ID: 945712475

View in Genome Browser
Species Human (GRCh38)
Location 2:213316045-213316067
Sequence CAGGGTTGGCAATTTAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945712475 Original CRISPR CAGGGTTGGCAATTTAAATT TGG (reversed) Intronic
901121288 1:6896167-6896189 TAGGGTTGAAAATTGAAATTTGG + Intronic
902244392 1:15110765-15110787 CAGGGATGGAAATTGAACTTGGG - Intronic
905799785 1:40835786-40835808 TAGGGTTTGCAATTTTAAATAGG + Intronic
906611309 1:47205602-47205624 CTGGGTTGGAAATGTAACTTTGG - Intergenic
907070662 1:51531725-51531747 CTGGGTTGGTGATATAAATTTGG + Intergenic
907484181 1:54765666-54765688 AAGTGTTTGCAATTTAAAATAGG + Intergenic
907499596 1:54868616-54868638 CAAGGTTGGCCATTCTAATTGGG + Intronic
910092418 1:83480774-83480796 CAGGGCTGGAGATGTAAATTTGG - Intergenic
917152197 1:171957096-171957118 CTGGCTTGGCAATTAACATTAGG + Intronic
917271456 1:173279448-173279470 CTGGGTTGCATATTTAAATTGGG - Intergenic
918947015 1:191079221-191079243 TTGAGTTGGCAATGTAAATTTGG + Intergenic
919048043 1:192478592-192478614 CAGAGTTAGAAATTAAAATTAGG - Intergenic
1064387250 10:14907301-14907323 CAAGTTTGTCAATTTAAATCAGG + Intronic
1065402971 10:25327642-25327664 CTAGGGTGGCTATTTAAATTTGG - Intronic
1066283828 10:33944580-33944602 CAGGGTTCTCAATGTAAAGTCGG - Intergenic
1071809220 10:89160515-89160537 CAGGCTTGGCACTTAAAAGTTGG + Intergenic
1073855230 10:107665720-107665742 GAGGGTTGGAATTTTAAAATAGG - Intergenic
1076864167 10:133159277-133159299 CAGGGTGGGCATTTTCAATAAGG + Intergenic
1078430792 11:11286890-11286912 CAGGGTTTGCCATCTAACTTCGG + Intronic
1078618804 11:12889209-12889231 CAGGGTGGGCTATTTAAAAGGGG + Intronic
1078620746 11:12905511-12905533 GAGGGAAGGCAATTTAAATTCGG + Intronic
1079622413 11:22570077-22570099 CAAGGTTTGAAATTTAAACTAGG - Intergenic
1079944652 11:26726586-26726608 TAGGGTTTGCAATTTAAATAGGG - Intergenic
1080134864 11:28842886-28842908 CAGGGCAGGAAACTTAAATTGGG - Intergenic
1080335455 11:31190514-31190536 CAGTGTTTGCAATTACAATTTGG - Intronic
1081672145 11:44948468-44948490 CCGGGTTGTCATTTTAAATAGGG - Intronic
1083193482 11:61068982-61069004 GAGGGGTGGCGATTTAAATAGGG - Intergenic
1083415363 11:62522051-62522073 CAGGTCAGGCATTTTAAATTTGG + Exonic
1083710020 11:64542434-64542456 CAGTGATGCCATTTTAAATTCGG - Intergenic
1085788413 11:79475048-79475070 CAGGCTTGGCAGTAGAAATTAGG - Intergenic
1086314293 11:85574260-85574282 CAAGGTTAGAAATTTAAATTTGG - Intronic
1087251283 11:95903180-95903202 GAGTGTTTGAAATTTAAATTAGG - Intronic
1087605598 11:100373753-100373775 CAAGGTTGGAAATGTAGATTTGG - Intergenic
1087751430 11:102011495-102011517 CAGAGTTGGCATTTTAAATTTGG - Intergenic
1088280161 11:108127221-108127243 CAGGGTTGGAGATAGAAATTTGG + Intronic
1088726883 11:112646613-112646635 CAGGGTTGGCAAATACAATCTGG + Intergenic
1090284906 11:125491390-125491412 CAGGGTAGGCAGTGTATATTTGG - Intronic
1093143287 12:15535242-15535264 CTGGGCTGGAAATATAAATTTGG + Intronic
