ID: 945719145

View in Genome Browser
Species Human (GRCh38)
Location 2:213397014-213397036
Sequence TCATTAGCACAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945719145_945719152 29 Left 945719145 2:213397014-213397036 CCCTTCACCTTCTGTGCTAATGA 0: 1
1: 0
2: 1
3: 18
4: 245
Right 945719152 2:213397066-213397088 CCCTGCATCCATTGAGGTTCTGG 0: 1
1: 0
2: 2
3: 9
4: 102
945719145_945719149 23 Left 945719145 2:213397014-213397036 CCCTTCACCTTCTGTGCTAATGA 0: 1
1: 0
2: 1
3: 18
4: 245
Right 945719149 2:213397060-213397082 AGTTTCCCCTGCATCCATTGAGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945719145 Original CRISPR TCATTAGCACAGAAGGTGAA GGG (reversed) Intronic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
901928426 1:12581784-12581806 TCACCAGCACAGAGGGAGAAAGG + Intronic
904087369 1:27918657-27918679 TCATATGCACAGAAAGTCAAAGG + Intergenic
907712858 1:56900468-56900490 TCACTACCAGAGAAGGTGAATGG + Intronic
909514127 1:76488325-76488347 CAATCAACACAGAAGGTGAAGGG - Intronic
911061556 1:93752175-93752197 TCACTACCACAGAGTGTGAAGGG + Intronic
913062342 1:115220063-115220085 TCCTTAGCACAGAACGTCAGAGG + Intergenic
916991735 1:170251729-170251751 TCATTAACACAGAAGGTGGCAGG - Intergenic
917136167 1:171790056-171790078 CAATTATCACAGAAGGTGAAGGG + Intronic
917403053 1:174673334-174673356 TCATTAGCAGAAAAAGTTAAAGG + Intronic
918066157 1:181103179-181103201 TCATTGGCCCAGCAGGTAAATGG - Intergenic
918702156 1:187618564-187618586 TCATTAGCTCATAAAGTCAAGGG + Intergenic
920204110 1:204279100-204279122 TCATCTGCACAGAAGGAGGAGGG + Intronic
920285195 1:204874088-204874110 TCATTAGCACAGGAGTAGGAAGG + Intronic
921037229 1:211392490-211392512 TCTTCAGCACTGATGGTGAAAGG + Intergenic
921699281 1:218248947-218248969 CAATTATCACAGAAGGCGAAAGG + Intergenic
923765016 1:236884988-236885010 GAATTAGCACAGTTGGTGAAGGG + Intronic
1062961694 10:1577270-1577292 TCATGCACACAGAAGGTGGATGG + Intronic
1063237065 10:4127966-4127988 TCATTAGCAAAAAAGGTCAGAGG + Intergenic
1063581355 10:7310511-7310533 TCATTAGAACAGATAGAGAATGG - Intronic
1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG + Intergenic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1068284035 10:54911821-54911843 TAATCATGACAGAAGGTGAAGGG - Intronic
1068851177 10:61742978-61743000 TCATATGCACAGCAGGGGAAAGG + Intronic
1069114514 10:64488758-64488780 TAATTATGGCAGAAGGTGAAGGG + Intergenic
1071345882 10:84692142-84692164 TCATGAGCAGAGCAGGAGAAAGG + Intergenic
1079314810 11:19398593-19398615 TCATGAGAGCAGAGGGTGAATGG - Intronic
1079473596 11:20805283-20805305 TCATTAACATTGAATGTGAATGG - Intronic
1080118921 11:28652648-28652670 TCATCAGAACAAAAGGTGAATGG - Intergenic
1080287530 11:30632808-30632830 TGATTAGCACAAAAAGGGAAAGG + Intergenic
