATGACTGG - Intergenic
1182580097 22:31302994-31303016 AAAGCACTTAGAACAGTATCTGG - Intergenic
1182806478 22:33074885-33074907 AAAGCACTTAGAACAGTATCTGG - Intergenic
1183249265 22:36718004-36718026 AAGGCAATTAGAACAATGTCTGG - Intergenic
1183251678 22:36734599-36734621 AAAGCACTTAAGAGAATGTCTGG - Intergenic
1184260287 22:43311311-43311333 TAAGCACTGAAAACCATGTCTGG + Intronic
1184591477 22:45486617-45486639 CAAGCAGTTTTAACCGTGTCAGG - Intergenic
1184830220 22:46981269-46981291 GAAGCACTCAGGACCATGTCAGG - Intronic
949271922 3:2226851-2226873 AAAGTTCTTGTAACAATGTCTGG - Intronic
949348179 3:3096871-3096893 AAAGCACTTAGAACAGTGCCTGG - Intronic
949659680 3:6263882-6263904 AAAGCACTTAGCACAATGTCTGG - Intergenic
949807071 3:7967082-7967104 AAAGCATTTAGAACAATGCCTGG + Intergenic
949889441 3:8722633-8722655 AAAGTACTTATAACAGTGGCGGG - Intronic
950747411 3:15101524-15101546 AAAGCACATAGAACAGTGTCTGG - Intergenic
950873449 3:16249156-16249178 AAAGCACTTAGAACAAGGCCTGG - Intergenic
950896147 3:16453038-16453060 AAAGCATATAAAACAATGTCTGG - Intronic
951016733 3:17740362-17740384 AAAGCACTTACAACAGTGTCCGG + Intronic
951115828 3:18860999-18861021 AATGGACTTAAAACCTTGTCTGG - Intergenic
951581509 3:24169614-24169636 AAAGCACTTAGAATGATGACTGG + Intronic
951689028 3:25376026-25376048 AGAGCTCTTAAAACCATGCCTGG + Intronic
952510360 3:34047339-34047361 AAGGCACTTACAACAGTGTCTGG + Intergenic
952520481 3:34152096-34152118 ACAGAACTTATAGCCATGTCTGG - Intergenic
953085968 3:39667669-39667691 AAAGCACATATCTCCCTGTCAGG - Intergenic
953204443 3:40811354-40811376 AAAGCAATTATAACATTGTATGG - Intergenic
953313412 3:41902890-41902912 AAAGCACTTAAAACAATGCCTGG + Intronic
953543492 3:43843046-43843068 AAAACACTTAGCTCCATGTCTGG + Intergenic
955258126 3:57355898-57355920 AAAGTGTTTATAACAATGTCTGG - Intronic
955775437 3:62427608-62427630 AGAGGACTTTTAACCATGTCTGG - Intronic
955856095 3:63275747-63275769 AAAGCACTTAGCACAATGCCTGG + Intronic
956016429 3:64888490-64888512 AAAACACTTATCACATTGTCTGG + Intergenic
956351747 3:68344756-68344778 AAAGCACTTAGCACAATGCCTGG - Intronic
956395772 3:68824575-68824597 AAAGCCCTTTTCACCATGTAAGG + Intronic
956466093 3:69522021-69522043 AAAGCACCCATAAACATGTGTGG - Intronic
956516474 3:70054320-70054342 AAAGCAGTAATACCCATCTCTGG + Intergenic
956802221 3:72770021-72770043 AAAGCACTTAGCACAATGCCTGG + Intronic
956951094 3:74283335-74283357 AAATTACTTAGAACCATGACCGG + Intronic
957367019 3:79238638-79238660 CAAGCACTTAAAACTATGTCAGG - Intronic
958645741 3:96871343-96871365 AAAGAAGTTAAAACAATGTCTGG + Intronic
959029843 3:101286172-101286194 AAAGTACCTAGAACAATGTCTGG + Intronic
959929803 3:111967516-111967538 AAACAACTCATAACCATGCCTGG - Intronic
960025961 3:113009785-113009807 AAAGCACTTAGAACAATGCCTGG + Intronic
960315049 3:116166259-116166281 AAAGCACTTAGAACTGTGCCTGG - Intronic
960362649 3:116733401-116733423 AAAACACTTCTAACCACTTCTGG - Intronic
960736199 3:120783755-120783777 AAAGCACTTAAAATAGTGTCTGG - Intergenic
960862779 3:122168590-122168612 CAAGCACCTACCACCATGTCTGG + Intergenic
961021918 3:123515075-123515097 AAAGCACTTAGAACACTGCCTGG - Intronic
961286219 3:125806494-125806516 CAAGCACCTACCACCATGTCTGG + Intergenic
961570164 3:127791923-127791945 CAAGCACTCATCACCATGCCCGG - Intronic
