ID: 945712734

View in Genome Browser
Species Human (GRCh38)
Location 2:213319567-213319589
Sequence GATTTTGTATATTCATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 405}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945712732_945712734 -7 Left 945712732 2:213319551-213319573 CCCTGTTGCTCACTATGATTTTG 0: 1
1: 0
2: 0
3: 28
4: 536
Right 945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG 0: 1
1: 0
2: 3
3: 32
4: 405
945712731_945712734 23 Left 945712731 2:213319521-213319543 CCATTTCTCAAAAGTGTTTTGTA 0: 1
1: 0
2: 2
3: 36
4: 513
Right 945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG 0: 1
1: 0
2: 3
3: 32
4: 405
945712733_945712734 -8 Left 945712733 2:213319552-213319574 CCTGTTGCTCACTATGATTTTGT 0: 1
1: 0
2: 1
3: 7
4: 186
Right 945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG 0: 1
1: 0
2: 3
3: 32
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945712734 Original CRISPR GATTTTGTATATTCATCTAA TGG Intronic
905073165 1:35245745-35245767 CATTTTGTCTATTCATCCACTGG + Intergenic
906981698 1:50638136-50638158 ATTTTTGTATATTGATCTCATGG + Intronic
907812756 1:57888347-57888369 GATTCTGTATATCCATCTGATGG - Intronic
908010675 1:59774006-59774028 GATGTGGTATATTCATTAAATGG + Intergenic
908217491 1:61969111-61969133 GTTTTTTTCTATTCATCTGATGG + Intronic
908603709 1:65770010-65770032 AATGTTGTATATTCATATGACGG + Intergenic
908769022 1:67579431-67579453 AATATTGTATATTCATCCAATGG - Intergenic
908990711 1:70085231-70085253 CCTTTTGTATTTTCATCAAAGGG + Intronic
909147020 1:71947889-71947911 TATTTGGTATATTTTTCTAATGG + Intronic
909689189 1:78387502-78387524 GATTTTACAAATTCTTCTAATGG - Intronic
910661372 1:89677253-89677275 GATATTGTATGTTCAATTAATGG - Intronic
911241558 1:95472953-95472975 GAAGTTTTATATTCATTTAATGG - Intergenic
911818611 1:102386940-102386962 GATTTTTCATATTTATATAAAGG + Intergenic
912705778 1:111910894-111910916 AATTTTGCATATTTATTTAATGG - Intronic
913033757 1:114939426-114939448 AATTTGGTATATTCATATAATGG + Intronic
913107882 1:115631438-115631460 GTTTTTATATATGCATATAAAGG - Intergenic
915671538 1:157492920-157492942 AATATTGTATATCCATATAATGG - Intergenic
916555894 1:165894056-165894078 GATTTTGGATTTTCATGTTAGGG + Intronic
916688040 1:167165459-167165481 AATATGGTATATTCATGTAATGG - Intergenic
916840283 1:168593538-168593560 AATGTGGTATATTCATGTAATGG - Intergenic
917862193 1:179157189-179157211 GATTTTGGATATTCAAATTAGGG + Intronic
918507034 1:185266994-185267016 GATTTTGTAAAATAATTTAAAGG + Intronic
918532101 1:185534764-185534786 AATGTGGTATATTCATTTAATGG - Intergenic
918790344 1:188817403-188817425 GATTTTGAATATTCATATCGAGG + Intergenic
918954162 1:191183361-191183383 GAGTTTAAATACTCATCTAAGGG + Intergenic
919121572 1:193347531-193347553 GAGTTTGTATTTTATTCTAATGG - Intergenic
919603964 1:199657292-199657314 AATATGGTATATTCATGTAATGG - Intergenic
919956756 1:202425000-202425022 GATTTTGGATACTCATCCTATGG + Intronic
920291588 1:204927442-204927464 CATTTTGCTTATTCATCTGATGG + Intronic
921750587 1:218788540-218788562 GATTTTATATGTTTATGTAAAGG - Intergenic
922646205 1:227289223-227289245 GAGTTTATATTTTCCTCTAAGGG - Intronic
922772748 1:228196568-228196590 GATATGGTATATTCATGCAATGG - Intergenic
923138650 1:231141321-231141343 TATTTTCTTTATTCATCTGATGG - Intergenic
923294052 1:232575780-232575802 TGTTTTCTGTATTCATCTAATGG - Intergenic
923428943 1:233901846-233901868 GATTTTGTATAGTACTGTAATGG - Intergenic
923829325 1:237537623-237537645 GTTTTTATAGATTCATCTAATGG + Intronic
924364468 1:243276453-243276475 GATTTTGTTTATTTAGTTAATGG + Intronic
924854851 1:247866001-247866023 GGCTTTATAAATTCATCTAATGG - Intronic
1063358152 10:5421936-5421958 AATGTAGTATATTCATATAATGG - Intronic
1063567873 10:7187909-7187931 GACTTTTAATATTCATCTATGGG - Intronic
1064681540 10:17815404-17815426 GGTTTTGTTTATTTATCTTAAGG + Intronic
1065651420 10:27896327-27896349 GATTTTTTAAATTCATATCAAGG + Intronic
1066111911 10:32204990-32205012 GTTTTTGCATATGCAGCTAATGG + Intergenic