1082903502 11:58282454-58282476 TCATTAGCATCAAAGGTCAAAGG - Intergenic
1084277991 11:68065616-68065638 ACCTGAGCACAGAAGGTCAAGGG + Intronic
1085446095 11:76602136-76602158 TGATCATCACAGAAGGTGTATGG + Intergenic
1085684778 11:78611667-78611689 TCATGAGCACACTAGGTGATAGG - Intergenic
1085801315 11:79592533-79592555 TCAGAAGCACAGGGGGTGAAGGG + Intergenic
1087705827 11:101491002-101491024 TCATTAGCACAGTAAGAAAATGG + Intronic
1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG + Intronic
1089798953 11:121007798-121007820 TCATTTTAACAGAAGGAGAAAGG + Intergenic
1090833339 11:130435672-130435694 TCATGAGAACAGAAGGTCAGAGG - Intergenic
1092976938 12:13754493-13754515 TCAGTGGTCCAGAAGGTGAATGG + Intronic
1094383417 12:29868068-29868090 CCATTATGGCAGAAGGTGAAAGG - Intergenic
1097079173 12:56417063-56417085 TCAAGAGCACAGCAGGGGAAGGG + Exonic
1097842626 12:64336838-64336860 TCTTTAGCATAGAGGGAGAAGGG - Intronic
1098937381 12:76496286-76496308 CCAACAGCACAGAAGGGGAAGGG - Intronic
1099297517 12:80847739-80847761 TCACTACCACAAAAGGTGACAGG + Intronic
1099298646 12:80863528-80863550 TCATCAGAATAGAAGGTCAAAGG - Intronic
1099790532 12:87328998-87329020 TCATTAGGACAGTAGGTTAGTGG - Intergenic
1104115806 12:125748048-125748070 ACATCATGACAGAAGGTGAAGGG - Intergenic
1104572697 12:129938972-129938994 TCATCATGGCAGAAGGTGAAAGG + Intergenic
1107018126 13:35724983-35725005 TCATTATGCCAGAAGGAGAAGGG + Intergenic
1107598470 13:41988305-41988327 CCATAACCACAGAAGGAGAATGG + Intergenic
1107884604 13:44864964-44864986 TGATTAGGACAGAGGATGAAGGG + Intergenic
1109772635 13:66997286-66997308 CAATTATAACAGAAGGTGAAGGG + Intronic
1109860850 13:68197102-68197124 TCGTTAGCAGAGAAGGTGATTGG - Intergenic
1110684775 13:78358976-78358998 TCCTTAGCCCAGAGGGTGGATGG - Intergenic
1110693558 13:78460162-78460184 TCATTGGCAGAGGATGTGAAAGG + Intergenic
1110913362 13:80991206-80991228 CCATCATGACAGAAGGTGAAAGG + Intergenic
1111016295 13:82386725-82386747 TCTTTAGAACACAAGGTTAAAGG + Intergenic
1111778770 13:92695047-92695069 ACATTATGGCAGAAGGTGAAGGG - Intronic
1113507891 13:110829745-110829767 TCTTTAGCACACAAGGCGATGGG + Intergenic
1114450827 14:22824178-22824200 GCTTTAGCCCAGAAGGTCAAGGG - Intronic
1116199169 14:41770022-41770044 TCATTATGACAGAAGGCAAAGGG + Intronic
1117304489 14:54460188-54460210 TGATTACGGCAGAAGGTGAAGGG - Intergenic
1117693957 14:58339792-58339814 TAATCAGGACAAAAGGTGAAGGG + Intronic
1117714430 14:58566181-58566203 TGATTAGCACAAAAGCTGCAGGG + Intergenic
1118491334 14:66263555-66263577 TAATTATGGCAGAAGGTGAAGGG - Intergenic
1118910498 14:70058345-70058367 ACATTAGACCATAAGGTGAAAGG - Intronic
1120984612 14:90323409-90323431 TCATTATAATAGAAGGGGAATGG - Intronic
