ID: 945716217

View in Genome Browser
Species Human (GRCh38)
Location 2:213360509-213360531
Sequence GACACACCTGGAGAGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945716217_945716222 14 Left 945716217 2:213360509-213360531 CCTGTCAGCTCTCCAGGTGTGTC 0: 1
1: 0
2: 0
3: 21
4: 143
Right 945716222 2:213360546-213360568 CAAGGTTACCACTTAAAGAATGG 0: 1
1: 0
2: 0
3: 10
4: 137
945716217_945716220 -4 Left 945716217 2:213360509-213360531 CCTGTCAGCTCTCCAGGTGTGTC 0: 1
1: 0
2: 0
3: 21
4: 143
Right 945716220 2:213360528-213360550 TGTCCTTGTGGAACAAGTCAAGG 0: 1
1: 0
2: 0
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945716217 Original CRISPR GACACACCTGGAGAGCTGAC AGG (reversed) Intronic
900978707 1:6034251-6034273 GACACACAGGCAGAGCCGACTGG - Intronic
902079220 1:13809709-13809731 GAGTCACCTGCAGAGATGACAGG + Intronic
904001186 1:27339674-27339696 GACACAGCAGGAGAGATGGCTGG + Intergenic
904064945 1:27742274-27742296 GACACACTAGGACAGGTGACAGG - Intronic
904809104 1:33151699-33151721 AACACACCTGGAGACCAGACGGG - Intronic
909695765 1:78466155-78466177 GACTGACCTGGAGAGCTGTATGG - Intronic
911824778 1:102468238-102468260 AATACACCTGGAGAGCTTCCTGG - Intergenic
913233377 1:116760617-116760639 CACGCACCTGGACAGCTGACAGG - Exonic
913385166 1:118251416-118251438 GACAGATGTGGAGAGCTGAGTGG - Intergenic
917380158 1:174397485-174397507 GACACACCTAAAGAGCTGGAAGG + Intronic
920267192 1:204732891-204732913 GACTCTGCTGGAGAGCTGGCTGG + Intergenic
920436511 1:205950322-205950344 CACAGTCCTGGAGGGCTGACAGG - Intergenic
922496276 1:226060753-226060775 TAAGCACCTGGAGAGGTGACTGG - Intergenic
924477607 1:244395471-244395493 TACACATCTGCAGTGCTGACAGG + Intergenic
1062965781 10:1606708-1606730 GGGGCACTTGGAGAGCTGACAGG + Intronic
1063096786 10:2915593-2915615 GACACACAAGGAGCGCTGCCGGG - Intergenic
1063368339 10:5504944-5504966 GACACACCTGGGAACCTGGCAGG + Intergenic
1070278687 10:75033006-75033028 CAGACACCTGGAGAGCTTAACGG - Intergenic
1071248631 10:83791887-83791909 GACTAACATGGAGAGCTGCCTGG - Intergenic
1071554515 10:86592178-86592200 GACAGAGCTGGAGACCTTACCGG + Intergenic
1072656065 10:97331452-97331474 GACACAGCTGGTGAGCAGAAAGG + Intergenic
1072955887 10:99887669-99887691 TGCCCACCTGGGGAGCTGACAGG - Intronic
1073265759 10:102227546-102227568 CACTCACCTGGAGAGATGAGTGG + Intronic
1076867138 10:133173235-133173257 GACAGGCCAGGAGAGCAGACGGG - Intronic
1077158672 11:1102847-1102869 GACACACCTGGAGGGCCTGCAGG - Intergenic
1079747783 11:24155185-24155207 GAACCACATGGAGAGCTGCCTGG + Intergenic
1080387655 11:31819235-31819257 GGCACACCTGGACAGGTGCCGGG + Intronic
1080801406 11:35613637-35613659 AACAGAGCTGGAGAGCTTACTGG + Intergenic
1083857329 11:65399720-65399742 GGCACACCTGGGGAGGGGACTGG - Exonic
1085197265 11:74680222-74680244 CACACACCTTGTGGGCTGACAGG - Intergenic
1090514089 11:127406216-127406238 GACACACATGGAGCGGTGAGGGG + Intergenic
1090626350 11:128612104-128612126 CAGAAGCCTGGAGAGCTGACCGG - Intergenic
1091258936 11:134218343-134218365 GACAGAAATGGAGAGCTGATTGG - Intronic