1066256306 10:33682339-33682361 AATTTTGTATAGTCATATACTGG - Intergenic
1066804018 10:39224989-39225011 GTTTTTGTAGAATCATCAAAGGG + Intergenic
1066807179 10:39269988-39270010 GTTTTTGTAGACTCATCAAAAGG - Intergenic
1066812565 10:39359357-39359379 GTTTTTGTATAGTCTCCTAAGGG - Intergenic
1066929677 10:41741481-41741503 GGTTTTGTAGAATCTTCTAAGGG + Intergenic
1067538302 10:47133398-47133420 GATATAGTATATTTATCTGAGGG + Intergenic
1068024160 10:51622123-51622145 GATTTTCTATATTTTTATAAGGG - Intronic
1068489377 10:57702991-57703013 GATATTATATGTTCTTCTAAGGG - Intergenic
1068585520 10:58793818-58793840 GATTTTGGATTTTCATATTAGGG + Intronic
1069783547 10:70973440-70973462 CATTCTATATATTCATATAATGG + Intergenic
1070436720 10:76401055-76401077 GATTTTGGATTTTCAGCTTAGGG + Intronic
1071686685 10:87765449-87765471 GATTTTGAATATAAATTTAAAGG - Intronic
1072294628 10:93997145-93997167 GATTTTGGAAATACAGCTAAAGG - Intronic
1073044196 10:100626769-100626791 AATGTTGTATATCCATATAATGG + Intergenic
1073222280 10:101885394-101885416 CATTTTGTTTATTCATCCATTGG - Intronic
1073380009 10:103071020-103071042 GATTTTGTATATTCATTGAGAGG + Intronic
1074398818 10:113124292-113124314 AATTTAGAATGTTCATCTAAGGG + Intronic
1074540146 10:114358421-114358443 GAGTCTGTTTCTTCATCTAAGGG - Intronic
1074929841 10:118113095-118113117 GTTTTTGAATATTCATCTCTGGG - Intergenic
1075856462 10:125634105-125634127 ACCTTTGTATATTCATTTAAGGG + Intronic
1078142981 11:8705033-8705055 GATTTTGGATTCTCATCTGATGG - Intronic
1078765160 11:14289533-14289555 CATTTTGTTTATTCTGCTAAAGG - Intronic
1080959067 11:37136611-37136633 GATTTTCTATATTCCTTTAAGGG - Intergenic
1081287615 11:41290451-41290473 GATTTTGTATATTTCTAGAATGG - Intronic
1082291572 11:50380383-50380405 GTTTTTGTACAATCATCAAAAGG + Intergenic
1082298977 11:50481793-50481815 GTTTTTGTATATTCTGCAAAGGG - Intergenic
1082302358 11:50523802-50523824 GTTTTTGTCTATTCTGCTAATGG + Intergenic
1082303777 11:50545621-50545643 GTTTTTGTATAATCTGCTAAAGG - Intergenic
1082312266 11:50666066-50666088 GTTTTTGTACATTCAGCGAATGG - Intergenic
1082596909 11:55093402-55093424 GTTTTTGTATAATCAGCAAAGGG - Intergenic
1084138354 11:67204885-67204907 CATTTTGTTTATTCATATCATGG + Intronic
1084152155 11:67293006-67293028 GATATGGTATATTCATACAATGG - Intronic
1084997906 11:73000576-73000598 CATTTTGTATAATAATTTAAAGG - Intronic
1085005869 11:73089564-73089586 GATGTGGTATATTTATATAATGG + Intronic
1085869956 11:80337944-80337966 GATTTTGTAAATACCTGTAAAGG - Intergenic
1086076004 11:82853277-82853299 GATTTTGTAAACTCTTCTTAGGG - Exonic
1086313505 11:85563681-85563703 GTTTTGGTATATCCATATAAAGG - Intronic
1087309432 11:96522573-96522595 GATTTTGTATTTTAAATTAATGG - Intergenic
1087378520 11:97374810-97374832 AATGTTGTATATTCATACAAGGG + Intergenic
1087488477 11:98790616-98790638 GATTGTGGCCATTCATCTAATGG - Intergenic
1087538736 11:99487525-99487547 GATTTTGTAAATTCTTCTACAGG - Intronic
1087658780 11:100960652-100960674 GCTTTTTTATATTCAAATAATGG + Intronic
1087769863 11:102196347-102196369 AATGTGGTATATTCATATAATGG + Intronic
1089475418 11:118756594-118756616 GATATTGTATCTTTTTCTAAAGG + Intronic
1089577650 11:119457951-119457973 GATGTAGTATATACATATAATGG + Intergenic
1090001685 11:122966182-122966204 GTTCTTTGATATTCATCTAAAGG - Intergenic
1092627389 12:10341573-10341595 ATTGTTGTATATTCATATAATGG - Intergenic
1092874852 12:12838968-12838990 GATTTCTTAAATTCATCCAAGGG + Intergenic
1093275608 12:17121361-17121383 AATTTTGTGTATTTATTTAATGG - Intergenic
1093524942 12:20094778-20094800 GATTTTTTAAATTCATGAAATGG + Intergenic
1094859917 12:34452293-34452315 GTTTTTGTATATTCTGCGAATGG - Intergenic
1094866838 12:34543868-34543890 GTTTTTGTATATTCTGCTTAGGG - Intergenic
1095058405 12:37648506-37648528 GATTTTATGCATTCATCTCACGG + Intergenic
1095058679 12:37653593-37653615 GATTTTGTGCATTCATCTCACGG + Intergenic
1095078883 12:37971900-37971922 GATTTTGTCCATTCTGCTAATGG + Intergenic
1095536139 12:43250182-43250204 GGTTTTGTCTATTCATTCAATGG + Intergenic
