ID: 945720942

View in Genome Browser
Species Human (GRCh38)
Location 2:213417829-213417851
Sequence TGATCTTTGTTTATAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945720942 Original CRISPR TGATCTTTGTTTATAAAAGG AGG (reversed) Intronic
904444873 1:30562569-30562591 GGATAAATGTTTATAAAAGGTGG + Intergenic
904887843 1:33754797-33754819 TGATCATCTCTTATAAAAGGTGG + Intronic
905696353 1:39976909-39976931 TGAACTTTTTTTACATAAGGTGG + Intergenic
908036556 1:60060689-60060711 TAATCTTTGTTTTTTAAAGGGGG - Intronic
908573194 1:65431085-65431107 TGATCTTTGTCTAGATAATGGGG + Intronic
908855943 1:68428659-68428681 TGATCTTTATTTAGATAAGATGG - Intergenic
909749346 1:79139064-79139086 TGATTTTTGTTTATGATATGAGG + Intergenic
909913664 1:81291465-81291487 TTCTCTTTGTTTTTAAAGGGAGG + Intergenic
910061658 1:83100817-83100839 GGATATTTGCTTTTAAAAGGAGG - Intergenic
911251275 1:95579293-95579315 TGAACTCTGGTGATAAAAGGAGG + Intergenic
911802254 1:102157046-102157068 GGATCTGTGTGTATAAAAAGAGG - Intergenic
912142823 1:106752415-106752437 TAATCTTTGTTAACAGAAGGAGG - Intergenic
912642971 1:111364809-111364831 TGAACTTTCTTTAGATAAGGTGG + Intergenic
912779513 1:112531985-112532007 TGTTTTTTGTTTTTTAAAGGTGG + Intronic
912895279 1:113580194-113580216 TGAACTTTATTTTTAAAAGTTGG - Intronic
912965228 1:114231258-114231280 TGATCTTTTTATACAAAAGGAGG + Intergenic
914396808 1:147277547-147277569 TGTTCTTTGTTTATCTTAGGGGG + Intronic
916204401 1:162301295-162301317 TGACCTTATTTTATAAAAAGAGG + Intronic
918033050 1:180835740-180835762 TGTTCTTGGTTTAAAAAAAGAGG + Intronic
918707445 1:187684390-187684412 TAATTTTTGTTTATAAACTGAGG + Intergenic
918808597 1:189084662-189084684 TTCTCTTTATATATAAAAGGTGG + Intergenic
918904200 1:190471358-190471380 TAATCTTAGTTGCTAAAAGGAGG - Intronic
919074383 1:192796236-192796258 TTATTTTTTTTTAAAAAAGGGGG + Intergenic
919151580 1:193707536-193707558 TGCTCTTCATTTATAAAATGTGG - Intergenic
919358096 1:196552277-196552299 TTATTTTTGTTTTTAAAAAGAGG + Intronic
919498555 1:198308843-198308865 TAATCTTAATATATAAAAGGGGG - Intronic
921085497 1:211787564-211787586 TGATTCTTGATTATAAAAAGAGG - Intronic
921137216 1:212272562-212272584 GGATCTTTATTTTTAAAAAGAGG - Intergenic
922043179 1:221917105-221917127 TGATCTTTGGTTTTAAAAATCGG + Intergenic
922116161 1:222617332-222617354 TGCTCTTTGATTAAGAAAGGGGG - Intergenic
923243768 1:232111027-232111049 GCGTCTGTGTTTATAAAAGGGGG + Intergenic
923385653 1:233462908-233462930 GGATCTTCATTTATAAAATGAGG + Intergenic
923577941 1:235177979-235178001 TGTTCTATGTTTCTAAAATGTGG - Intronic
923977467 1:239279968-239279990 TGATACTTCTTTATTAAAGGAGG + Intergenic