1093201640 12:16194189-16194211 CAGGGTAAGAAATTTCAATTTGG - Intronic
1093267551 12:17021658-17021680 CAGGGGTGTAAATTTAGATTTGG + Intergenic
1093907274 12:24707858-24707880 CAGGGCTGGACATATAAATTTGG + Intergenic
1093907373 12:24709162-24709184 CAGGGCTGGACATATAAATTTGG - Intergenic
1096877936 12:54645019-54645041 CAAGAATGGCAATTTAAATCTGG + Intronic
1097600783 12:61690075-61690097 CACTGTTGGGAATGTAAATTAGG + Intergenic
1098227928 12:68343959-68343981 CAGGGTGGGCACTTTTAATTTGG - Intergenic
1098877332 12:75879798-75879820 CAGAATTGGCAATTCACATTGGG + Intergenic
1099141929 12:78988925-78988947 CAGAGTTGGTAATTTTGATTAGG + Intronic
1100035697 12:90248772-90248794 CAGGGTTAGAAAGATAAATTTGG - Intergenic
1103138823 12:118530904-118530926 CAGAGTTGGAAAGTTAAATTTGG - Intergenic
1103346585 12:120255103-120255125 CAGGGGTGGAAATATAAATTTGG + Intronic
1109921599 13:69069992-69070014 CAAGTTTGGCAATTTCTATTTGG + Intergenic
1110976565 13:81843375-81843397 GAGGGTTGGCCAGTGAAATTAGG - Intergenic
1111047463 13:82833306-82833328 CAGGCATAGCAATTTACATTTGG + Intergenic
1111415270 13:87933039-87933061 CAGGGTTAGCATTGTAAAGTGGG - Intergenic
1114617051 14:24073934-24073956 AAGGGTTGGCACTTTGAGTTGGG - Intronic
1114791740 14:25667329-25667351 GTGGGTTGGCAACTTAAATAAGG + Intergenic
1115316872 14:32034065-32034087 AAGTATAGGCAATTTAAATTTGG + Intergenic
1117291761 14:54341424-54341446 CTGTGTTGGGAGTTTAAATTGGG + Intergenic
1121673093 14:95728564-95728586 GAGGGTTGGAAATTAAAATGAGG - Intergenic
1122404254 14:101490505-101490527 TAGGGTTGGAGATATAAATTTGG + Intergenic
1123792000 15:23731065-23731087 AAGGTTTGGCAAATTAAATGTGG - Intergenic
1124550768 15:30679468-30679490 CAGGGCTAGAGATTTAAATTTGG + Intronic
1124680482 15:31726207-31726229 CAGGGCTAGAGATTTAAATTTGG - Intronic
1125469625 15:39990190-39990212 CTAGGTTGGCCTTTTAAATTAGG + Intronic
1126855963 15:52839834-52839856 CAGGGTAGGAAATTTAAGCTGGG - Intergenic
1127520858 15:59741832-59741854 CAGGGCTGGAAATTTAATTATGG - Intergenic
1127831044 15:62751670-62751692 CAGGGTGCCCAATGTAAATTTGG - Intronic
1131499173 15:92944912-92944934 CTGGGCTGGAGATTTAAATTTGG + Intronic
1135198732 16:20418279-20418301 CAGGGCTGGGAATTTTAGTTGGG + Intronic
1135806064 16:25543815-25543837 GATGGCTGGCAATTTACATTAGG - Intergenic
1141943109 16:87291468-87291490 CAGGGGTGCTAATTAAAATTTGG - Intronic
1145854299 17:28138193-28138215 CAGGGTTGGAAATAAAAATTTGG + Intronic
1146535852 17:33651415-33651437 CAGTGTTGGAATTTTACATTTGG - Intronic
1146806104 17:35866276-35866298 CAAGGATGTCAAGTTAAATTTGG + Intronic
1150511543 17:65757522-65757544 CAGCATTGGCAATTTCAAGTGGG - Intronic
1151258633 17:72899344-72899366 CAGGATAGGAAATTTAAAGTGGG - Intronic
1151325204 17:73375555-73375577 CAGGGTTTGAAATTTTAAATGGG - Intronic
1153602677 18:6796967-6796989 TGGGGATGGCAATTGAAATTAGG + Intronic
1156239060 18:35234051-35234073 CAGGGTTGGAAGTAGAAATTTGG + Intergenic