1095676433 12:44924358-44924380 CATTTTTTATATATATCTAAAGG - Intergenic
1098836799 12:75433536-75433558 GATTTTATATATATATATAATGG + Intergenic
1099306808 12:80967243-80967265 GATTTTGCATTTACAACTAATGG - Intronic
1099457153 12:82877829-82877851 GATTTTGTTTTTTCTTCTACTGG - Intronic
1099598885 12:84705633-84705655 GATTTTGTATCTACATTTTAAGG + Intergenic
1100183692 12:92113257-92113279 GAGTTTTTCTAATCATCTAAAGG + Intronic
1100476206 12:94937905-94937927 GATTTTGTTTATTCATTCATTGG - Intronic
1100545651 12:95599554-95599576 GATAGTGAATATTCATCTACAGG + Intergenic
1100670828 12:96810774-96810796 GTTTTTGTCTATTCTTCTGAGGG - Intronic
1100709279 12:97237402-97237424 GATTTTTTAAATGCATATAATGG + Intergenic
1100985236 12:100197385-100197407 TATGTAGTATATTCATATAATGG - Intergenic
1103597717 12:122034053-122034075 GGTTTTGTTTATCCTTCTAAAGG + Intronic
1103636411 12:122310223-122310245 GTTTTAGTAAAATCATCTAATGG - Intronic
1104517170 12:129438398-129438420 TGTGTTGTATATTCATATAATGG + Intronic
1105519026 13:21114947-21114969 TATTTTGTATATACATGTATAGG - Intergenic
1106104256 13:26719892-26719914 CATTTTTCATATTCATCTAGTGG - Intergenic
1107200028 13:37703990-37704012 AATATGGTATATTCATATAATGG + Intronic
1108889170 13:55231388-55231410 AAGATTGTATATTCATCTAAGGG - Intergenic
1109410246 13:61955565-61955587 GATGTTGTTTCTGCATCTAATGG + Intergenic
1109880496 13:68467578-68467600 GATTTTGTTTATTCTTTCAAAGG + Intergenic
1111413192 13:87903897-87903919 TATTTTGTACTTTCATGTAAGGG + Intergenic
1111736955 13:92153787-92153809 GATTTTTCATATTCATCTAAAGG + Intronic
1111970985 13:94916469-94916491 CAATTTGTTTATTCATCTATCGG - Intergenic
1112844338 13:103619569-103619591 CATTATTTATATTGATCTAATGG + Intergenic
1113181501 13:107633154-107633176 GCTTTTATATTTTCATATAAAGG + Intronic
1114444113 14:22774924-22774946 GATTTTGGATATTCAGATTAGGG + Intronic
1114583188 14:23784367-23784389 AAGTTTCTAGATTCATCTAAGGG - Intergenic
1114827512 14:26099224-26099246 GACTTTGTTTATTTATCTCATGG + Intergenic
1114969428 14:28006571-28006593 AATTTTGTATAATCACCTTAGGG + Intergenic
1115316579 14:32031202-32031224 GATTTTTTATATTCTTCAAAGGG - Intergenic
1115322694 14:32101377-32101399 GATTTACTATATTAATATAATGG - Intronic
1117135044 14:52726950-52726972 GATGTTAAATATTCATATAATGG + Intronic
1118481221 14:66168039-66168061 GATATGGTATATTCATACAATGG - Intergenic
1119059066 14:71456009-71456031 GATTTTGTTTTTACAGCTAAAGG + Intronic
1122777339 14:104126571-104126593 CATTTTGTTTATTCATCTACTGG + Intergenic
1123777617 15:23596551-23596573 GAGTTTGTATTCTTATCTAATGG - Intronic
1124826479 15:33101293-33101315 GATTTGGTAAATTCAGTTAATGG + Intronic
1126300737 15:47193277-47193299 TATTTTGTATTTTCATATTAGGG - Intronic
1126321371 15:47427921-47427943 GAAATTGTATATTCTTCTTAGGG + Intronic
1126412027 15:48382070-48382092 GGTTTTGTTTTTTCCTCTAACGG + Intergenic
1128361181 15:66962829-66962851 GATATTGCATGTTCACCTAATGG + Intergenic
1128663451 15:69520788-69520810 TATTTTGTTTACTCATCCAATGG - Intergenic
1130437503 15:83915855-83915877 AATGTTGTATATCCATATAATGG - Intronic
1130628982 15:85546406-85546428 AATGTGGTATATTCATATAACGG + Intronic
1130976704 15:88782132-88782154 TCTTTTGTATATTCATCCACTGG - Intergenic
1132005580 15:98223538-98223560 TATTTTATAGATTCATCTCAAGG + Intergenic
1133670644 16:8016040-8016062 GATCTTGTATATTGTTCTACTGG - Intergenic
1134437293 16:14272476-14272498 AATGTGGTATATTCATATAATGG + Intergenic
1134867165 16:17618729-17618751 TATTTTGTAGATTCCTTTAAAGG + Intergenic
1135754793 16:25088095-25088117 GATTTTGTAAATACTTGTAACGG - Intergenic
1136741624 16:32535988-32536010 GTTTTTGTATATTCTTGAAATGG - Intergenic
1137862739 16:51863093-51863115 AATGTGGTATATTCATATAATGG - Intergenic
1138033860 16:53582791-53582813 GTTGTGGTATATTCATATAATGG + Intergenic
1138755373 16:59477970-59477992 TACTTTGTATAATAATCTAATGG - Intergenic
1138840791 16:60502562-60502584 TATTTTTTATATTTATGTAATGG - Intergenic
1139262900 16:65612190-65612212 TATTATGTATCTTCATCTCAAGG + Intergenic