1063674403 10:8127278-8127300 TGATTTTTTTTTATAAGAGATGG + Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1065139565 10:22707249-22707271 AGTTCCTTGATTATAAAAGGAGG - Intronic
1068147349 10:53088564-53088586 TGATCTATGTTAATAAAGAGTGG + Intergenic
1068927965 10:62559465-62559487 GGAGATTTGGTTATAAAAGGTGG + Intronic
1069386434 10:67886873-67886895 TTTTCTTTTTTTTTAAAAGGTGG + Intronic
1070046700 10:72845357-72845379 TTATTTTTATTTATAATAGGGGG + Intronic
1072380613 10:94865750-94865772 TGATCTTTCATTATAGATGGTGG - Intergenic
1072858029 10:98970268-98970290 TGATCTATGTTTTTAAAAGTGGG - Intronic
1073096997 10:100985922-100985944 TAATCTTAGTTTAAAAAGGGGGG - Intronic
1073369420 10:102973823-102973845 TGATGTTGTTTTAAAAAAGGGGG - Intronic
1073443757 10:103568675-103568697 TTATCTTTTTTTTTAAATGGTGG - Intronic
1075487107 10:122831711-122831733 TGTTTTGTATTTATAAAAGGAGG + Intergenic
1076016656 10:127033183-127033205 TTATCTTTATTTTTAAAAGCTGG + Intronic
1077706725 11:4493742-4493764 TGATCCTAGTTAATAAAAAGGGG - Intergenic
1080387289 11:31817678-31817700 TGATTTTTGCTTTTAAAAGGAGG - Intronic
1080863181 11:36168336-36168358 TGATGCTTGTTTTTAACAGGAGG + Intronic
1081258825 11:40932716-40932738 TCATCTTTTTTTAAAAGAGGAGG + Intronic
1081496431 11:43615709-43615731 TTATATGTGTTTATAGAAGGAGG + Intronic
1081558922 11:44194350-44194372 TGATCCTTGTTAATAAAATCTGG - Intronic
1083093985 11:60230500-60230522 TGTGCTTTGGTTATAAAAGGAGG - Intronic
1085212333 11:74792077-74792099 TGATCTTTGCTTGTAAATGAGGG + Intronic
1087273562 11:96138139-96138161 AAATCTTTGATTACAAAAGGAGG - Intronic
1087536465 11:99452936-99452958 TTATTTTTGTTTATAAGATGAGG - Intronic
1088593153 11:111420413-111420435 TGGTCTTTGTGTAAAAAATGTGG - Intronic
1089766428 11:120770478-120770500 AGATCTTTGTTTATAAAGGATGG - Intronic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1091232054 11:133994640-133994662 TAATCTTTGTCTGTAAAATGGGG + Intergenic
1092189426 12:6507587-6507609 TGAACTTTCTTTAGATAAGGTGG + Intronic
1092805900 12:12222260-12222282 TGATCTTTCTTTATATATAGAGG - Intronic
1093134787 12:15437517-15437539 TGATCTATGTCCATAAATGGTGG - Intronic
1093444129 12:19234929-19234951 TGATTTATGTTTTTTAAAGGGGG + Intronic
1093495334 12:19750568-19750590 TGATCTGTGTTGTTAAAATGAGG - Intergenic
1093518393 12:20018614-20018636 TGACGTCTGTTTATAATAGGAGG + Intergenic
1093602649 12:21048072-21048094 TGATCTTTTTTTATTATAGCAGG + Intronic
1094260275 12:28488939-28488961 TAAACTTTATTTATAAAAGCAGG - Intronic
1094442494 12:30494133-30494155 TCATCTTTGCTGATAAAATGGGG - Intergenic
1094452918 12:30601313-30601335 TGATCTATGTCTATGAAGGGTGG - Intergenic
1095194581 12:39298035-39298057 TTCTCTTTGTTTACAATAGGGGG - Intronic
1098110282 12:67114280-67114302 TGAACTTTGTTTGTCAAAAGGGG - Intergenic