1160080134 18:75718590-75718612 CAGTGTTGGAGATTCAAATTGGG + Intergenic
1167034280 19:46984636-46984658 CAGGGTTGCTATTTTAAAATGGG + Intronic
1167706525 19:51084386-51084408 CGGGGTTGGAAATTCAAAATAGG + Intergenic
925773808 2:7311790-7311812 AAGGCTTGGCAATTTACACTTGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932102530 2:68913716-68913738 CTGGGCTGGAAATGTAAATTTGG + Intergenic
932231723 2:70088676-70088698 CTGGGTTGGCAATTTTGATCTGG - Exonic
938241017 2:129742335-129742357 CAGGGCTGGCAATTTAGTTAGGG + Intergenic
939222691 2:139323186-139323208 CAGGATTTGAAATTTAAATTTGG + Intergenic
939856582 2:147365946-147365968 CAAGGTTTGCAATTTAAGTAGGG - Intergenic
940506996 2:154568488-154568510 GTGGGTAGGCAATTTAAACTGGG + Intergenic
940521476 2:154755813-154755835 TAGGGTGGGAAATTTAGATTTGG + Intronic
940611294 2:155995069-155995091 CAGCTTTGGCTATTGAAATTTGG + Intergenic
943353773 2:186825197-186825219 CAGAGTTGGGGATGTAAATTAGG - Intergenic
944058817 2:195549682-195549704 CTGGGCTGGAAATATAAATTTGG + Intergenic
944276631 2:197846287-197846309 CAGGACTGGCAAATTAGATTTGG + Intronic
945712475 2:213316045-213316067 CAGGGTTGGCAATTTAAATTTGG - Intronic
945777653 2:214127252-214127274 CAGGGATGACAATTTTAATGAGG - Intronic
947890751 2:233617094-233617116 CAGGGTTGTCAATGTCATTTCGG + Intergenic
947892366 2:233635926-233635948 CAGGGTTGTCAATCTCATTTTGG + Intronic
948366145 2:237456118-237456140 CAGGGTTGGCAATGGAAAGAAGG - Intergenic
1169254716 20:4088068-4088090 CATGGCAGGCAATTTAAAATGGG - Intergenic
1170107856 20:12771443-12771465 CAGACCTGGAAATTTAAATTTGG + Intergenic
1170384735 20:15804042-15804064 CTGGGTTAGCACATTAAATTAGG - Intronic
1170605435 20:17872186-17872208 CAAGGTTGGAAATGTAACTTGGG + Intergenic
1174111943 20:48203190-48203212 CAGGGTTGGCACTTTAAATGGGG - Intergenic
1178244878 21:30940969-30940991 CAGGTCTGGGAATTTTAATTTGG - Intergenic
1179079093 21:38153697-38153719 CAAGGATGGAAATATAAATTGGG + Intronic
1182673436 22:32017368-32017390 CTGGGTGGGGAATTTAATTTTGG - Intergenic
950280648 3:11705054-11705076 CAAGGTTGGAAATTTAGATTGGG + Intronic
951142358 3:19178990-19179012 CAGAGTGGGAAATTTGAATTAGG + Intronic
953266194 3:41391159-41391181 TAGGGTTTGCAAGTTAATTTGGG - Intronic
953600605 3:44360112-44360134 CAGAGATGGCAATTTAAAATAGG - Intronic
955774590 3:62419875-62419897 CAGGGTTGGCTAATCATATTAGG + Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
956733262 3:72216145-72216167 CAGGGTTAGAAATAGAAATTTGG - Intergenic
960234314 3:115264030-115264052 AGGGGTTTACAATTTAAATTAGG - Intergenic
960995424 3:123337081-123337103 AAGGGTTGTAAATTTAAATGAGG - Intronic
961097081 3:124166680-124166702 CAGCGGTGTCAGTTTAAATTTGG - Intronic
962006001 3:131350714-131350736 CAGAGTTGGCATTTGAAACTAGG + Intergenic
962274333 3:134000708-134000730 CTGGGTTGCCATTTTAAATTGGG - Intronic
966075400 3:175930851-175930873 CAGTAGTAGCAATTTAAATTGGG - Intergenic
970409785 4:15793186-15793208 CTGGGTTGGAGATATAAATTTGG - Intronic