1140654620 16:77126744-77126766 TATTTTGGACATTGATCTAAGGG + Intergenic
1141348893 16:83274661-83274683 GATTTTATAAATTCATTTAAAGG + Intronic
1203027978 16_KI270728v1_random:539246-539268 GTTTTTGTATATTCTTGAAATGG + Intergenic
1203043743 16_KI270728v1_random:795185-795207 GTTTTTGTATATTCTTGAAATGG - Intergenic
1144212431 17:13026753-13026775 GAGTTTGTATATCATTCTAAGGG + Intergenic
1145356211 17:22155871-22155893 GATTTTTTACATTATTCTAAAGG - Intergenic
1145357469 17:22173684-22173706 ATTTTTGTATATTTATCCAATGG - Intergenic
1149436516 17:56638251-56638273 CATTTTGTTTATTTATTTAATGG - Intergenic
1150310466 17:64124749-64124771 AATGTGGTATATTCATATAATGG + Intronic
1151075048 17:71261888-71261910 CATTTTGTATATTTATCTCTGGG - Intergenic
1151523003 17:74644325-74644347 AATTTTTTAAATTCAGCTAATGG + Intergenic
1155056774 18:22191377-22191399 AATTTTGTATATTCTTATAGAGG - Intronic
1155592608 18:27445133-27445155 GATTTTGTGTATTGATATATTGG + Intergenic
1155632823 18:27914320-27914342 TATTTTGTATATTCTTTGAAAGG - Intergenic
1155710819 18:28876995-28877017 AATTTTGTATTTACTTCTAATGG + Intergenic
1155947448 18:31871754-31871776 GGTTTTGTATATTCACATAATGG - Intronic
1156241774 18:35261856-35261878 GGTTTTGAAAATTCATCTCAAGG - Intronic
1156933340 18:42672137-42672159 GTTTTTCTGTATTCATCTATAGG - Intergenic
1157965636 18:52205232-52205254 GAGCTTGTAAATTCATATAAGGG + Intergenic
1159069660 18:63609269-63609291 TATTTTGTTTATTCATCGATGGG + Intergenic
1159373070 18:67554331-67554353 AATTTTGTATATTCATATAATGG - Intergenic
1159729504 18:72007787-72007809 GATTTTGTGTTTTCATCTTGAGG + Intergenic
1160212195 18:76890608-76890630 GATTTTTTTTACTCATCCAATGG + Intronic
1161671314 19:5612432-5612454 GATCTTGTAAATTGCTCTAATGG - Intronic
1163225381 19:15956977-15956999 GACTTTGTATATTCATTTTCTGG + Intergenic
1163445939 19:17346565-17346587 GAGTTTGTATATTCAACCACTGG - Intergenic
1164365405 19:27575877-27575899 GTTTTTGTATATTCTGCGAAGGG + Intergenic
1164952348 19:32347248-32347270 GATTTTGAAGATTGATCCAAGGG + Intronic
1165929659 19:39348602-39348624 GAGTTTCTATTTTCATTTAAGGG + Intronic
1166350148 19:42193890-42193912 CATTGTGTATATTCATACAATGG + Intronic
925986647 2:9221629-9221651 CTTTTTGTATATTGATCTTATGG + Intronic
926854373 2:17237346-17237368 GATTTTATATATACATATATTGG + Intergenic
927802623 2:26115372-26115394 AAATGTGTATATTCATATAAGGG + Intronic
928287637 2:30007370-30007392 GAGTTTGTTTCTTCATCTAAAGG - Intergenic
928501472 2:31901039-31901061 AATGTGGTATATTCATATAATGG + Intronic
928526062 2:32142242-32142264 AATGTGGTATATTCATTTAATGG + Intronic
928598822 2:32883902-32883924 GATTTTGTTTCTTCTTTTAAGGG - Intergenic
929061783 2:37931975-37931997 GCTTTTGTTTATTTTTCTAAAGG - Intronic
929343919 2:40857377-40857399 TATTTTGTATATTCATTCATTGG - Intergenic
929845851 2:45526233-45526255 AATGTTGTATATCCATATAATGG + Intronic
930152497 2:48072967-48072989 GTTTCTGTATATTCATCTTCTGG + Intergenic
930224684 2:48780170-48780192 TATGTAGTATATTCATGTAATGG + Intergenic
930500364 2:52208872-52208894 TATTTTCTATATTCCTTTAATGG - Intergenic
930922380 2:56772232-56772254 GATTTTGTTTATTTTTCTACTGG - Intergenic
932052786 2:68415946-68415968 AATTATGTATATTCATACAATGG + Intergenic
933211473 2:79574717-79574739 CATTTTGGATATACACCTAAAGG - Intronic
933418207 2:82014321-82014343 AATATTGTATATTCAAATAATGG - Intergenic
933878498 2:86644478-86644500 AATTTGGTATATTCATACAATGG - Intronic
934898219 2:98137008-98137030 GATGTGGTATATCCATATAATGG - Intronic
937553047 2:123118658-123118680 GCTTTTTTATATACATCTAATGG + Intergenic
937605374 2:123794201-123794223 GATGTGGTATATTCATATAGTGG - Intergenic
938219713 2:129555063-129555085 AATTTGGTATATTCATACAATGG - Intergenic
939181333 2:138805879-138805901 GATTTTTGATATTCATGAAAAGG - Intergenic
939395214 2:141620266-141620288 TACTTTGTATATTCATAAAAGGG + Intronic
939438683 2:142212834-142212856 GATGTTGTCACTTCATCTAATGG - Intergenic
939730522 2:145778922-145778944 GATTTTGCATATATATCTGATGG - Intergenic
939974610 2:148703081-148703103 GATTTTATTTGTTCATCTTAAGG + Intronic