1098579609 12:72083672-72083694 TGATCTTGGTTTTTAACAGATGG - Intronic
1100099038 12:91080028-91080050 TGACCTTTATTTGTCAAAGGTGG - Intergenic
1100791991 12:98140699-98140721 TGACCTTTATCTGTAAAAGGAGG + Intergenic
1101196484 12:102388313-102388335 TGATCTCTATTTTTAAAAAGAGG + Intergenic
1101293888 12:103400981-103401003 GGAGCTTTGTTTACAAAAGCAGG - Intronic
1103170981 12:118819729-118819751 TGATTTTTGTATATAATATGAGG + Intergenic
1103677619 12:122668601-122668623 AAAACTTTATTTATAAAAGGTGG + Intergenic
1104045429 12:125159448-125159470 TGACCTTTGTACATCAAAGGAGG - Intergenic
1105317910 13:19284841-19284863 TTATCTGTGTTAATAAAGGGAGG - Intergenic
1106193677 13:27475582-27475604 TGTTCTTTGTTTATAAAAACTGG + Intergenic
1106330351 13:28733755-28733777 TGATCTGTAGTAATAAAAGGAGG - Intergenic
1106645755 13:31632023-31632045 TGATTTTTGTTCACACAAGGAGG + Intergenic
1107008653 13:35644778-35644800 AGATTTATGATTATAAAAGGGGG - Intronic
1107096477 13:36542942-36542964 AGATATTTGTTTTTAAAAAGTGG + Intergenic
1107225232 13:38040886-38040908 TTTTCCTTGTTTATAAAAGGTGG + Intergenic
1107293499 13:38884414-38884436 TGACATTTGCTTTTAAAAGGTGG + Exonic
1107568589 13:41632139-41632161 TGGTTTTGGTATATAAAAGGTGG + Intronic
1108878402 13:55076986-55077008 TGATTTTAGTTTATATAAAGAGG + Intergenic
1109861276 13:68201837-68201859 TGTTCTCTGTTTACAAAATGAGG + Intergenic
1110082947 13:71340499-71340521 TGATGTTTGTTTTTAAAATATGG - Intergenic
1110271385 13:73595086-73595108 AGATCTTTTTTAATTAAAGGTGG - Intergenic
1110620606 13:77590973-77590995 ATATATTTGTTCATAAAAGGTGG - Intronic
1110688539 13:78403832-78403854 TGTTCTTTGGTTATATAATGAGG + Intergenic
1111005706 13:82245402-82245424 TCAACTTTGAATATAAAAGGAGG - Intergenic
1111929733 13:94501341-94501363 TTTTCATTGTTTATAAAAAGTGG + Intergenic
1112554910 13:100458172-100458194 TGAACTTTGTTTAAAAATTGTGG + Intronic
1112703675 13:102041088-102041110 CAATATTTGTTTGTAAAAGGAGG - Intronic
1113228428 13:108184057-108184079 AGTTCTTTGTTTAAAGAAGGTGG + Intergenic
1113284442 13:108830798-108830820 TTATCTTATTTTATAAAAGCAGG + Intronic
1113401538 13:109998784-109998806 TGCTGTTTGTTTTTAAAGGGAGG - Intergenic
1113645828 13:111994866-111994888 TGATGCTTGTCTATGAAAGGGGG - Intergenic
1114881826 14:26795895-26795917 TGAGTTTTGTTTACAAAAAGTGG + Intergenic
1115110313 14:29813218-29813240 ATATCTTTATTTATAAAAAGAGG + Intronic
1116174706 14:41453150-41453172 TAATTTTTGTTTTTAAAAGATGG - Intergenic
1116738632 14:48727012-48727034 TGAATTTAGTTTATAAAAGCAGG - Intergenic
1117182989 14:53211649-53211671 TGATCTTTTTTTTTTAAAGATGG + Intergenic
1118037571 14:61884390-61884412 AGATCTGTGTTTAAGAAAGGAGG - Intergenic