962958578 3:140289124-140289146 AAAGCCCTTGGAACCATGCCTGG - Intronic
964584881 3:158286425-158286447 AAAGCACTTGTTACCGTGCCTGG + Intronic
964630640 3:158806124-158806146 AAAGGTCTTCAAACCATGTCTGG + Intronic
964659813 3:159107643-159107665 AAAGCACTTAGAGCAATGCCTGG - Intronic
965760349 3:172068808-172068830 AAAGCATTTAGAACAGTGTCTGG - Intronic
965918230 3:173877785-173877807 AAAGCATTTGTAACAATGCCTGG - Intronic
966532063 3:180992213-180992235 AAAGCATTTAGTACAATGTCTGG - Intergenic
967157106 3:186703397-186703419 AAAGCACTTATAAGAATGCCTGG - Intergenic
967199512 3:187059695-187059717 AAAGCACTTAGAACAATACCTGG + Intronic
967356055 3:188573101-188573123 AAAGCACTTACAACAGTGCCTGG - Intronic
967544488 3:190708387-190708409 AAAGTACTTAGAATCATGCCTGG - Intergenic
967999517 3:195195246-195195268 AAAGCACTTAGAACAATGCCTGG + Intronic
969126194 4:4949987-4950009 AAAGTGCTTAGAACCATGTTTGG - Intergenic
969167000 4:5324375-5324397 AAGGCACTTAGAACGGTGTCTGG + Intronic
969933881 4:10661894-10661916 AAGGAAATTATAACCATGTGTGG + Intronic
970319229 4:14859431-14859453 AAAGCACTTAGAATAATGGCTGG + Intergenic
970492352 4:16587263-16587285 AAAGCACTTAGAACAATGCCTGG - Intronic
970538444 4:17053783-17053805 AAAGCCCTTAAAAGAATGTCTGG - Intergenic
970550571 4:17176955-17176977 AAAGCACTTAGAACAATGGCCGG + Intergenic
970855363 4:20644864-20644886 AAAGTGCTTAGAACAATGTCTGG + Intergenic
970946511 4:21699304-21699326 CCAGCACATAGAACCATGTCTGG - Intronic
971409841 4:26358877-26358899 AAGGCACTTAGAACAATATCTGG - Intronic
971696147 4:29906239-29906261 AAATCACTCATCACAATGTCTGG + Intergenic
971768696 4:30868212-30868234 AAAACACTTAGCACCATGCCTGG - Intronic
972359312 4:38313055-38313077 AAAACACTTGTCACCATGCCTGG + Intergenic
972371538 4:38428598-38428620 AAAGCACTTATAGCAATTCCTGG + Intergenic
972715845 4:41644999-41645021 AAAGTACTTAGAACAATGCCTGG - Intronic
972855449 4:43100276-43100298 AAAGCACTTAAAATAATATCTGG + Intergenic
973031650 4:45349404-45349426 AAAGTACTTACAACAGTGTCTGG + Intergenic
973042863 4:45494651-45494673 AAAGCCGTTATAACCATACCAGG + Intergenic
973345553 4:49051163-49051185 AAAGCACCTATAACAGGGTCTGG - Intronic
973543658 4:51959168-51959190 AAAGCACTTACAACAGTGTCTGG - Intergenic
973641010 4:52902662-52902684 AAAGCACTCAGAACAGTGTCTGG - Intronic
973843897 4:54891278-54891300 AAAGCACTTAGAACAGTGCCTGG + Intergenic
974676236 4:65092920-65092942 AAAGCACTTATGACAGTGCCTGG + Intergenic
975504688 4:75124883-75124905 AAAGCACTTATAACAGTATCTGG - Intergenic
975771394 4:77727186-77727208 AAAGCACTTAGAACAGTGCCTGG - Intronic
975824856 4:78308728-78308750 AAAGCACTTGGAACCGTGCCTGG - Intronic
976035198 4:80810029-80810051 AAAACACTTATAACAGTGCCTGG + Intronic
976266988 4:83194088-83194110 AAAGCACTTGTCACCAGGTGTGG + Intergenic
976329818 4:83817297-83817319 AAAGTACTTACAACAGTGTCTGG + Intergenic
976625054 4:87171335-87171357 AAAGCACTAAGAACAATGTCTGG + Intronic
976902911 4:90201662-90201684 AAAGCACCAATAGCCATGTGTGG + Intronic
977087754 4:92625715-92625737 AAAGCATTTACAACGATGTCTGG + Intronic
977363576 4:96037352-96037374 AAAGCAGTTATAAGAGTGTCTGG + Intergenic
977604492 4:98968701-98968723 ACAGCACTTAGAACAATGTCTGG - Intergenic
977621067 4:99137595-99137617 AAAGCCCTTAAAAGCATTTCTGG - Intronic