1122124286 14:99570813-99570835 GCATTAGCAGAAAAGGAGAAGGG + Intronic
1122868702 14:104623483-104623505 TCATAAGGGCAGAGGGTGAAAGG + Intergenic
1126218912 15:46189537-46189559 TCTATAGGACAAAAGGTGAAAGG - Intergenic
1126435299 15:48631500-48631522 TGGTTAGCAGAGAAGGGGAAGGG - Intronic
1126681054 15:51202544-51202566 TCCTTAGAAGAGAAGGTGGAGGG + Intergenic
1127659030 15:61082672-61082694 TCATTGGGACTGAAGGAGAAAGG + Intronic
1127833998 15:62775284-62775306 TTATTCGTACAGAAGGTGAAAGG - Intronic
1131407186 15:92175050-92175072 TCATTTGCACAAAACTTGAAGGG - Intergenic
1131529126 15:93177461-93177483 TCATAATCATGGAAGGTGAAAGG + Intergenic
1131767637 15:95697346-95697368 TCAGTAGGAAAGAAGGTGGAGGG - Intergenic
1131939714 15:97547558-97547580 CAATTATGACAGAAGGTGAAGGG + Intergenic
1132209184 15:100007826-100007848 TCATGAGCAAAGGAGGTCAAGGG + Intronic
1132284439 15:100651542-100651564 TCATGAGCCCAGAATGTGATTGG + Exonic
1133203453 16:4218663-4218685 CCATTAGCAGAGCAGGTGAGAGG + Intronic
1133707733 16:8371195-8371217 ACATTAGCAGTGAAGGAGAAAGG + Intergenic
1135489799 16:22899463-22899485 TCATTTGCAGAGAAAGGGAACGG + Intronic
1136602722 16:31306215-31306237 TCATTAGGACACAAGGAAAAAGG - Intronic
1137859881 16:51835858-51835880 TGATTTTCTCAGAAGGTGAAGGG - Intergenic
1140202884 16:72908539-72908561 TCATTAGCAAGGTAAGTGAACGG - Intronic
1140409517 16:74733570-74733592 TCGTGAGCACTGAAGGAGAAAGG + Intronic
1140616744 16:76674303-76674325 TCATGAGCACAAAAAGTAAAAGG + Intergenic
1142788505 17:2244498-2244520 ACAGTAGGACAGAAGATGAAGGG + Intronic
1143440278 17:6966550-6966572 TCATTATCACAGAAGGGGACAGG + Intronic
1144004193 17:11085450-11085472 TAATCAGGGCAGAAGGTGAAGGG - Intergenic
1144639855 17:16931283-16931305 TCAGCACCACAGAAGGTGGACGG - Intronic
1149047199 17:52260866-52260888 TAATTATGACAGAAGGTGAAAGG + Intergenic
1149240010 17:54638077-54638099 TCTTTAACACTGAATGTGAATGG + Intergenic
1153506241 18:5802471-5802493 TAATTATGGCAGAAGGTGAAGGG - Intergenic
1153546053 18:6206046-6206068 TCATTATCACAGCAGGTCAGAGG + Intronic
1157180456 18:45493217-45493239 TCATTAGGCCAGATGGTGTAAGG - Intronic
1158096856 18:53782497-53782519 TCATTAGCACTGAATGTGTAAGG + Intergenic
1159893488 18:73974541-73974563 TCATTATCACAAATAGTGAAAGG + Intergenic
1160415280 18:78705529-78705551 TTATGAGCAGAGAACGTGAATGG - Intergenic
1161132120 19:2596712-2596734 TCATCAGTGCAGAACGTGAAAGG - Intronic
1162989420 19:14292893-14292915 TGAGTAGCTCAGAAGGTGAGGGG + Intergenic
1164317903 19:24110719-24110741 TCATAAAAACAGAAGGTGGAAGG - Intronic
1166651666 19:44579767-44579789 TCATCATGGCAGAAGGTGAAGGG - Intergenic
1167772870 19:51531645-51531667 GCATGAGCAGAGAAGGGGAAGGG + Exonic
925281029 2:2684931-2684953 TCAAGAGCACATAAGGTGAATGG + Intergenic