1118431592 14:65724291-65724313 TGACCCTTCTTTATTAAAGGAGG + Exonic
1120949864 14:90031076-90031098 TGTTCTGTGTTTGTAAAAGTGGG - Intronic
1121396962 14:93633824-93633846 ACATCTTTGTTTTTAAAAAGTGG - Intronic
1122526586 14:102389954-102389976 TGTTCTTTGTTAGTAAAAGGAGG + Intronic
1123899177 15:24859039-24859061 TGAACTTTCTTTAGATAAGGTGG - Intronic
1123953670 15:25311400-25311422 AGATCTTGGTTTGTAGAAGGTGG - Intergenic
1123973663 15:25532223-25532245 TCATCTTTATTTTTAAAAGGAGG + Intergenic
1126384879 15:48084009-48084031 TCATCCTTATTTATAAAAGCAGG - Intergenic
1127142488 15:55992366-55992388 AGTTCTTTGTTTATAAAGGGTGG - Intronic
1127295746 15:57607452-57607474 TGATTTTTTTTTAAAAAAGAGGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1129076523 15:73001476-73001498 TCATCTTTCTTTATATAAAGAGG - Intergenic
1129634029 15:77295810-77295832 AGATTTTTGTTTATAAACGAGGG + Intronic
1130575237 15:85086294-85086316 TTATCTTCCTTTATAAAATGTGG - Intronic
1130692036 15:86090113-86090135 TGTTCTTTATCTATAAAATGGGG - Intergenic
1131245475 15:90788133-90788155 TTATCTTTGTTGACAAAAGGAGG + Intronic
1132029315 15:98427440-98427462 TGTGCTTCGTTTATAAAATGGGG - Intergenic
1132073541 15:98800469-98800491 TGTTCTTTGTTGGTAAAACGGGG - Intronic
1132127374 15:99239902-99239924 TCGTCTTTATTTATAAAATGGGG - Intronic
1132169097 15:99629479-99629501 TGATTTTTTTTTAGATAAGGTGG + Intronic
1133514131 16:6491332-6491354 TTATCTTTATTTCTAAAAGGAGG - Intronic
1134019228 16:10910035-10910057 AGATCTTTTTTTTTAAGAGGGGG + Intronic
1134334510 16:13285477-13285499 TTTTTTTTTTTTATAAAAGGAGG + Intergenic
1134472301 16:14536644-14536666 TTATCTTTGTTAATAAAGAGAGG + Intronic
1134647037 16:15877150-15877172 TGATATTTTTTTAAAAAAGAAGG - Intronic
1135425296 16:22329944-22329966 TGATTTTTTTTTTTAAATGGGGG - Intronic
1135691618 16:24542090-24542112 TGACACTTGTTTTTAAAAGGTGG - Intronic
1136182112 16:28560648-28560670 TGATCTGTGTTTACAAAAAAAGG + Intronic
1136455543 16:30377976-30377998 TGATCTTTGTTTCTTATGGGCGG + Exonic
1139066815 16:63326155-63326177 TGCTTTTTGTTTATAAGAGAGGG + Intergenic
1139126699 16:64087153-64087175 TGATTTTTTTTTAAAAAAAGAGG - Intergenic
1140556739 16:75930086-75930108 TGAACTTTGTTTGAAAAATGTGG - Intergenic
1140769696 16:78192045-78192067 ATTTCTTTGTTTATAAAAGAGGG + Intronic
1140970521 16:80008019-80008041 TGAACTTTGCATATAATAGGGGG - Intergenic
1144261680 17:13527727-13527749 AAATGTTTGTTTGTAAAAGGAGG - Intronic
1146406009 17:32538607-32538629 TGACCTTTGACTATAAAAGATGG - Intronic
1147817312 17:43219418-43219440 GGATATTTGTTCATTAAAGGTGG + Exonic
1147836908 17:43339417-43339439 TGATCCTAGTTAATAAAAAGCGG - Intergenic
1147911232 17:43857453-43857475 TGTTCTGTGATTCTAAAAGGGGG - Intronic