977641485 4:99362395-99362417 AAAGCACTTAGAACAGTGCCTGG + Intergenic
977705473 4:100065822-100065844 AAAGCACTTAGAACAGTGCCTGG - Intergenic
977923368 4:102670347-102670369 AGAGCACTTAGAACAATGCCTGG + Intronic
978171646 4:105678586-105678608 AAAGCACTTAGAACAATGTCTGG - Exonic
978200737 4:106021208-106021230 AAAGCACATTTAAGAATGTCAGG - Intergenic
978267811 4:106847821-106847843 AAAGCACTTAAAACAGTGCCTGG + Intergenic
978508734 4:109491860-109491882 ACATCACTTTTAACCATATCTGG + Intronic
978667499 4:111202317-111202339 AAAACTCTTAGAACAATGTCTGG + Intergenic
978783668 4:112584047-112584069 ATATCACTTAAAACCATGCCAGG + Exonic
979176689 4:117673653-117673675 AAAGCACTTATAATTATGCCTGG - Intergenic
979392723 4:120145443-120145465 AAAGCACTTAAAACAGTGCCGGG + Intergenic
979414761 4:120422816-120422838 AAAGTACTTACAACAATATCTGG - Intergenic
979435451 4:120683368-120683390 AAAGCTTTTATAAAGATGTCAGG - Intergenic
979555831 4:122046391-122046413 AAAGCTCTTAGAACAATGTCTGG + Intergenic
979564397 4:122137769-122137791 AAACCAATCATAACCAGGTCAGG - Intergenic
979588954 4:122455528-122455550 AAAGCACTCAGAACCGTGTCTGG - Intronic
979615775 4:122740829-122740851 ATAGTACTTAGAACAATGTCTGG - Intronic
980000333 4:127479827-127479849 AAAGCACTTAGAAATATGTATGG - Intergenic
980844616 4:138309242-138309264 AAAGCACTTAAAAGAATGTCTGG + Intergenic
980941527 4:139279725-139279747 AAAGCACTTAAAAACGTGCCTGG - Intronic
980955459 4:139423977-139423999 AAAGCACTTAGAACCAAACCTGG - Intergenic
981073215 4:140567063-140567085 GAAGCACTTAGAACAATGTCTGG + Intronic
981098173 4:140803013-140803035 AATACACTTAAAACAATGTCTGG - Intergenic
981384584 4:144114169-144114191 AAAGCATTTAAAACCATTTGTGG - Intronic
981633736 4:146851177-146851199 AAAGCACTTAGACCTATGTCTGG - Intronic
981876530 4:149553241-149553263 AAAGCAGTTATTAACATGTATGG - Intergenic
982546940 4:156745683-156745705 CAAGCACCCACAACCATGTCTGG - Intergenic
982652067 4:158098894-158098916 CAAGCACATATCACCATGCCAGG + Intergenic
983213631 4:164982309-164982331 AAAGCACTTTGAACAGTGTCTGG + Intergenic
983232377 4:165142118-165142140 AAAACACTTAGAACCAGTTCTGG + Intronic
983510789 4:168607556-168607578 AAAGCACTCAGAACAGTGTCTGG - Intronic
983996879 4:174192943-174192965 AAGGCACTTATCACAATGTCTGG + Intergenic
984229681 4:177079718-177079740 AAATCACTTAGAACAATGTCTGG + Intergenic
984461245 4:180039886-180039908 AAAGCATTTATAACAATGCCTGG - Intergenic
984555599 4:181210813-181210835 AAAGTGCTTACAACAATGTCTGG - Intergenic
984987253 4:185343304-185343326 AAAGCATTTATAAGAATGTGTGG + Intronic
985136699 4:186793340-186793362 AAAGCACTTAGACCAATGCCAGG - Intergenic
986403392 5:7401157-7401179 AAAGCCCTTAGAACAATGCCTGG + Intronic
987206938 5:15637616-15637638 AATGCAGTTAAAACCATGCCTGG - Intronic
989052643 5:37336490-37336512 AAAGCACTCAGAACAATGCCTGG - Intronic
990173316 5:53079792-53079814 AAAGCACTTGATACCATGGCTGG - Intronic
990218514 5:53561178-53561200 AAACCACTTAAAACCATGGAAGG - Intronic
990624917 5:57599838-57599860 AAAGTGCTTAAAACCATGCCAGG + Intergenic
990630260 5:57661123-57661145 AAAGTACTTATCACAGTGTCTGG - Intergenic
990797726 5:59563539-59563561 AAAGCACTTACAGCTGTGTCTGG - Intronic
991037025 5:62137694-62137716 TAAGCACTTAGAACAGTGTCTGG - Intergenic