925702266 2:6650631-6650653 TCATTAACACAGAGGGTTAGGGG + Intergenic
925944370 2:8847060-8847082 TCATTAGACCAAAAGGTGAATGG + Intergenic
926702793 2:15815023-15815045 ACATTTGCACAGAAGGAAAATGG - Intergenic
927421827 2:22941934-22941956 GCATTACCACAGAAGGGAAAGGG - Intergenic
928159172 2:28906232-28906254 TCATTGGCAGAGGATGTGAAAGG - Intronic
928885660 2:36145318-36145340 TCAGTAACACTGAAAGTGAATGG - Intergenic
930309322 2:49718068-49718090 TATTTATCACAGTAGGTGAAAGG - Intergenic
935203155 2:100875907-100875929 ATATTAGCACAGAAGGGAAATGG + Intronic
935572028 2:104671679-104671701 ACATTTGCACAGTTGGTGAATGG - Intergenic
938042334 2:128085967-128085989 CAATTATGACAGAAGGTGAAGGG + Intergenic
938615055 2:132989012-132989034 TCATTTAGAAAGAAGGTGAATGG - Intronic
939172377 2:138710921-138710943 ACATTAGCACAGATGCTGAGTGG - Intronic
940471249 2:154103825-154103847 TCATTCCCACAGCAGGTGAGTGG - Intronic
942857218 2:180563499-180563521 TCAATAGCACAAAAGATGAGGGG + Intergenic
943108238 2:183572927-183572949 TCATTAGAACAGCATGGGAAAGG - Intergenic
943944888 2:194045939-194045961 TTATGGGCACAGAAGCTGAAAGG + Intergenic
944099594 2:196008969-196008991 TAATTACGGCAGAAGGTGAAGGG + Intronic
945719145 2:213397014-213397036 TCATTAGCACAGAAGGTGAAGGG - Intronic
946381572 2:219352501-219352523 TCATGTGCACAGAAATTGAAGGG - Intergenic
946907597 2:224431300-224431322 TCCTTATCTCAGAAGATGAAGGG + Intergenic
946992181 2:225346179-225346201 TAATTATGGCAGAAGGTGAAGGG - Intergenic
947264855 2:228267199-228267221 TCATCATGGCAGAAGGTGAAGGG + Intergenic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1171567967 20:26212460-26212482 TCATAAACCCAAAAGGTGAACGG + Intergenic
1173099728 20:40074440-40074462 CCTCTAGCACAGAAGGTGAAAGG + Intergenic
1175185784 20:57178925-57178947 TCATGAGCACAGAAGGGACAAGG + Intronic
1175946935 20:62563350-62563372 CCAGTAGCACAGAGGGTGCAGGG - Intronic
1177736411 21:25096412-25096434 TTATAAGGACTGAAGGTGAAAGG - Intergenic
1177869398 21:26552778-26552800 TGACTAGCACAGGAGGGGAAAGG - Intronic
1178357253 21:31919384-31919406 GCATTTGCACAGAAGTTGGAAGG + Intronic
1179204065 21:39256709-39256731 TTCTTACAACAGAAGGTGAAGGG + Intronic
1179306948 21:40163181-40163203 TGATTAGGAGAGAAGGTGACAGG + Intronic
1180225538 21:46390020-46390042 TCATGAGCCCAGAAAGTGTACGG + Intronic
1180576651 22:16782158-16782180 CAATTAGCAGAGAGGGTGAAGGG + Intergenic
951159385 3:19398449-19398471 TCACTCTCACAGAAGGTGAATGG + Intronic
951281717 3:20758400-20758422 GCATTACCAGAGGAGGTGAAGGG - Intergenic
952636522 3:35538962-35538984 TAACTAGCATAGAAGGTAAAGGG - Intergenic
953766184 3:45745710-45745732 TCATCATGGCAGAAGGTGAAGGG - Intergenic
954614505 3:51962716-51962738 GCTTGAGCACGGAAGGTGAAAGG + Intronic