940061789 2:149579301-149579323 GTTTTTGTATATACATGTACTGG + Intronic
940270374 2:151883704-151883726 TCTTTTGCATATACATCTAAAGG + Intronic
941089144 2:161154398-161154420 GATTTTGGATTTTATTCTAAAGG + Intronic
941716755 2:168772155-168772177 TATTTTGTAAATTCAACTATAGG + Exonic
941733165 2:168942097-168942119 GTTTTTGTATACTTATCTTAAGG - Intronic
942091880 2:172500115-172500137 GATTTTGTATATCCATGTAGAGG + Intronic
942361553 2:175177942-175177964 GCTTTTGTTTATTCATATAAAGG - Exonic
943210673 2:184961767-184961789 GGTTTTGTAAATTCCTCTCATGG + Intergenic
943869840 2:192980021-192980043 GATTTTGTATGTATATATAAAGG + Intergenic
944492474 2:200271900-200271922 TATTTTTTAAATTCATCTAGTGG - Intergenic
944762176 2:202827554-202827576 GATTCCAAATATTCATCTAATGG + Intronic
945695695 2:213101061-213101083 GATTTTGTTTAGTCAACAAAGGG - Intronic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
945927266 2:215818568-215818590 GCTTTTCCATTTTCATCTAAGGG - Intergenic
946723471 2:222636831-222636853 GATATTCTATATGCATCAAAAGG + Intronic
947040415 2:225912051-225912073 CATTTTGGAGATTCAGCTAAGGG + Intergenic
947150777 2:227112922-227112944 AATGTGGTATATTCATCCAAAGG - Intronic
1170337412 20:15285195-15285217 GATATTTTATATTTCTCTAAAGG + Intronic
1171080940 20:22183785-22183807 GACTTTGTATATTGATAAAAGGG - Intergenic
1171232759 20:23500603-23500625 GATTTTACAAATGCATCTAATGG - Intergenic
1172585634 20:36082056-36082078 TATTTTGTATATTTACCTATTGG + Intergenic
1173130667 20:40390198-40390220 AATGTGGTATATTCATATAATGG + Intergenic
1173329181 20:42060117-42060139 GATGGAGTACATTCATCTAAAGG + Intergenic
1173722863 20:45274798-45274820 GATTGTGGATATTCATATAATGG - Intergenic
1174884166 20:54313542-54313564 GATTTTGTATCTTCTTCTCTGGG + Intergenic
1175506205 20:59486275-59486297 AAATTTGTATATTCATAAAATGG - Intergenic
1177342865 21:19827282-19827304 TATTGAGTATATTCATCAAAAGG + Intergenic
1177724412 21:24948642-24948664 GATTTTGTATCTACTTCCAAGGG - Intergenic
1178249183 21:30985655-30985677 TCTTTTGGATATTCATCTGAAGG - Intergenic
1178991001 21:37356507-37356529 AATTTTGTATAATCAACTACTGG - Intergenic
1181612160 22:24023274-24023296 CATTTTGTTTATCCATCTATTGG + Intronic
1184935930 22:47720532-47720554 CATTTTGTTTATCCATCCAATGG + Intergenic
950322939 3:12074248-12074270 GATTTTGAAAATTCATTTATAGG - Intronic
951673697 3:25213426-25213448 GATGTGGTATATTCATACAATGG - Intronic
952528769 3:34241774-34241796 GATGTTATATATTCATCCAAGGG + Intergenic
953485833 3:43294553-43294575 GATTTCGTATTTTCACCTTAGGG + Intronic
953941518 3:47102934-47102956 TATTTTGTATATTATTTTAATGG - Intronic
955587619 3:60498455-60498477 CATATTGTATCTTCAACTAAGGG + Intronic
956027553 3:64999627-64999649 AATGTGGTATATTCATCCAATGG + Intergenic
956737198 3:72246990-72247012 GAGTCTGTATATTCATCCAAAGG - Intergenic
957659738 3:83132707-83132729 TATTTAGTATTTTCATATAATGG - Intergenic
957670887 3:83301447-83301469 TTTTTTGTAGAGTCATCTAAAGG - Intergenic
957853379 3:85841222-85841244 GTTTTTAAATATTCACCTAAAGG - Intronic
958473931 3:94556457-94556479 TATTTTTGATATTCATATAATGG + Intergenic
958766571 3:98375858-98375880 GAGTTTGTATTTTCATGTGAAGG + Intergenic
959160137 3:102713468-102713490 CATTTTTTAAATTCATGTAAAGG + Intergenic
959234598 3:103703459-103703481 TATTTTCTTTATTCATATAAAGG - Intergenic
959688937 3:109177613-109177635 AATTTTATATTTTAATCTAAAGG + Intergenic
960996082 3:123341257-123341279 AATGTGGTATATTCATATAATGG + Intronic
961015226 3:123463060-123463082 GTTGTGGTATATTCATGTAATGG + Intergenic
963539741 3:146569976-146569998 GTTTTTGTACATTCATCTCATGG + Intergenic
964191685 3:154010061-154010083 GTTACTGTATATTCATATAAAGG + Intergenic
964427184 3:156566313-156566335 CTTGTGGTATATTCATCTAAAGG - Intergenic
964616879 3:158675556-158675578 AATTTTATATATTGATCAAATGG + Intronic
965042139 3:163522391-163522413 GATTAAGTATTTTGATCTAAAGG - Intergenic
965594729 3:170399537-170399559 GATTTTTAATAATGATCTAATGG - Intergenic
965706591 3:171514577-171514599 AATGTGGTATATTCATATAATGG + Intergenic