991044723 5:62210895-62210917 AAAGTAATTATAAAGATGTCGGG + Intergenic
991616197 5:68499216-68499238 AAAGCACTTGTTACAATGTGTGG + Intergenic
993089048 5:83400965-83400987 AAAGCACTTAAAACAATGTCTGG - Intergenic
993251905 5:85538085-85538107 AAAGCATTTAGAACAATTTCTGG - Intergenic
993274530 5:85839271-85839293 AAAGCACTTAGAACAGTGCCTGG - Intergenic
993318617 5:86443517-86443539 AAAGAAATTATAATAATGTCTGG + Intergenic
993588489 5:89762552-89762574 AAAGCCCTTAGCACAATGTCTGG + Intergenic
993921554 5:93811000-93811022 AAAGCACTTAAAACAACGCCTGG + Intronic
993956702 5:94243155-94243177 AAAACACTTAGAACAATGCCTGG + Intronic
994118137 5:96084023-96084045 AAAGCATTTAGAACAATGCCTGG + Intergenic
994128014 5:96191337-96191359 AAAGTACTTAGAACAATGCCTGG - Intergenic
995232201 5:109780040-109780062 AAAAAACTTACAACCATGACTGG - Intronic
995287889 5:110412677-110412699 AAACCCCTTAAAACCAAGTCAGG - Intronic
995323800 5:110868068-110868090 TAAGCACTTAAAAGAATGTCTGG + Intergenic
995610057 5:113899678-113899700 CAAGCACTAAGAACAATGTCTGG + Intergenic
995775618 5:115722128-115722150 ACAGCACTTACAACAGTGTCTGG - Intergenic
995832771 5:116372298-116372320 AAAGCACTCATAACAGTGTCTGG - Intronic
996333377 5:122356557-122356579 AAAGCTCTTATAAATATGTTAGG - Intronic
996408718 5:123132021-123132043 AAAGCACTTAGAACAGTGCCTGG + Intronic
996988367 5:129597304-129597326 AAAGCACTTAAAAACGTGTCTGG - Intronic
997203667 5:132028077-132028099 TAAGCACTTAGAACAGTGTCTGG + Intergenic
997483042 5:134203855-134203877 ACAGCACATGTCACCATGTCTGG + Intronic
997744591 5:136288028-136288050 AAATCATTTAGAACAATGTCTGG - Intronic
997759113 5:136427913-136427935 AAAGTGCTTAGAACAATGTCTGG - Intergenic
997805962 5:136918094-136918116 AAAGCACCTAGCACCATGCCAGG + Intergenic
998193477 5:140046031-140046053 AAAGTGCTTAGAACAATGTCTGG + Intergenic
998225590 5:140323899-140323921 AAAGCATTTATCACAGTGTCTGG - Intergenic
998244846 5:140490719-140490741 AAAGCATTTAAAATTATGTCAGG + Intronic
998889782 5:146733988-146734010 AAAGCACTTAAAACAATTCCTGG - Intronic
999116794 5:149171350-149171372 AAAGCACTTATCACATTTTCTGG - Intronic
999202838 5:149828451-149828473 AAAGCACTTAGAACAGTGCCTGG + Intronic
999342506 5:150784216-150784238 AAAGCACTTAGGACAACGTCTGG - Intronic
999494576 5:152084487-152084509 AAAACACTTAGAGCAATGTCTGG + Intergenic
999640492 5:153667575-153667597 TAAGCACTTAGTACCATGTCTGG - Intronic
999849863 5:155526412-155526434 AAAGCACCTGTATCCATGGCTGG - Intergenic
1000429310 5:161132338-161132360 AAAGCACTTTGAAAAATGTCTGG - Intergenic
1000466366 5:161582697-161582719 TAAGCAGTTAAAACCAAGTCAGG + Intronic
1001082085 5:168674878-168674900 GAACCACTTAGCACCATGTCTGG - Intronic
1001200115 5:169708316-169708338 AAAGCACTTAAAACAGTGCCTGG - Intronic
1001213200 5:169830270-169830292 AAAGCACTTATCATAATGGCTGG + Intronic
1001453109 5:171841237-171841259 AAAGCACTTAGAACCGTGTCTGG + Intergenic
1002151415 5:177234949-177234971 AAAACAGTAATAACAATGTCGGG - Intronic
1002385696 5:178865106-178865128 AATGCACTTAAAACCATATCGGG - Intronic
1003494066 6:6648667-6648689 ACAGCACTAATAACAATGCCTGG - Intronic
1003818721 6:9871087-9871109 AAAGCACTTAAAACAATGCCTGG + Intronic
1004314437 6:14573558-14573580 AAAGTGCTTAGAACCATGCCAGG - Intergenic