1148899114 17:50862704-50862726 TGATTTTTTTTTATAAAAATTGG - Exonic
1150330094 17:64287450-64287472 CTATCTTTGTTTTTAAAAGGAGG + Intergenic
1150959147 17:69895145-69895167 TGATATTTGTTTCTAGAATGTGG + Intergenic
1151583796 17:74996139-74996161 TGTTTTTTGTTTCTAAAACGAGG - Intronic
1153026811 18:679980-680002 TTATCATTTTTTATAAAATGGGG - Intronic
1153192209 18:2553698-2553720 ATACCTATGTTTATAAAAGGGGG - Intronic
1153852133 18:9104727-9104749 TACTATTTGTTTAAAAAAGGGGG - Intronic
1155107754 18:22684505-22684527 TCATCTTTGTTAGTAAAATGGGG - Intergenic
1157089571 18:44621173-44621195 AGAACTTTGTTTATGAAAAGAGG + Intergenic
1159226835 18:65549300-65549322 AGATCACTGTTTAGAAAAGGTGG - Intergenic
1159587709 18:70297117-70297139 TGCTATTTGTTTAAAAAAGAGGG - Intronic
1162828852 19:13271574-13271596 TTAGCTTTGTTTAAAAGAGGAGG + Intronic
1165378970 19:35464376-35464398 TGAACTTTCTTTAGATAAGGTGG + Intergenic
1165560978 19:36679331-36679353 TCATCTTTGTTTGTAATAGCAGG - Intergenic
1166936854 19:46339196-46339218 TGATTTTTTTTTAGATAAGGTGG - Intronic
1167357237 19:49011431-49011453 CGCTCTTTGCTTACAAAAGGCGG + Intronic
925658074 2:6171360-6171382 TGATTTTTGTTTAAAGAAGTGGG + Intergenic
925940268 2:8810265-8810287 TGATCTCTGTTTAGAGAAGCAGG - Intronic
929066946 2:37986891-37986913 TGATCTTAGTTTCTCAATGGTGG - Intronic
930200630 2:48549324-48549346 TGACCTTTACTTACAAAAGGAGG - Intronic
930311771 2:49750952-49750974 TGGTCTTCTTTTATATAAGGTGG + Intergenic
930669055 2:54128718-54128740 TGAATTTTTTTTAAAAAAGGGGG - Intronic
931241354 2:60455286-60455308 TGATCTTTTTTTTTTAAATGAGG - Intronic
931301195 2:60979985-60980007 TGATGTTTGTTTAGAAATGAAGG + Intronic
931468056 2:62509312-62509334 TGATAATTGTTTAGAAAAGAGGG + Intronic
932031016 2:68184695-68184717 TGATCAATGTTTAGAAAAGTTGG + Intronic
933918518 2:87020992-87021014 ATTTCTTTGTTTATAAAATGAGG + Intronic
934004477 2:87748923-87748945 ATTTCTTTGTTTATAAAATGAGG - Intronic
934609691 2:95725760-95725782 GTTTCTTTGTTTATAAAATGAGG - Intergenic
934752881 2:96805323-96805345 TGATTTTTATTTATAAAACTAGG - Intronic
935767436 2:106382939-106382961 ATTTCTTTGTTTATAAAATGAGG - Intergenic
937617821 2:123946651-123946673 ATATATTTGTTTAAAAAAGGGGG + Intergenic
938866091 2:135422469-135422491 GTATCTTTCTTTAAAAAAGGCGG + Intronic
938880829 2:135585492-135585514 TGATCTTTGTTTAACAAAATGGG + Intronic
939118245 2:138086435-138086457 ATTTCTTTGTTTATAAAATGAGG + Intergenic
939363731 2:141206607-141206629 TGTTCTTTGTTTAGAAATAGTGG - Intronic
941020771 2:160406701-160406723 TCATCTTTGTTTTTAAAAGAAGG - Intronic
941551939 2:166927618-166927640 TTATCTTTGTTTATTACAGTGGG + Intronic
942158641 2:173158672-173158694 TGATCATTGATTATAAAGGAAGG + Intronic