955458386 3:59151106-59151128 GCAATATCACAGAAGCTGAAAGG - Intergenic
955578632 3:60394496-60394518 GCTTTGGCACAGAAGGGGAAAGG + Intronic
955779453 3:62468742-62468764 TCATTATAACAGAAGAGGAATGG - Intronic
956172351 3:66442894-66442916 TCATTTGCTGAGAAAGTGAAGGG - Intronic
957227514 3:77468938-77468960 TCTTCTGCACAGAAGGGGAATGG - Intronic
958040260 3:88219071-88219093 CCATTCGAACAGAAGGTGCATGG + Intergenic
958267464 3:91456038-91456060 TGAATAGAACAAAAGGTGAAGGG + Intergenic
958506036 3:94978227-94978249 AACTTAGCAAAGAAGGTGAAAGG - Intergenic
959120410 3:102225478-102225500 TCATCAGCTCAGAAGGGGGAAGG + Intronic
959668343 3:108946029-108946051 TCATTAGCTCAGAGGGTTCAAGG - Intronic
959838731 3:110950139-110950161 CAATTATGACAGAAGGTGAAAGG + Intergenic
961057841 3:123804117-123804139 TCATTTGCTCATAAGGTAAATGG + Intronic
961602134 3:128070561-128070583 TCTTCAGCCCAGAAGGTGTAGGG - Exonic
963064822 3:141255438-141255460 TCTTTTCCACAGAAGGTGATGGG + Intronic
963132893 3:141875232-141875254 TCATTAGCTCAAAACGTAAATGG + Intergenic
963975010 3:151470607-151470629 TCATGAACAAACAAGGTGAAAGG - Intergenic
964629377 3:158793486-158793508 TCAGGAGTACAGAAGGTCAATGG + Intronic
965358086 3:167702213-167702235 TCAGAAGTAGAGAAGGTGAATGG - Intronic
967340910 3:188397031-188397053 AAATTAGCACAGAAGATAAATGG - Intronic
967956942 3:194884673-194884695 TCATGATCAGAGAATGTGAAAGG - Intergenic
968149348 3:196324781-196324803 TCTTTAGCTCAGAGGCTGAATGG - Intronic
971418031 4:26451480-26451502 TCCTAAGCTCAGAAGGTGAGGGG - Intergenic
973543584 4:51958348-51958370 GCAGTAGCAAAGAAGGGGAAAGG + Intergenic
973745658 4:53960862-53960884 TGATTGGCACAGGATGTGAAGGG + Intronic
974824436 4:67109012-67109034 TCATTATAACTGAAGGTAAATGG + Intergenic
975496900 4:75045489-75045511 TCATTAGCACCTTAGTTGAATGG - Intronic
975501003 4:75084835-75084857 TAATTGGCACAGATGTTGAATGG + Intergenic
977197697 4:94082936-94082958 TCATCATGGCAGAAGGTGAAAGG + Intergenic
978273864 4:106925123-106925145 TCTCTTGCACAGGAGGTGAAGGG - Intronic
978966349 4:114746738-114746760 TCATGAGAACAGAATGGGAAAGG + Intergenic
979389978 4:120117147-120117169 TCATGAGAACAGCAGGGGAAAGG + Intergenic
981269172 4:142823994-142824016 TGAATAGAACAGAAGGTGAGAGG + Intronic
984873124 4:184344976-184344998 TCATAAAGACAGAAAGTGAAGGG + Intergenic
985315586 4:188655963-188655985 TCAAAAGCTCAGAAGGAGAAGGG - Intergenic
985516136 5:345689-345711 TCATTATCACAGCAGGTGTTAGG - Intronic
986446241 5:7824004-7824026 TCCTTAGCACGGAAGCTGAAGGG + Intronic
986496088 5:8343605-8343627 TCATCAAGGCAGAAGGTGAAGGG + Intergenic
986961388 5:13217629-13217651 TAATGAGCACAGAGGCTGAAAGG + Intergenic
987322652 5:16784894-16784916 TCGCTAGCAGAGCAGGTGAAAGG - Intronic
987453257 5:18112345-18112367 CGATTAGCAGAGAAGGTGAAGGG - Intergenic