1006154118 6:32005046-32005068 AAAGCACTTAGAGCAGTGTCTGG + Intergenic
1006160425 6:32037782-32037804 AAAGCACTTAGAGCAGTGTCTGG + Intergenic
1006726567 6:36203337-36203359 AAAGCACTTAGCACAGTGTCTGG + Intronic
1006930018 6:37681879-37681901 AAAGCACTGACACCCTTGTCTGG - Intronic
1007216841 6:40246917-40246939 CAGGCACTTATCACCATGCCTGG - Intergenic
1007261980 6:40570312-40570334 AAAGCACTTAGAACAGTGTCTGG - Intronic
1007734154 6:43970108-43970130 AAAGTACTTAAAACAGTGTCTGG - Intergenic
1009826764 6:68875891-68875913 ACAGCACTTATAATCATATGGGG - Intronic
1010265189 6:73857743-73857765 AAAGAACTTAGAACAATGCCGGG - Intergenic
1010368134 6:75076310-75076332 AAGGCACTTAGTACCATGCCAGG + Intergenic
1010833029 6:80554137-80554159 AGAACACTTAGAACAATGTCAGG + Intergenic
1011187487 6:84694817-84694839 AAAGCACTTATAATGGTGCCTGG - Intronic
1011743937 6:90391020-90391042 AAAGCACTTGGAACAGTGTCTGG - Intergenic
1011994945 6:93574693-93574715 AAAGCATTTAATACAATGTCTGG - Intergenic
1012808326 6:103924814-103924836 AGAGCACTTATTAGGATGTCAGG + Intergenic
1012837686 6:104291143-104291165 AAAGCATTTATAATGATGTTTGG + Intergenic
1014863470 6:126498667-126498689 AAAGTACTTGGAACTATGTCTGG - Intergenic
1014880273 6:126715382-126715404 AAAGCACTGATAACTCTCTCAGG - Intergenic
1015229037 6:130892781-130892803 AAACAACTTAGAACCATTTCTGG - Intronic
1015862299 6:137693532-137693554 AAAGCATTTATAACAATATAAGG - Intergenic
1016536563 6:145113112-145113134 AAAGCACTTAGAAGAGTGTCTGG - Intergenic
1018792481 6:167159270-167159292 AAAGCACTTAGCGCCATGTCTGG + Intronic
1020910423 7:14122871-14122893 AAAGAACTTAAAACAGTGTCAGG - Intergenic
1021026734 7:15677281-15677303 AAAGCAATTAGAACAATGTCTGG - Intronic
1021183904 7:17540425-17540447 AAAGCACTTAGAGCCCTGTTTGG - Intergenic
1021444996 7:20723620-20723642 AAAACACTTAGAACAGTGTCTGG + Intronic
1021459077 7:20865434-20865456 AAAGCATTTAGAACAATGGCTGG - Intergenic
1021488480 7:21192667-21192689 AAAGGGCTTAAAACAATGTCTGG + Intergenic
1021989703 7:26129812-26129834 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1022017672 7:26365971-26365993 AAAGCACTCATGACAGTGTCTGG + Intronic
1022441722 7:30438456-30438478 AAAGCACTTAGAACCGTGTGTGG + Intronic
1022886184 7:34646991-34647013 AAAGCACTTAGAATAATGCCTGG - Intergenic
1024280736 7:47717120-47717142 AAAGCAATTAGAACAGTGTCTGG + Intronic
1024317828 7:48037299-48037321 AAAGCACTTAGAACAGTGCCTGG - Intronic
1026172857 7:67969726-67969748 AAAGCAATTAGAACTGTGTCTGG + Intergenic
1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG + Intergenic
1026257892 7:68728524-68728546 AAAGCACTTAGAACAATGCCTGG - Intergenic
1027759521 7:82260249-82260271 AAAACACTTAGAACAATGCCTGG + Intronic
1027764379 7:82321581-82321603 AAAGCACTTCCCACAATGTCTGG + Intronic
1028838352 7:95398861-95398883 AAATCACTTATCACCACCTCTGG + Intergenic
1028982761 7:96984757-96984779 GAAGAACTTATAAACATGTTGGG - Intergenic
1029860907 7:103570924-103570946 AAAGCACCTAGAACAATGTCTGG + Intronic
1029982722 7:104894286-104894308 AAAGCACTTAGCACAATGCCTGG + Intronic
1030926293 7:115459565-115459587 AAAGCACTTAAAACAATACCTGG - Intergenic
1030964587 7:115974913-115974935 AAAGCACTTAGAAGCATGCCTGG - Intronic
1031423694 7:121580551-121580573 CAAGCACTTATAACAATAACTGG + Intergenic