971210753 4:24613765-24613787 TAGGGCTGGAAATGTAAATTTGG + Intergenic
971355719 4:25893674-25893696 GAGGGTCAGCAATTTATATTGGG - Intronic
972163658 4:36256482-36256504 CAGGCTTTCCAATTTAAAGTAGG - Intergenic
973540008 4:51926266-51926288 TAGGTTTGCCAATTTAAGTTTGG - Intergenic
973789386 4:54364295-54364317 CAGGCTTGACAATTTATTTTTGG + Intergenic
974100902 4:57415103-57415125 CAGGGATGGGGTTTTAAATTTGG + Intergenic
978049974 4:104186420-104186442 TAGGGTTGCCAAATTAAATACGG + Intergenic
979369468 4:119867083-119867105 CTGGGCTGGAAATATAAATTTGG + Intergenic
979609666 4:122675770-122675792 CAGGGTTAGAATTTTAAAATTGG - Intergenic
980556339 4:134410428-134410450 ATGGGTTTGTAATTTAAATTTGG - Intergenic
984279499 4:177652220-177652242 CAGGTTTATCAATTTATATTTGG + Intergenic
985297567 4:188451868-188451890 CAGGGCTGGGAATTTATCTTTGG + Intergenic
986934192 5:12862833-12862855 CCAGATTGGCAATATAAATTTGG + Intergenic
987356870 5:17071186-17071208 CACGGGTGTCAAGTTAAATTTGG + Intronic
987546671 5:19319414-19319436 CTGGATTGGGAATATAAATTTGG - Intergenic
988324350 5:29742498-29742520 CAGGTTTGTCATTTTAACTTAGG - Intergenic
989747378 5:44846168-44846190 TATGGTTGGCAATTTGAATTGGG - Intergenic
992536870 5:77715060-77715082 GAGGGTTTGCAATTTAAAATAGG + Intronic
992857830 5:80881363-80881385 CAGAGTTCGTAATTTACATTGGG + Intergenic
993355326 5:86899754-86899776 CAGTGATGGCAATTTGAATAGGG - Intergenic
994562447 5:101393699-101393721 CAAGATTGACAATTTAACTTAGG + Intergenic
996891535 5:128427021-128427043 CAAGGTTGGCAATATAAATTTGG - Intronic
996929480 5:128869014-128869036 CTGGGTTGGGAATATGAATTTGG - Intronic
997407914 5:133666967-133666989 CAGGGGTGGAAATAGAAATTTGG - Intergenic
998649661 5:144103905-144103927 CAGAGGTGGCAAATTGAATTGGG - Intergenic
998895847 5:146799244-146799266 CTGTGTTAACAATTTAAATTAGG - Intronic
999916775 5:156271206-156271228 AAGGGTGGGAAGTTTAAATTGGG + Intronic
1001201720 5:169723721-169723743 CAGGGGTTGCAATTTTAAATAGG - Intronic
1002525494 5:179813421-179813443 CAGTGTTGGGAATTGAATTTGGG + Intronic
1004581680 6:16960544-16960566 CAGCGTTGGCAGTTTACATTAGG - Intergenic
1005431441 6:25762007-25762029 CAGTGATGGCAATTTAAACGTGG + Exonic
1006678756 6:35782051-35782073 CAGGGTTTGCAGTTTTAAATGGG + Intronic
1007194925 6:40052147-40052169 CAGGGTTAGCAATTAAAAGATGG + Intergenic
1012474447 6:99604662-99604684 CAGTGCTGGTAATTTAAACTGGG + Intergenic
1012549223 6:100452548-100452570 GAGGGTGGGCCATTGAAATTGGG + Intronic
1012556361 6:100517409-100517431 CAGGGTTGGCAATGTTTAATTGG - Intronic
1014028534 6:116675926-116675948 CAGGGATGGAAATTTGAATTTGG + Intergenic
1015003480 6:128249238-128249260 CAGGGTTATCAATTTCAATTGGG - Intronic
1015210924 6:130697351-130697373 CAGGGTTGCAACTTAAAATTTGG + Intergenic
1015397318 6:132749537-132749559 GTGGGTTGGCAATTTGAACTTGG - Intronic
1015853046 6:137593927-137593949 CTGGCTTGGCAATTAACATTTGG + Intergenic