942585578 2:177472700-177472722 TGCTATTTGTTTATAAATGGTGG + Intronic
942836858 2:180310402-180310424 TGATATTTCTTTATCAAAGCAGG + Intergenic
944479532 2:200142730-200142752 TAATCTGTGTTTATAGAAGTAGG + Intergenic
944796254 2:203188515-203188537 TGATCTTTGGCTATAAACAGAGG + Exonic
945250918 2:207766319-207766341 TTAGCTTTGTTTATAGAGGGAGG - Exonic
945664915 2:212729180-212729202 TAATTTTTGTTTATAATATGAGG - Intergenic
945720942 2:213417829-213417851 TGATCTTTGTTTATAAAAGGAGG - Intronic
947798853 2:232914299-232914321 TGATGTTTGTTTAAACCAGGTGG + Intronic
1169523946 20:6402688-6402710 TGTTCTCTGCTTATAAAACGTGG + Intergenic
1169802448 20:9523976-9523998 TTTTCTTTGTTTATAAATGAAGG + Intronic
1173331860 20:42082009-42082031 TGCTCTGTGTTTAGAAATGGGGG - Exonic
1173622402 20:44446527-44446549 TGAACTTTATTTACAAAAGTAGG + Intergenic
1173695436 20:45007081-45007103 TTCTGTTTGTTTATAACAGGAGG + Intronic
1173988849 20:47284228-47284250 AGATTTATGTCTATAAAAGGTGG - Intronic
1175642710 20:60644248-60644270 TGATTCTTGATTGTAAAAGGAGG - Intergenic
1177060350 21:16365891-16365913 TTAGCTTTGTTTTAAAAAGGAGG - Intergenic
1178299457 21:31439839-31439861 TAATCTATGTTTAAAAAAGAGGG + Intronic
1182193305 22:28487257-28487279 TTATCTTTGTTTTTAAAAACTGG + Intronic
1182245297 22:28952437-28952459 TGTTCTTTGTTGATAAAGGGAGG - Intronic
1183037282 22:35149907-35149929 TCATCTTTTTCTATCAAAGGTGG + Intergenic
1184323110 22:43758606-43758628 TGATTTTTGGCTATATAAGGTGG - Intronic
949373751 3:3364161-3364183 TTATCTTTGTCTATAAAATGAGG + Intergenic
950878734 3:16303901-16303923 TGATTTTTGAGTATAAAATGTGG + Exonic
951159584 3:19401175-19401197 TGGAGTTTGTTTAAAAAAGGAGG - Intronic
956260441 3:67334560-67334582 TGTTCTTTCTTTATAATAGTAGG - Intergenic
956334496 3:68147795-68147817 TGATCCTTGTGTATAAAACAGGG + Intronic
956337547 3:68180912-68180934 TGAGATTGGGTTATAAAAGGTGG + Intronic
956861836 3:73332034-73332056 TGATTTTTGTTTATAATACTAGG + Intergenic
957645944 3:82926741-82926763 TGATATCTATTTAGAAAAGGTGG - Intergenic
958080529 3:88740843-88740865 TGATCAATGTTTATAAAAAAAGG + Intergenic
958649014 3:96912593-96912615 TTTTCTTTGTTTTGAAAAGGGGG + Intronic
959195293 3:103172821-103172843 TGAGCTACGTTTCTAAAAGGAGG + Intergenic
959313282 3:104769121-104769143 TGTTTTTTTTTTAAAAAAGGAGG + Intergenic
959557734 3:107741252-107741274 TGATCTTGTTTTATATCAGGAGG + Intronic
960425186 3:117498055-117498077 TTACCTTTTTTCATAAAAGGAGG - Intergenic
960985236 3:123274990-123275012 TTATCTTAGTATATAAAAGAGGG - Intergenic
961955339 3:130796147-130796169 GTATGTTTCTTTATAAAAGGGGG - Intergenic
962708292 3:138065464-138065486 TGATCCTTTGTTATAAAATGAGG - Intronic