965769285 3:172164368-172164390 GATGTTGTAAATTCCTCTTAGGG - Intronic
965829681 3:172771235-172771257 CATTTTGTATGACCATCTAAGGG - Intronic
969334277 4:6498234-6498256 GATTTTGGATTTTTATATAATGG - Intronic
971636056 4:29059496-29059518 CTGTTTCTATATTCATCTAAAGG + Intergenic
971954554 4:33399732-33399754 GATATTCTATATTCATGGAATGG + Intergenic
972247589 4:37261697-37261719 GATTTTGTATATTTACATTATGG - Intronic
973057839 4:45682304-45682326 GATTTTCTATCTTCATCTTTAGG + Intergenic
973103839 4:46305696-46305718 GAAGTTGTATATGCATCTATAGG + Exonic
974160605 4:58133287-58133309 GATTTTGTGAATTAATCTATGGG + Intergenic
975208686 4:71673854-71673876 AATGTGGTATATTCATGTAATGG + Intergenic
975641455 4:76504487-76504509 GATTTTTTATGTTTATCAAAAGG - Intronic
976564341 4:86536575-86536597 GATTATGTATCTACAACTAAAGG - Intronic
976911127 4:90307440-90307462 GATTTAGTTTCTTCTTCTAATGG + Intronic
977083136 4:92559150-92559172 GTTTATGTATATTTATCAAATGG - Intronic
977215500 4:94278787-94278809 CATTTTGTTTAGTCATATAATGG + Intronic
978891768 4:113837401-113837423 TCTTTTGTATGTTCATATAATGG - Intergenic
979646156 4:123071840-123071862 GATTTTGGACATTTATCAAATGG + Intronic
980308258 4:131093282-131093304 GATTTTATCTATTCATTTATAGG + Intergenic
981173032 4:141646759-141646781 GATTTAATATTTTCATATAAGGG + Intronic
981272859 4:142865059-142865081 GATGGTGGATATTTATCTAATGG - Intergenic
982231594 4:153212918-153212940 CATTTTGTCTATTCATACAAAGG + Intronic
982604301 4:157494931-157494953 ATTTTTTTTTATTCATCTAATGG - Intergenic
982804415 4:159746515-159746537 AATGTTGTATGTTCATATAATGG - Intergenic
982928360 4:161368521-161368543 TAATTTGTATTTTCATCTTAGGG + Intergenic
983726716 4:170938104-170938126 AATTTTGGATATACATCTATAGG - Intergenic
983907849 4:173203651-173203673 GATGTTGTATATAAACCTAACGG - Intronic
984090158 4:175363736-175363758 GATTTAGCAAATCCATCTAAGGG + Intergenic
984687216 4:182683427-182683449 GATTTTGTATTTTCAGATTAGGG + Intronic
986281505 5:6326830-6326852 GACTTTGTATTTTAATCAAATGG - Intergenic
986497657 5:8362225-8362247 GATTTTGGATATGTAGCTAAAGG - Intergenic
986554124 5:8993677-8993699 GTTGTGGTATATTCATCTAATGG - Intergenic
987048978 5:14133684-14133706 AATTTTGTATATTCATATAATGG - Intergenic
988350020 5:30090966-30090988 GAATTTATATAATCATCTAGAGG - Intergenic
988602804 5:32655310-32655332 GATTTTGAATATTCTTCTTTAGG - Intergenic
989648252 5:43660065-43660087 AATTTTGTATATCCATATGATGG - Intronic
989835414 5:45982485-45982507 GTTTTTGTAAATTCTTCGAAGGG + Intergenic
989835673 5:45986750-45986772 GTTTTTGTAGAATCATCAAAGGG + Intergenic
989853917 5:46254392-46254414 GTTTTTGTAGATTCTTCAAAGGG - Intergenic
990771803 5:59255191-59255213 AATGTGGTATATTCATATAATGG + Intronic
990915412 5:60897817-60897839 GATTTTGAATATTCAGATTAGGG - Intronic
991244506 5:64495686-64495708 TATGTTGTATATTCATACAATGG - Intergenic
991293111 5:65051955-65051977 AATTTGGTATATTTATATAATGG - Intergenic
992528608 5:77635285-77635307 GAAATTGTATATTTATGTAAAGG + Intronic
992573004 5:78079532-78079554 GATTTAGTATATAATTCTAAAGG + Intronic
993527634 5:88985919-88985941 GATTTTGCATATTCAAGCAACGG - Intergenic
993669695 5:90745565-90745587 TATTTTGTATATGCTTCTTATGG + Intronic
993748165 5:91628339-91628361 GATTCAGTATATTCAGCAAAGGG + Intergenic
993930208 5:93929096-93929118 GATTCTGGATATGTATCTAATGG - Intronic
994125135 5:96160470-96160492 AATGTTGTATATTCATACAATGG - Intergenic
994637456 5:102361258-102361280 GTGTTTGTATATTCATGCAATGG + Intergenic
994987073 5:106948991-106949013 TATTTTATATACTAATCTAATGG + Intergenic
995948240 5:117677107-117677129 GTTGTTGTATATTAGTCTAAGGG + Intergenic
996311058 5:122105922-122105944 GATTTTGGATTTTCAAATAAGGG + Intergenic
997365985 5:133325447-133325469 CATTTTGGATATTCTTCAAAGGG - Intronic
997816784 5:137026984-137027006 GATTTTATTCATTCATTTAAAGG - Intronic
997954797 5:138270840-138270862 GATTTTATATATTTACCAAAAGG + Intronic
999158529 5:149475876-149475898 GCTTTTGTATCTGGATCTAATGG - Intergenic