1091887099 12:4024858-4024880 GAAACCCCTGGAGACCTGGCAGG + Intergenic
1092070944 12:5630952-5630974 AAGACAGCTGGAGAGTTGACTGG - Intronic
1092225550 12:6746037-6746059 GGCCCAGATGGAGAGCTGACCGG + Intergenic
1092698949 12:11205496-11205518 GACAGGCTTGGAGAGCTGCCAGG - Intergenic
1093313524 12:17620396-17620418 GAGACACCTGGAGAGGTTCCTGG - Intergenic
1101549676 12:105750345-105750367 GACACACAGGGAGAGAGGACAGG + Intergenic
1102007393 12:109597299-109597321 GAAACAGCTGGAGAGGGGACAGG - Exonic
1103928723 12:124437825-124437847 GACACAGCTGCGGAACTGACAGG + Intronic
1104156291 12:126136253-126136275 GAAACACCTGGGCAGCAGACTGG - Intergenic
1106424386 13:29611826-29611848 GACATAGCTGGAGAGATGACTGG - Intergenic
1113142102 13:107165329-107165351 GACACACTTGAAGAGTTGAATGG - Exonic
1115160116 14:30384348-30384370 TACACACCTTGAGAGTTGACAGG + Intergenic
1116990533 14:51271319-51271341 GACACAACTGGCAAGCAGACAGG - Intergenic
1118361846 14:65063532-65063554 GACTCACCTTGAGGGCTGTCAGG - Intronic
1121086576 14:91151000-91151022 GACAGACATGGAAAGCTGAATGG - Intronic
1124332275 15:28831228-28831250 GCCACACCAGGAGAGCTGAAGGG + Intergenic
1124689457 15:31809996-31810018 AACACACTTGGAGAGGTGAAGGG + Intronic
1125434376 15:39629427-39629449 GACTCACCTGGTGCCCTGACTGG - Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1129616942 15:77106118-77106140 GAAACACCTGGAGCCCTGAAAGG - Exonic
1130689302 15:86066694-86066716 GCCAGACCTGCAGTGCTGACAGG - Intergenic
1130880006 15:88046715-88046737 CACACACCTGGACAGCAGCCGGG + Intronic
1132749540 16:1451093-1451115 GACACAACTGCAGAGGTGAAAGG + Intronic
1135411539 16:22238717-22238739 GACACACCTGGGTAGGTGATAGG + Intronic
1136142826 16:28298229-28298251 GCCATACCTGGAGAGAGGACAGG + Intronic
1136706122 16:32189181-32189203 GCCACACCAGGAGAGCTGAAGGG - Intergenic
1136761788 16:32740225-32740247 GCCACACCAGGAGAGCTGAAGGG + Intergenic
1136806312 16:33130164-33130186 GCCACACCAGGAGAGCTGAAGGG - Intergenic
1136996524 16:35194675-35194697 GACACCCATGGAGAGGTCACAGG + Intergenic
1139447245 16:67005427-67005449 AGCACACCTGGAGAGTGGACGGG - Intronic
1141386799 16:83628745-83628767 AACAAACCAGGAGAGCTGGCTGG - Intronic
1203063945 16_KI270728v1_random:1000537-1000559 GCCACACCAGGAGAGCTGAAGGG + Intergenic
1143498128 17:7324031-7324053 GAGACACCTAGAGACCTGATGGG - Intronic
1150571061 17:66387717-66387739 GGCACCCCTGGGGAGCAGACAGG - Intronic
1151334460 17:73431828-73431850 GAGAGACCTGGAGAGCTTTCTGG + Intronic
1152447286 17:80353186-80353208 GACACATCTGCAGAACTGACTGG + Intronic
1155088088 18:22477067-22477089 GACAAACCTAGAGAGCTGCCTGG + Intergenic
1156994201 18:43447092-43447114 GACTAACATGGAGAGCTGCCTGG + Intergenic
1162050735 19:8031086-8031108 GTCAGCCCTGGAGAGCTGCCGGG + Intronic
1163317510 19:16551343-16551365 GACACTCCTGAAGAGGTGACTGG - Exonic
1164999443 19:32749070-32749092 GAAACACCTGGGGTGCTGCCTGG + Intronic
1168237356 19:55071669-55071691 GACACAGATGCAGATCTGACTGG - Intergenic
926161427 2:10492759-10492781 GAAACACCTGGAGGACTGGCAGG + Intergenic
926574326 2:14563535-14563557 GATAAACCTGGAGAGGTGAGAGG + Intergenic