1032027301 7:128454195-128454217 AAAGCGCTTAGAACAATGCCTGG - Intergenic
1032455596 7:132071064-132071086 AAAGTACTTAGCACCATGTCTGG + Intergenic
1032477961 7:132225254-132225276 GAAGCATTTACAGCCATGTCTGG - Intronic
1032728632 7:134615701-134615723 AAAGCATTTAGAAGCATTTCTGG + Intergenic
1032928341 7:136636265-136636287 ACAGCACCTAGAACAATGTCTGG + Intergenic
1034049566 7:147968225-147968247 AAAGCCCTTGTAACCATTTCGGG - Intronic
1034123053 7:148644739-148644761 AAAGCACTTAGAAGAAGGTCAGG + Intergenic
1035699014 8:1623803-1623825 AAAACACTTATTAGCATTTCTGG + Intronic
1035779895 8:2219881-2219903 AAAGCACTAAGAACAGTGTCTGG - Intergenic
1037338942 8:17821633-17821655 AAAGCAATTAAAATCGTGTCCGG - Intergenic
1037673989 8:21038830-21038852 AAGGCACTTAGAATAATGTCTGG + Intergenic
1037934148 8:22903364-22903386 AAAGCACTTAGAACAGTGTCTGG + Intronic
1038324496 8:26562317-26562339 AAAGCACTGAGAACAATGCCTGG + Intronic
1038967052 8:32586075-32586097 AAAGCTCTTAGAACAATGCCTGG + Intronic
1039189146 8:34952540-34952562 AATGCACTTAAAATAATGTCTGG + Intergenic
1039582678 8:38679880-38679902 AAAGCACTTAAAACAGTGTCTGG + Intergenic
1039930058 8:41978463-41978485 AAAGCACTTAGAATAGTGTCTGG + Intronic
1040409965 8:47144107-47144129 AAAGCAAATATAACCACGTGGGG + Intergenic
1040578189 8:48672808-48672830 AGAACACTTATAAATATGTCTGG - Intergenic
1041184319 8:55283247-55283269 AAAGCACTTAGCACCATGCCAGG - Intronic
1041825283 8:62088695-62088717 AAAGCACTTAGATCAATGCCTGG - Intergenic
1042029086 8:64454705-64454727 AAAGCATTTCAAACCATGGCCGG - Intergenic
1042211069 8:66381161-66381183 AAAGCTCTTAGAACTATGCCAGG - Intergenic
1042831152 8:73030144-73030166 ATACCTCTTATAAGCATGTCTGG + Intronic
1042845426 8:73165539-73165561 AAAGCACTCATAGCCAAGTGTGG + Intergenic
1042868360 8:73375871-73375893 AAAGCACTTAGAAGAATGCCTGG + Intergenic
1043074932 8:75686273-75686295 AAAACACTTAAAACCAAGCCTGG - Intergenic
1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG + Intergenic
1043369982 8:79579749-79579771 AAAGAACTTAGAACAGTGTCTGG + Intergenic
1043740599 8:83806369-83806391 AAAGCACTCATCACAATGTCTGG + Intergenic
1043973684 8:86561956-86561978 AAAGCACTTATGAAGCTGTCAGG + Intronic
1043977875 8:86603533-86603555 AAAGCACTTAGAACACTGCCTGG - Intronic
1044418763 8:91967154-91967176 AAAGCACTTCATACCATGCCTGG + Intronic
1044833171 8:96269943-96269965 AAAGCACTTAAAACAGTGCCTGG - Intronic
1044846598 8:96387976-96387998 TAAACATTTATCACCATGTCTGG + Intergenic
1044871262 8:96622140-96622162 AAAGCACTTAGAACAATGCCTGG + Intergenic
1045505550 8:102775855-102775877 AAAGCACTTAGCACCATGCCTGG + Intergenic
1045559812 8:103250158-103250180 AAAGCACTTAAAACAGTGTCTGG + Intergenic
1047074218 8:121381772-121381794 AAAGCACTTAGAACAAAGCCTGG - Intergenic
1047633042 8:126729006-126729028 AAATCATTTAGAACCATGCCTGG - Intergenic
1047716708 8:127602454-127602476 AAAGCCCTTAGAACAGTGTCTGG + Intergenic
1047738011 8:127783568-127783590 AAAGCACTTAGACCAATGTCTGG + Intergenic
1047803255 8:128331819-128331841 AAAGCACTTCAAGCAATGTCTGG + Intergenic
1047921650 8:129640674-129640696 AAAGCACTCAAAACAGTGTCTGG + Intergenic
1048016168 8:130499588-130499610 AAAGCATTTGGAACCATGCCTGG - Intergenic
1048298006 8:133229055-133229077 AAAGCACTGAGAGCAATGTCTGG - Exonic