999545110 5:152620112-152620134 GTTGTGGTATATTCATATAATGG + Intergenic
999676459 5:154008415-154008437 AATTTTGGATTTTCATATAAGGG - Intronic
1000112137 5:158119018-158119040 CATTTTGTATATTTATCAAGTGG + Intergenic
1000378938 5:160611570-160611592 GATTTTTCCAATTCATCTAAAGG + Intronic
1000473949 5:161681451-161681473 AATTTTGTAAATTTATCTCATGG - Intronic
1000964943 5:167645191-167645213 GACTTAGTCTATTAATCTAAAGG + Intronic
1002361992 5:178679550-178679572 GATTTCTTATAGACATCTAATGG + Intergenic
1002802453 6:537948-537970 GGTTTTGTATTTTCATCTGGTGG + Intronic
1003607078 6:7572118-7572140 GATTTTTTTTATTCATTTACAGG - Intronic
1004129170 6:12902521-12902543 GATGTTGTATGTTCATCCAATGG - Intronic
1006996601 6:38267020-38267042 GATTGTATATATTCATCAAGAGG - Intronic
1007451539 6:41943473-41943495 CATTTTGTACATTCACCTAATGG - Intronic
1007797140 6:44358490-44358512 GATTTTTTATTTGCATTTAATGG + Intronic
1008637070 6:53421170-53421192 GATATGGTATATTCATACAAGGG - Intergenic
1010787360 6:80020124-80020146 GAGTTTGTATTGTCATCTTATGG - Intronic
1011096400 6:83669854-83669876 ATTTTTGTATGTTCATCTAATGG - Intronic
1011225901 6:85106657-85106679 TATTTTGTATATTCATTGCATGG + Intergenic
1011547449 6:88496912-88496934 TATTTTGTATTTCCATATAATGG + Intergenic
1012139721 6:95610131-95610153 GTTGTTGTATATTCACATAAAGG + Intergenic
1013008053 6:106092895-106092917 GATTTTGTATCTTTATCTATAGG + Intronic
1014335621 6:120131796-120131818 GATTTTATTTATTTGTCTAAGGG - Intergenic
1014367800 6:120565799-120565821 AATGTTGTATATTCATTCAATGG - Intergenic
1014488339 6:122029550-122029572 GATTTTTTATACTCATTGAAAGG + Intergenic
1014976879 6:127897908-127897930 ATTGTAGTATATTCATCTAATGG + Intronic
1015246347 6:131079042-131079064 TATTGTGTATATTCTTCTATTGG - Intergenic
1015524155 6:134159671-134159693 GAGTTTTTATATACATCTCAAGG - Intergenic
1015537198 6:134278257-134278279 GCGTTTGTTTATTTATCTAATGG - Intronic
1016194058 6:141310025-141310047 TATTTTGTATAATAATATAATGG + Intergenic
1018467938 6:164068997-164069019 TATTTTCTATATTCCTCAAAAGG - Intergenic
1020445721 7:8265260-8265282 AATGTAGTATATTCATGTAATGG + Intergenic
1020553491 7:9638858-9638880 AATGTGGTATATACATCTAATGG + Intergenic
1020565544 7:9789942-9789964 GATAATGTATATTCATTAAATGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020862359 7:13510525-13510547 GATTTTGTAGTTTCATCAATTGG - Intergenic
1021057133 7:16062921-16062943 GATTTTATACCTTTATCTAAAGG - Intergenic
1023128356 7:36977283-36977305 CATTTTGCATATTCCTTTAATGG - Intronic
1023247773 7:38224163-38224185 TATGTTGTATATCCATATAATGG - Intronic
1024216279 7:47251720-47251742 TATATGGTATATTCATCCAATGG + Intergenic
1025225501 7:57157240-57157262 TAATTTATATATTCATCTATTGG - Intergenic
1025531469 7:61890578-61890600 GTTTTTGTATATTCTTGAAATGG - Intergenic
1025579913 7:62699482-62699504 GATTTTGTATAATCTGCTAAGGG - Intergenic
1027683974 7:81257878-81257900 GATTTTGTATATTCTTTAATTGG + Intergenic
1028458710 7:91067209-91067231 AATTATGTTTTTTCATCTAATGG + Intronic
1028707515 7:93867355-93867377 GATTTTGTATTTTTTTCTACTGG + Intronic
1029336600 7:99905490-99905512 GCTTTGGTATATTAATATAATGG + Intronic
1030329186 7:108255037-108255059 AATGTGGTATATTCATATAATGG + Intronic
1032104462 7:129014782-129014804 GTTTCTGTATAATCCTCTAAAGG - Intronic
1032176194 7:129628870-129628892 GATTTTGTAACATCATCTATTGG + Intronic
1032210843 7:129912681-129912703 GATTTTGGATTTTCAGATAAGGG + Intronic
1033858286 7:145593024-145593046 TATTCTGAATATACATCTAAAGG - Intergenic
1033970752 7:147035706-147035728 GACTCTGTATCTTCATGTAAAGG - Intronic
1034020608 7:147637769-147637791 GATTGTGTATTTTCATCCAAAGG + Intronic
1034819937 7:154207352-154207374 GATTTTATATATTTATCAATTGG + Intronic
1035193481 7:157193966-157193988 GTTTTTGTATGTGCATCTATAGG + Intronic
1037416289 8:18653731-18653753 GATTTTATTTATTCATTTATAGG - Intronic
1037488928 8:19378131-19378153 GATTTTTTATATTGACCTATAGG + Intronic
1040116770 8:43630612-43630634 CTTTTTGTATAATCATCAAAGGG + Intergenic
1040347578 8:46522392-46522414 GTTTTTGTAGATTCAGCAAAAGG + Intergenic