987494728 5:18629481-18629503 CAATCATCACAGAAGGTGAAAGG + Intergenic
987946868 5:24621170-24621192 TCATTGGCACTGTAGGTGAGAGG - Intronic
990488312 5:56280292-56280314 TCTGGAGCACAGAAGGAGAAGGG + Intergenic
992327860 5:75681307-75681329 TCATTTGAATAGAAAGTGAAAGG - Intronic
993021632 5:82598315-82598337 TCATTAGAAGGGAAGGTGACAGG + Intergenic
994138746 5:96319093-96319115 TAATTATGGCAGAAGGTGAAGGG + Intergenic
994354887 5:98783666-98783688 CCATGATCACAGAAGGTGATTGG + Intronic
995754294 5:115486266-115486288 TCAATAGCTCAGAAGCTCAAAGG + Intergenic
997563081 5:134865698-134865720 GCATGTGCACAGAAGGTGAGGGG + Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
998465423 5:142340007-142340029 TGATTAACACAGCAGGTGAGGGG - Intergenic
998730982 5:145077044-145077066 TCAGTACCTCAGAATGTGAAAGG + Intergenic
999442235 5:151611429-151611451 CCAGTAGCCCAGAAGATGAAAGG + Intergenic
1003484264 6:6562376-6562398 ACATTAAGGCAGAAGGTGAAGGG + Intergenic
1003922158 6:10842867-10842889 ACATTAGCACATAAATTGAATGG - Intronic
1004285491 6:14317162-14317184 TAATAAGCACAGAAGAGGAAGGG + Intergenic
1006124294 6:31827668-31827690 TGATTGGCTCAGAAGGGGAAAGG + Intergenic
1006196736 6:32247654-32247676 TCATTTGCACAGAGAGAGAAAGG - Intergenic
1007649230 6:43407606-43407628 TCATCAGTAGAGAAGGAGAAGGG + Intergenic
1008282942 6:49617796-49617818 TGATTATCACAGATGCTGAATGG - Intronic
1008546626 6:52589131-52589153 TCAACAGCACAGCAGGGGAAAGG - Intergenic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1008987752 6:57565566-57565588 TGAATAGAACAAAAGGTGAAGGG - Intronic
1009176356 6:60464166-60464188 TGAATAGAACAAAAGGTGAAGGG - Intergenic
1011177780 6:84584657-84584679 CCATTCGTAGAGAAGGTGAAGGG + Intergenic
1011305906 6:85926541-85926563 TCATAATCACACAAGGTAAATGG + Intergenic
1011384012 6:86774282-86774304 ACATAAGCAAATAAGGTGAAAGG + Intergenic
1013189182 6:107787648-107787670 TTATTAGCAAAGTATGTGAAAGG - Intronic
1013884221 6:114942399-114942421 TCATTAGCTCACAAGGAGAAAGG - Intergenic
1014045060 6:116876307-116876329 TCAAAAGAACAGAAGGTGGAAGG + Intergenic
1014722527 6:124935057-124935079 ACAATCGCGCAGAAGGTGAAGGG + Intergenic
1015086881 6:129305405-129305427 TCTTGAGCCCAGAAGGTGGAGGG - Intronic
1015921502 6:138270638-138270660 GCAGTAGTACAGTAGGTGAAAGG + Intronic
1017579770 6:155850824-155850846 CCATTTGCTCAGAAGGAGAAAGG + Intergenic
1018374399 6:163197385-163197407 TCATAAGGACAGTAGGTTAATGG - Intronic
1021626953 7:22602978-22603000 GCATTGGTACTGAAGGTGAATGG - Intronic
1022117057 7:27270442-27270464 TCACTAGCCCAGGAGGTGGAGGG - Intergenic
1024158146 7:46647378-46647400 TAATCATGACAGAAGGTGAAAGG + Intergenic
1024158412 7:46649329-46649351 TGATCATCGCAGAAGGTGAAAGG + Intergenic