963145135 3:141986104-141986126 TGAGCTTAGTCTATAAAAGATGG + Intronic
963438480 3:145304753-145304775 TATTTTTTGTTTATAAAAAGGGG - Intergenic
963933006 3:151023767-151023789 GGCTCCTTGTTTGTAAAAGGTGG + Intergenic
964021309 3:152015420-152015442 TGATTTTTGTTTATAGATTGAGG + Intergenic
964161742 3:153653957-153653979 TTATATTTGTTATTAAAAGGGGG + Intergenic
964562433 3:158012246-158012268 TGATTTTATTTTATAACAGGAGG + Intergenic
966759772 3:183407613-183407635 TGATCTTTCTTTTTAAAATCTGG + Intronic
967066188 3:185918432-185918454 TGACATTTGTTTATAGAAGGCGG - Exonic
967355178 3:188561274-188561296 TGAACTTTTTTTAAAAAACGTGG + Intronic
967431124 3:189386460-189386482 TGATGTATGTTTATTAAAGTTGG + Intergenic
967464503 3:189788264-189788286 TGGTTTTTGTGTATAAAAGAAGG + Intronic
967481585 3:189979483-189979505 TGATTTTTATCTATAAAAGAAGG - Intronic
967679735 3:192346843-192346865 TGCTATTTTATTATAAAAGGAGG - Intronic
968887496 4:3342258-3342280 TGCTTTTTGTTTTTAAGAGGTGG + Intronic
969268521 4:6082113-6082135 GGTTCTTTGTCTATAAAATGCGG - Intronic
970939250 4:21612146-21612168 TGATTTTTTTTAAAAAAAGGAGG + Intronic
971015160 4:22481264-22481286 TGATTTTTGCTTATCACAGGTGG - Intronic
971692066 4:29849583-29849605 TAAGCTTGGTTTATTAAAGGAGG + Intergenic
971692459 4:29854580-29854602 TGATATTTTTTTAAAAAAGAAGG - Intergenic
972130359 4:35825330-35825352 TAATCTTTGCATATAAAAGATGG + Intergenic
974188415 4:58470193-58470215 TGGTCTTTATTTATAAAATCAGG + Intergenic
974486779 4:62515483-62515505 TTATCTTTGTTTTAAAAATGAGG + Intergenic
976533673 4:86186182-86186204 GTTTCTTTATTTATAAAAGGAGG - Intronic
976942222 4:90717117-90717139 TGAGCTTTGTTTAAATAATGCGG + Intronic
977063271 4:92282129-92282151 TAATCTCTATTTATAAATGGAGG - Intergenic
977063528 4:92285450-92285472 CTATCTTTATTTATAAAATGTGG - Intergenic
978300840 4:107268548-107268570 TGATCTGTGTTTTTAATAGAAGG - Intronic
978310294 4:107379776-107379798 TGAACTTTCTTTAGATAAGGTGG - Intergenic
978311433 4:107388304-107388326 TGAACTTTCTTTAGATAAGGTGG - Intergenic
978469023 4:109041362-109041384 GGATTTTTTTTTAAAAAAGGGGG - Intronic
978787703 4:112628299-112628321 TGTTCTTTCTTTGTAAAATGGGG - Intronic
979952868 4:126916500-126916522 TGATTTTTTTTTTTTAAAGGAGG - Intergenic
980505364 4:133712220-133712242 TGATCTTAGTTTATCCAAGTTGG + Intergenic
980547743 4:134290818-134290840 TGATCTATGTTAAAAAAATGTGG - Intergenic
980665772 4:135932158-135932180 TGATTTCTGTCTTTAAAAGGTGG - Intergenic
982434226 4:155364242-155364264 TCATCTTTGTTTTCAAATGGTGG - Intronic
982821702 4:159948454-159948476 TGCTCTTTGCTTCTAAAATGAGG + Intergenic
982872600 4:160602158-160602180 TTTTATTTGTTTATAGAAGGAGG + Intergenic
982993272 4:162306926-162306948 TGATTTTTTTTTATAAAGTGTGG - Intergenic