1016012322 6:139150175-139150197 TAGGTTTTGCATTTTAAATTAGG + Intronic
1016125992 6:140404513-140404535 CAGGATTGCCCATTTACATTGGG + Intergenic
1016376740 6:143429156-143429178 TAGGGTTGGCAAATTATACTTGG + Intronic
1016738260 6:147503867-147503889 CTGGGTTGGCAACTTAATTGGGG - Intergenic
1017584741 6:155908540-155908562 CACAGTTGGACATTTAAATTAGG - Intergenic
1019655778 7:2194279-2194301 CAGGGCTAGCCATTTAATTTTGG - Intronic
1020435149 7:8153593-8153615 CAGTGTTGGTAATTTAAGATAGG + Intronic
1020552493 7:9624672-9624694 CAGGTCTGGGAATATAAATTGGG + Intergenic
1023182097 7:37495217-37495239 CAGGAATGACAATTAAAATTAGG - Intergenic
1023480470 7:40628444-40628466 CAGAGTATGCCATTTAAATTGGG + Intronic
1023726608 7:43148580-43148602 CAGTGTTGGATACTTAAATTTGG + Intronic
1024507453 7:50174316-50174338 CAGGGTTGGCAAATTTAGTCAGG - Intergenic
1027309275 7:76937266-76937288 CAGGGCTGGAGATGTAAATTTGG - Intergenic
1027736230 7:81936128-81936150 CAAGGTTGGAGATATAAATTAGG + Intergenic
1028116659 7:87004863-87004885 CAGGGTTAGCAATTTTCTTTGGG - Intronic
1028935994 7:96464838-96464860 CTGGGATGGCAATTTAAGTCAGG + Intergenic
1030483663 7:110137870-110137892 CAGAGATGCCAATTTAATTTAGG - Intergenic
1033505843 7:141998939-141998961 TAAGGGTGGCAATTTTAATTAGG - Intronic
1042527900 8:69783880-69783902 CAGGGTTCATAATTTACATTAGG - Intronic
1046049312 8:109002750-109002772 CAAGGTTGGCAAATTAGAGTTGG - Intergenic
1048565204 8:135588797-135588819 CAGAGTTAGAAATTTAGATTTGG - Intronic
1050248760 9:3720765-3720787 CATGGTTTGCAATTTAAAATAGG - Intergenic
1052875195 9:33554437-33554459 CAGAGCTGGAAATTTATATTAGG + Intronic
1053168991 9:35864994-35865016 CAGAGTTTGAACTTTAAATTGGG - Intergenic
1053500826 9:38589893-38589915 CAGAGCTGGAAATTTATATTAGG - Intergenic
1054786508 9:69215427-69215449 CAGCTTTTGCACTTTAAATTGGG - Intronic
1055422945 9:76162837-76162859 CAGTGTTGGAAATTCTAATTCGG - Intronic
1057680233 9:97174386-97174408 CAGAGCTGGAAATTTATATTAGG - Intergenic
1058881645 9:109290517-109290539 CTGGGATAGCAATTTAAACTAGG - Intronic
1059306460 9:113356972-113356994 CTGGGTTGGAGATATAAATTTGG + Intronic
1186754879 X:12659931-12659953 CAGGTTTGGCACTTTGAATTTGG - Intronic
1187576092 X:20557189-20557211 CTGGGTTTGAAATTTAGATTAGG - Intergenic
1188627333 X:32301360-32301382 GTGGTTTGGCAAATTAAATTTGG + Intronic
1190950312 X:55137138-55137160 CAGGCTTGGCAATACACATTTGG + Intronic
1191047013 X:56149267-56149289 CAGGGATAGAAATTTAGATTTGG + Intergenic
1191588216 X:62851853-62851875 CAGGGATGGCAATTTTACATGGG + Intergenic
1196704852 X:118708207-118708229 CTGGGTTGGAAACTCAAATTTGG - Intergenic
1199841559 X:151654369-151654391 CAGGACTGGAAATTTGAATTTGG + Intronic
1201685822 Y:16701439-16701461 CAGGGCTGGAAATATGAATTTGG + Intergenic
1202269842 Y:23060956-23060978 CAGAGATGAGAATTTAAATTTGG + Intergenic
1202422836 Y:24694702-24694724 CAGAGATGAGAATTTAAATTTGG + Intergenic
1202447953 Y:24975384-24975406 CAGAGATGAGAATTTAAATTTGG - Intergenic