927630234 2:24766821-24766843 GAGGCAGCTGGAGAGCAGACTGG + Intronic
927871955 2:26629403-26629425 GACTCACCCGCAGAGCTGGCAGG + Exonic
928415890 2:31091367-31091389 GCCACACCAGGAGAGCTGAGTGG + Intronic
932603088 2:73143537-73143559 GAAACTCCTGTGGAGCTGACAGG - Intronic
932740491 2:74287272-74287294 GACACACCTGCAGAGGAGACTGG - Intronic
935500385 2:103831375-103831397 GAAACACCTGGGTGGCTGACAGG - Intergenic
937122909 2:119453040-119453062 GACCCACATGCAGAGCGGACAGG + Intronic
937264282 2:120606349-120606371 TGCCCACCTGGAGAGCTGACAGG - Intergenic
945716217 2:213360509-213360531 GACACACCTGGAGAGCTGACAGG - Intronic
948903295 2:240966689-240966711 GCCACCCCTGAAGAGCTGCCGGG + Intronic
1173120830 20:40287418-40287440 GCCACAGCTGGAGAGGTGCCAGG - Intergenic
1173404519 20:42753173-42753195 GTCACACCTGGAGGGCTGGTGGG - Intronic
1175447205 20:59031494-59031516 GACACACCTTGTTAGTTGACTGG - Intronic
1176199554 20:63854288-63854310 GGCACACCTGGAGTGCAGAGGGG + Intergenic
1177710983 21:24773971-24773993 TCCACACCTGGATAGCTGACAGG - Intergenic
1179121043 21:38546072-38546094 GAGACACCTAAACAGCTGACTGG - Intronic
1179489892 21:41734396-41734418 GCCCCACCTGCAGAGCTGCCGGG + Intergenic
1179600935 21:42476800-42476822 GACACTCCCGGAGAGCGGAGGGG - Intronic
1182272516 22:29164250-29164272 GACACACCTGGCAAACTGATGGG + Intronic
1184548000 22:45185766-45185788 GACACCTCTGGAGAAGTGACAGG - Exonic
1184735613 22:46396032-46396054 GACTCACCTGGAGTCCTCACTGG - Intronic
1185128205 22:49023347-49023369 GACTCACCAGGAGAGCTGGCAGG - Intergenic
952981375 3:38738758-38738780 GACACTCCTGGGAATCTGACAGG + Intronic
954456482 3:50602439-50602461 GACAGTCCTGGAGGGCTGCCTGG + Intergenic
959787617 3:110319710-110319732 CACTCACCTGAAGAGATGACTGG - Intergenic
962402225 3:135070290-135070312 GACCCACCTGGAGTGAAGACTGG - Intronic
962461509 3:135618652-135618674 GACACACCTGCAGAACTTCCAGG + Intergenic
964504263 3:157381334-157381356 GACATACCTGGTGAGCCAACTGG - Exonic
968943759 4:3653029-3653051 TACACACCTGGGGAGCCCACGGG - Intergenic
969528216 4:7714949-7714971 GAGAAACCTGGAGGGCTGCCTGG - Intronic
970415569 4:15853589-15853611 GACTCACCTTGAGACCTCACAGG + Intergenic
972215331 4:36891335-36891357 GAGACATTTGGAGAGTTGACAGG - Intergenic
975885483 4:78959564-78959586 GTCACATCTAGAGAGCTGAGGGG + Intergenic
979295771 4:119031107-119031129 GCCACTCCTGGAGACCAGACTGG - Exonic
981475320 4:145180954-145180976 GAAACACCAGGAGAGCAGGCCGG - Intergenic
982921467 4:161278553-161278575 GAAAGCCCTGGAGAGCTGAAGGG - Intergenic
985062950 4:186096380-186096402 GGCACACTTGGAGAACTGAGAGG - Intergenic
985745953 5:1647830-1647852 GCCACAGCTGGTGAGCTGCCGGG - Intergenic
986391020 5:7288523-7288545 GCCACACCAGGAGAGCTGAAGGG + Intergenic
986705189 5:10448719-10448741 CACACACCTGGAGAACGGACTGG - Intronic
988097627 5:26637971-26637993 GCCACACCTGGAGAGATCATGGG - Intergenic
990594351 5:57298249-57298271 AACACACCCGGAGAGCTTAATGG + Intergenic
991488348 5:67161178-67161200 GGCACACCCAGAGAGCTGCCTGG - Intronic
992505270 5:77381076-77381098 GGTGCACCTGGAGAGCTGGCAGG + Intronic