1041411232 8:57558241-57558263 GTTTTTGTATGTGCATCTATAGG - Intergenic
1041492592 8:58451183-58451205 GTTTTTGTATGTGCATCTATAGG - Exonic
1041527111 8:58818922-58818944 GAATTTGTATGTTTATGTAATGG + Intronic
1043044122 8:75299721-75299743 GATTTTGAATATTTACCTGAAGG - Intergenic
1043548868 8:81345855-81345877 AATGTGGTATATTCATATAATGG - Intergenic
1043686802 8:83096598-83096620 GTTTATGGATATTCATCTATAGG + Intergenic
1043964413 8:86456729-86456751 ATTGTTGTATATTCATATAATGG + Intronic
1044055277 8:87561865-87561887 GCTTTGGTATATTCATAAAATGG - Intronic
1044415269 8:91931806-91931828 AATTTGGTATATTCATACAATGG + Intergenic
1045685866 8:104711586-104711608 TATTGTGTATATTCATATAATGG + Intronic
1045834931 8:106508649-106508671 GATGTTTTATATTCATCAATAGG + Intronic
1045918017 8:107496731-107496753 GAAATTGTATATTTATGTAAAGG - Intronic
1046207533 8:111021232-111021254 GATATTGAATATTCTTTTAAGGG - Intergenic
1046413525 8:113880029-113880051 GTTTTTGTTTCTTCATGTAATGG - Intergenic
1047312338 8:123703117-123703139 TATTTTGTTTATTCATCTTCAGG - Intronic
1047403739 8:124567925-124567947 GCTCTTGGATATTCATCTCATGG + Intronic
1047476901 8:125241184-125241206 GATTTTGTATTTTCAGATTAAGG + Intronic
1051065553 9:13098161-13098183 GAAATTGTATATACCTCTAATGG - Intergenic
1051522563 9:18005785-18005807 GATTTAGTAAACTCACCTAAAGG - Intergenic
1051550645 9:18325230-18325252 ACTTTTGTATATTTACCTAAGGG + Intergenic
1051957058 9:22708732-22708754 AATATTGTATATGCATATAATGG - Intergenic
1053566046 9:39252685-39252707 GATTGTGTATATTCAGCTGCAGG - Intronic
1053831813 9:42090535-42090557 GATTGTGTATATTCAGCTGCAGG - Intronic
1054131102 9:61366357-61366379 GATTGTGTATATTCAGCTGCAGG + Intergenic
1054598731 9:67096911-67096933 GATTGTGTATATTCAGCTACAGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1057094660 9:92294765-92294787 AATTTTTTATATCCCTCTAACGG - Intergenic
1060449034 9:123719908-123719930 GATTTTGAATTTTCAGATAAGGG + Intronic
1060862937 9:126970432-126970454 GATTTTGACTATTCAAATAATGG + Intronic
1186603829 X:11067729-11067751 CATTTTGTTTATTCATCCATTGG - Intergenic
1186944435 X:14549665-14549687 GATTTTGTTTATTCATGTCAGGG + Intronic
1187078581 X:15961978-15962000 GCTTTTGTTCACTCATCTAAGGG - Intergenic
1188181853 X:27066111-27066133 GTTTTTTTCTATTCACCTAAAGG + Intergenic
1188345085 X:29054108-29054130 GAATTTGAATTTTGATCTAAGGG - Intronic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1188695303 X:33183029-33183051 GATTTTTTATAGTGATGTAATGG + Intronic
1188997257 X:36900794-36900816 GTTATTTTATATTCCTCTAAGGG + Intergenic
1190154803 X:47981465-47981487 GATTTTGTAGCATCATCCAAAGG - Intronic
1190765025 X:53468927-53468949 GATTTTGAATTTTCAGATAAGGG - Intergenic
1190858100 X:54317055-54317077 TATTTTGTTTATTCATCTGTTGG - Intronic
1191268210 X:58425617-58425639 GTTTTTGTTCATTCAACTAATGG - Intergenic
1193553957 X:82931425-82931447 GATTTTTTATACTCAAGTAAAGG + Intergenic
1194609811 X:96028850-96028872 GATTTTGTAAATGCTTTTAATGG - Intergenic
1194897492 X:99462695-99462717 AATCTTGAATATTCATCAAAGGG + Intergenic
1195006878 X:100693818-100693840 AATGTGGTATATTCATATAATGG + Intronic
1195797313 X:108665229-108665251 GTTATGGTATATTCATATAATGG + Intronic
1196065844 X:111463416-111463438 AATGTTGTATATTCATAAAATGG + Intergenic
1196506451 X:116450039-116450061 TATTCTGTATTTTCTTCTAAAGG - Intronic
1197294388 X:124700137-124700159 GGTTTTGTATTTTTATCTGAAGG - Intronic
1197876178 X:131109835-131109857 GATATTCTATATTCATTGAATGG - Intergenic
1197908060 X:131448037-131448059 AATTTGGTATATCCATATAATGG - Intergenic
1198936878 X:141908024-141908046 GAACTTGTATATTCATCTACTGG - Exonic
1199395879 X:147336934-147336956 GATGTGGTATATTCATACAATGG + Intergenic
1199447323 X:147940259-147940281 CATTTTGTTTATACATCTCATGG + Intronic
1199813303 X:151372066-151372088 AATTTGGCATATTCATATAATGG - Intergenic
1199821633 X:151455165-151455187 AATATGGTATATTCATATAAGGG - Intergenic
1201891042 Y:18944218-18944240 GATTCTGAATATTCAGCTTACGG + Intergenic