1048483442 8:134824634-134824656 TGAGCACTTAGAATCATGTCAGG - Intergenic
1048485406 8:134843447-134843469 AAAGCACTTAGAACCATACTTGG - Intergenic
1048547695 8:135403017-135403039 AAAGCACTTATAGCAATGTCTGG - Intergenic
1048556060 8:135477667-135477689 AAAGCACCTTTTACCATGTAAGG - Intronic
1048575056 8:135683777-135683799 TAAGCACTTTTAAACATTTCTGG - Intergenic
1048828722 8:138455488-138455510 AAAGCTCTCAGAACAATGTCTGG - Intronic
1048947879 8:139467144-139467166 AAAGCACTTAGAACAGTGCCTGG + Intergenic
1049971282 9:824299-824321 AAAGCACTTATAACAGTGTTAGG + Intergenic
1051046215 9:12877338-12877360 ATAGCACATATAATCATGTACGG + Intergenic
1051093794 9:13441380-13441402 AAAGCACTTAAAACAATGGCTGG - Intergenic
1051308233 9:15739580-15739602 AAAGCATTTAGAACAATGCCTGG + Intronic
1051432835 9:16998124-16998146 ACAGCACTATTAACCATCTCTGG - Intergenic
1051472600 9:17463862-17463884 AAAGCACTTATAACAGTGACTGG + Intronic
1051591368 9:18779404-18779426 AAAGCACTGAGCACTATGTCTGG - Intronic
1051681515 9:19612284-19612306 AAAGCACTTACAACAAGGCCTGG - Intronic
1051856227 9:21569082-21569104 TAAGCACTTATGTCCATGTAGGG - Intergenic
1052197063 9:25730916-25730938 AAAGCACTTAAAAGAGTGTCAGG + Intergenic
1052361186 9:27560993-27561015 AAAGCACTTAGAACAGTGCCTGG - Intronic
1052387653 9:27840664-27840686 AAAGCTCTTAGCACCATGTTTGG - Intergenic
1052408516 9:28092895-28092917 AAAGCACTTAGTCCAATGTCTGG - Intronic
1053438134 9:38091082-38091104 AAAGGACTTAAATCCATGCCTGG - Intergenic
1054951825 9:70860415-70860437 TAAGCACTTAGAATCTTGTCTGG - Intronic
1054974250 9:71123477-71123499 AAAGCACTTAGAACAGTGCCTGG + Intronic
1055446464 9:76388417-76388439 AAAGCACTTAAAACGGTGCCTGG + Intronic
1055481411 9:76712177-76712199 AAAACCCTTAGAACCATGCCTGG - Intronic
1055671694 9:78613242-78613264 AGGGCAATTATATCCATGTCAGG - Intergenic
1055718780 9:79148326-79148348 AAATTATTTAGAACCATGTCTGG + Intergenic
1056343345 9:85662621-85662643 AAAGCACCTGTAACAGTGTCTGG - Intronic
1056919236 9:90771650-90771672 AAAGCACTTCTAATAATGCCTGG + Intergenic
1058173070 9:101705794-101705816 AAAGCACTTAGGACAGTGTCTGG - Intronic
1058501680 9:105625615-105625637 AAAGAACTTAGCACCATGCCTGG + Intronic
1058654998 9:107212275-107212297 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1059131118 9:111750475-111750497 CAGGCACTTACAACCATGCCTGG + Intronic
1059225816 9:112672061-112672083 AAAGCACTTAAAACAATGCCTGG + Intergenic
1059461150 9:114431054-114431076 AAACCACTTTCAACCAAGTCTGG + Intronic
1059709810 9:116857138-116857160 AAAGCACTTAGAACCGTGCTTGG + Intronic
1060010198 9:120037106-120037128 AAAGCACTTAGAACAGTTTCTGG + Intergenic
1060400341 9:123344978-123345000 AGAGCACTTAGAATCATGCCTGG + Intergenic
1060907481 9:127320168-127320190 AAAGCATTTATTACAGTGTCTGG + Intronic
1061067723 9:128289067-128289089 AAAGCACTTAGCACAATGCCTGG - Intergenic
1061303555 9:129720030-129720052 AAAGCGCTTAGAACAATGCCTGG + Intronic
1061424770 9:130492087-130492109 AAAGCACCTGGAACAATGTCTGG + Intronic
1061867991 9:133505187-133505209 AAAGCACTTCTAACAGTGTCTGG + Intergenic
1186203246 X:7175349-7175371 CAAGCACGTACCACCATGTCTGG - Intergenic
1186221930 X:7358325-7358347 GAAGCACTTAGAACCATGTCTGG - Intergenic
1186423809 X:9447789-9447811 AAAGCACTTATAGACTTGTAAGG - Intergenic