1027703185 7:81494671-81494693 TCATTAGTGCAGGAGGTGAAAGG + Intergenic
1028119097 7:87037022-87037044 GCATTAGCACAGAAGCAGACTGG - Intronic
1030313229 7:108088808-108088830 TCTCTTGCACAGAAGGTGTATGG + Intronic
1030766437 7:113415857-113415879 TCATTAGAATACAAAGTGAAAGG - Intergenic
1031676745 7:124619767-124619789 TCACTAGGAGAGATGGTGAATGG - Intergenic
1032932250 7:136686759-136686781 ACATTAACAGAGAAGGTGACAGG + Intergenic
1034027365 7:147720741-147720763 TCATCATGGCAGAAGGTGAAAGG - Intronic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1034594563 7:152177514-152177536 TCATGACCATAGAAGATGAATGG + Exonic
1035109716 7:156470971-156470993 TCATCATGGCAGAAGGTGAAGGG - Intergenic
1035514639 8:222228-222250 GCTTCAGCACAGAATGTGAAGGG + Intergenic
1037040418 8:14224409-14224431 TCTCTAGCTCTGAAGGTGAAAGG + Intronic
1039623225 8:39020920-39020942 TCATTAGCTTAAGAGGTGAAAGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042346886 8:67736602-67736624 TCAATAGAGCAGAAGGGGAAAGG - Intronic
1044647978 8:94464845-94464867 TAATTAGGGCAGAAGGTAAAGGG + Intronic
1048145415 8:131837040-131837062 TAATTAGCACAGTATCTGAAAGG + Intergenic
1048351987 8:133623846-133623868 CCATTCGTACAGAAGCTGAAGGG - Intergenic
1049329961 8:142045289-142045311 TCATTCCCACAGAAAGTGATGGG + Intergenic
1049336061 8:142086373-142086395 TCAATAGCACAAAAGCTGACAGG + Intergenic
1055912413 9:81367775-81367797 TCTTGAGGACAGAGGGTGAAAGG + Intergenic
1057311164 9:93944136-93944158 TCATCAGCCCACAAGGAGAAAGG + Intergenic
1059782336 9:117543161-117543183 TGATTAGCAAAGGAGGTGCATGG - Intergenic
1061813489 9:133178281-133178303 TCATGAACAAACAAGGTGAAAGG + Intergenic
1186169161 X:6858850-6858872 TGATTAGCACGAAAGCTGAATGG + Intergenic
1186195585 X:7108006-7108028 TCTTTCTCACAGAAGGTGAATGG + Intronic
1186726932 X:12367375-12367397 TCATTAGCATGAAATGTGAAGGG - Intronic
1186791832 X:13007290-13007312 TCATCTGCACAGAGGGAGAATGG - Intergenic
1187127513 X:16468042-16468064 TCTTTAGCATAGAAGGTTACAGG - Intergenic
1187830644 X:23377747-23377769 TCATTAGCACAGAGCATGAGTGG - Intronic
1188206297 X:27363349-27363371 TCATCAAGTCAGAAGGTGAAGGG + Intergenic
1188263111 X:28040673-28040695 ACATTAGCCCAGAGGGTGATGGG + Intergenic
1188423507 X:30017646-30017668 TTATTATCACACAAGGTGACCGG - Intergenic
1188522041 X:31049410-31049432 TCATTTGCACAGAGATTGAATGG - Intergenic
1189609409 X:42715720-42715742 TCATGTGAACAGAAGTTGAATGG - Intergenic
1189757915 X:44290600-44290622 ACATTAGGATAGATGGTGAAGGG - Intronic
1191957560 X:66661684-66661706 TAATTATGATAGAAGGTGAAAGG - Intergenic
1197999976 X:132423658-132423680 TCATTAGGAAAAAAGGAGAAAGG - Intronic
1198848565 X:140940349-140940371 TAATTATGGCAGAAGGTGAAGGG - Intergenic
1200164690 X:154027828-154027850 TCATCAGCAGAGCAGGTGGAAGG + Intronic