992636306 5:78728799-78728821 TACACCCCTGCAGAGCTCACTGG - Intronic
994832721 5:104806648-104806670 GTAAAAACTGGAGAGCTGACCGG - Intergenic
995528171 5:113067315-113067337 AAGACACCTGGAGACCTGGCAGG + Intronic
1003965943 6:11252199-11252221 GAGCCCTCTGGAGAGCTGACTGG + Intronic
1006114835 6:31769994-31770016 GCCAGACCTGCAGGGCTGACAGG + Exonic
1007953380 6:45893555-45893577 GAGAAACCTAGAGAGCTGGCAGG - Intergenic
1008438014 6:51498738-51498760 GACACACTTGGAGAGGTAGCAGG + Intergenic
1013597339 6:111672108-111672130 GGCACACCTGGAGATGTGACTGG - Intronic
1014372422 6:120626964-120626986 GACACACCTAGTGATCTGATGGG + Intergenic
1017846682 6:158264576-158264598 GATGCACCTGGAGGGCTGCCTGG + Intronic
1019342557 7:515487-515509 GCCACACCTGGGGAGGGGACTGG + Intronic
1022628477 7:32062355-32062377 GACACAGCTGGAGAGGAGCCAGG - Intronic
1023870834 7:44262275-44262297 GAGGCACCTGGGGAGCTGTCAGG - Intronic
1024057333 7:45670370-45670392 GACACAGCAGGTGAGCTGACAGG + Intronic
1024281191 7:47721190-47721212 GACACAGCTGCAGACCTCACTGG - Intronic
1024919757 7:54544878-54544900 GACACCCCTGGGGACCTGCCCGG + Intronic
1026718694 7:72812359-72812381 TACACTTCTGGAGCGCTGACAGG - Intronic
1029279947 7:99429096-99429118 GACATACCTGGAGGGCGTACCGG + Exonic
1030114873 7:106055468-106055490 GACCCACCTGGAAAACTGATGGG - Intergenic
1032831176 7:135628039-135628061 GGCACAGCTGGAGAGCTGGGAGG - Exonic
1034210381 7:149358034-149358056 GCCACACCAGAAGAGATGACGGG - Intergenic
1036013958 8:4759576-4759598 AACACACATGGGGACCTGACAGG - Intronic
1041137007 8:54769469-54769491 GACAAACCTGGAGAGGTGGGTGG + Intergenic
1041422642 8:57685841-57685863 AACATACCTGGAGAGCAGTCTGG + Intergenic
1042202136 8:66289392-66289414 TAGACAGCTGGATAGCTGACAGG - Intergenic
1045742726 8:105380959-105380981 GATACACGTGGAGAACTTACAGG + Intronic
1047783066 8:128125568-128125590 GACACACCGGGAGACTTGAAGGG + Intergenic
1048849010 8:138626671-138626693 TACACAAGTGGGGAGCTGACCGG + Intronic
1050821703 9:9887620-9887642 GACAAACCTGGAGAGTCAACTGG + Intronic
1051505121 9:17818495-17818517 CAAACACCTGGAGAGCTTTCTGG + Intergenic
1054741033 9:68805912-68805934 TACACAGCTGGAGAGTTGTCAGG + Intronic
1055636445 9:78283491-78283513 GACACATCTGAACAGCTGAAGGG - Intergenic
1056112288 9:83407944-83407966 TACACACATGGAGAGCTGCATGG - Intronic
1056810244 9:89758247-89758269 GTCATACCTGGAGAGCTTCCTGG + Intergenic
1057516149 9:95723128-95723150 CACACACCTGGAGAGGTGGGAGG - Intergenic
1059755857 9:117292719-117292741 CACACACGAGGAGAGCTGATAGG + Intronic
1061531971 9:131221516-131221538 GAGAGACCTGGGGAGGTGACAGG + Intronic
1186820348 X:13281797-13281819 AACATACCTGGAGAACTGGCAGG - Intergenic
1190815331 X:53924334-53924356 GGGAAACCTTGAGAGCTGACAGG + Intergenic
1197460335 X:126733596-126733618 CACACACCTGGAGTTTTGACTGG - Intergenic
1197627982 X:128824309-128824331 GATTCATCTGGAGAGGTGACAGG + Intergenic
1200052282 X:153440692-153440714 GACACCCCTGGTGGCCTGACGGG + Intergenic
1202390360 Y:24363869-24363891 GACTCACCTGGCAAGCAGACAGG + Intergenic
1202480424 Y:25306247-25306269 GACTCACCTGGCAAGCAGACAGG - Intergenic