1186677722 X:11836431-11836453 AAAGCACTTAGCACAGTGTCTGG - Intergenic
1186951184 X:14627261-14627283 AAAGCACTTAGAAGCAGGTCTGG - Intronic
1186995625 X:15118543-15118565 AAAACACTTAGAACAATGCCTGG + Intergenic
1187091864 X:16105504-16105526 ACAGCACTTATAAAAATGACTGG - Intergenic
1187199406 X:17120490-17120512 AAAGCACTTAGAATGATGCCTGG + Intronic
1187305305 X:18089919-18089941 AAAGCACTTAGAAGAGTGTCAGG - Intergenic
1187719868 X:22139197-22139219 AAAGTACTTATAAGAATGCCTGG + Intronic
1189084449 X:38006212-38006234 AAAGCACTTACAACAGTGCCTGG + Intronic
1189137609 X:38565120-38565142 TCAGCACTTAGAACTATGTCTGG + Intronic
1189397111 X:40632866-40632888 AAAGCACTTAGCAGCATCTCTGG + Intronic
1189795587 X:44642935-44642957 AAAGCACTTAGAACAATGCCTGG + Intergenic
1190569534 X:51767544-51767566 AAAGCACTAAAAACAATGGCAGG + Intergenic
1191044173 X:56118271-56118293 AAAGCACTTAATACAATATCTGG + Intergenic
1191652994 X:63561871-63561893 AAGGCATTTAAAACAATGTCTGG + Intergenic
1191736284 X:64391681-64391703 AAAGTGCTTAGAACAATGTCTGG - Intronic
1192095848 X:68209787-68209809 AATGAACTTAGCACCATGTCTGG + Intronic
1192146112 X:68684040-68684062 TAAGCACTTAGAACAATGTCTGG + Intronic
1192250435 X:69408668-69408690 AAAGCACTTAGCATAATGTCTGG - Intergenic
1192594044 X:72387684-72387706 AAAGCACTTAAAACAGTGCCAGG + Intronic
1192862941 X:75097811-75097833 AAAGGACTTATAACAGTGCCTGG - Intronic
1193144226 X:78060901-78060923 AAAGCACTTATTACAATGTCTGG + Intergenic
1193318550 X:80093546-80093568 AAAGAACTTAGAACAATGCCTGG + Intergenic
1193321079 X:80122288-80122310 AAAGCACTTAAAATAGTGTCTGG + Intergenic
1193584064 X:83299311-83299333 AAAGCACTTATAACAGTGTCTGG - Intergenic
1193869061 X:86774753-86774775 AAAGCAATTATATTCATGACAGG + Intronic
1194265349 X:91746334-91746356 AAAGCACTTAGAACAGTGTCTGG - Intergenic
1194429567 X:93784714-93784736 ATAGCACTTATCACAATGTATGG - Intergenic
1194796477 X:98217594-98217616 ATAGCACCTATAATCATGTTTGG + Intergenic
1195348005 X:103970391-103970413 AAAGCACTTAGAACAATGCCTGG + Intergenic
1195355485 X:104035748-104035770 AAAGCACTTAGAAAAATGCCTGG + Intergenic
1195359437 X:104068450-104068472 AAAGCACTTAGAACAATGCCTGG - Intergenic
1196021067 X:110991550-110991572 AAAGTACTTATCACCATGCCTGG + Intronic
1196289336 X:113920525-113920547 AAAGCACTTATCACAATGCTTGG + Intergenic
1197929054 X:131677311-131677333 AAAACACTTATGACAATGCCTGG - Intergenic
1197999495 X:132418329-132418351 AAAGCACTTTGAACAATGCCTGG - Intronic
1198151279 X:133912833-133912855 AAAGCACATATCACAATGTCTGG + Intronic
1198217124 X:134565765-134565787 AAACCACTTAGAACAATGTCTGG + Intergenic
1199092473 X:143707725-143707747 AAAGCACTTAGAACAATTTCAGG - Intergenic
1199103947 X:143839530-143839552 AAAGCACTTAGAACAATTTCAGG - Intergenic
1199775270 X:151005393-151005415 AAAGCACTTACAACCAGGTGTGG - Intergenic
1199881677 X:151978474-151978496 AAAGCAGTTAGCACCATGTCTGG + Intergenic
1200582500 Y:4966796-4966818 AAAGCACTTAGAACAGTGTCTGG - Intergenic
1201590309 Y:15607460-15607482 AAAGCACTTAGAATCATGTCTGG - Intergenic
1201983135 Y:19929561-19929583 AAAACACTTAAAACAATTTCAGG - Intergenic
1202371543 Y:24200797-24200819 AAAGCATTTATAACAATATGTGG + Intergenic
1202499242 Y:25469319-25469341 AAAGCATTTATAACAATATGTGG - Intergenic