983030651 4:162797634-162797656 TCATATTTGTTTATAAGAGTTGG - Intergenic
983468340 4:168123786-168123808 TGATTTTTTTTTATAGAAGTTGG - Intronic
984630636 4:182056907-182056929 TGCACTTTGTTGTTAAAAGGGGG - Intergenic
984810236 4:183789600-183789622 TTATCTTTTTTTATAGATGGGGG + Intergenic
986163014 5:5248157-5248179 TTCTTTTTCTTTATAAAAGGAGG + Intronic
986821932 5:11476944-11476966 GGATCTTTGTATAAAAAGGGAGG - Intronic
987034397 5:14005736-14005758 TCAGCTTTGTTTCTTAAAGGAGG + Intergenic
988019204 5:25601432-25601454 TGATCTTTGTTTAGAATATGTGG - Intergenic
990121965 5:52465612-52465634 TGGGCTTTATTTTTAAAAGGTGG - Intergenic
990259227 5:54003771-54003793 TGTTTTTCGTTTTTAAAAGGAGG - Intronic
991195732 5:63930056-63930078 TGATTTTTTTTTAGATAAGGTGG + Intergenic
992397283 5:76379637-76379659 TTATCTTTGATTTTAAAATGAGG - Intergenic
992623336 5:78615003-78615025 TGAACTTTGATTTTAAAATGTGG - Intronic
992788696 5:80194467-80194489 TGATGTTTGTTTTAAAAAGATGG + Intronic
992887766 5:81175984-81176006 TGATCATTTTTTGTAAAAGGGGG + Intronic
992949602 5:81845468-81845490 AGTTCTTTGTTTATAAAATGAGG - Intergenic
993137937 5:83993709-83993731 TGATCTGTGTTTACAAAAACAGG - Intronic
993864248 5:93173362-93173384 TGATTCCTGCTTATAAAAGGGGG + Intergenic
994049057 5:95342267-95342289 TTATCTTTGGTTCTCAAAGGTGG + Intergenic
995377828 5:111496721-111496743 TGCCCTTTGGTTAGAAAAGGAGG + Exonic
995955351 5:117770067-117770089 TCAGCTGTGGTTATAAAAGGAGG - Intergenic
997165272 5:131654174-131654196 TGGTCTTTGTTTGTAAACCGGGG - Intronic
997317049 5:132945449-132945471 TGTTGTTTGTTTTTAAAAGTAGG - Intronic
997619301 5:135274453-135274475 TGTTCTTTGTCTATGAAATGGGG + Intronic
998505467 5:142668617-142668639 TGAGCTTCCTTTATAAAAGGAGG + Intronic
998539978 5:142971587-142971609 TGATTTTTTTTTAGAAACGGAGG + Intronic
998784799 5:145697479-145697501 TGAACTTTATTTATAAAAGCAGG - Intronic
998960635 5:147482709-147482731 TGATTTTTTTTTCTAAAAGAAGG + Intronic
999943408 5:156569261-156569283 TGATCTTTTATTATACTAGGAGG + Intronic
1000501045 5:162050613-162050635 AGATCTTTTTTTAAAGAAGGAGG - Intergenic
1000715146 5:164633420-164633442 TGATTCTGGTTTATAATAGGTGG - Intergenic
1001213926 5:169837667-169837689 GTTTCTTTGTTTATAAAATGTGG - Intronic
1001724480 5:173885545-173885567 TTGTCTTGGTTGATAAAAGGTGG - Intergenic
1003241375 6:4348421-4348443 TGAGCTATCTTTATAAAAGCAGG - Intergenic
1003942944 6:11045715-11045737 ATATATTTGTTTATAAAAGGCGG + Intergenic
1003954552 6:11149723-11149745 TGAGCCTTGTTTATGAAAGGTGG - Intergenic
1005402928 6:25453602-25453624 TGATGTTTGTTTAAAAAACTAGG + Intronic
1008484132 6:52016830-52016852 TTTTATTTGTTTAGAAAAGGGGG + Intronic
1011134283 6:84082984-84083006 TGAACTTTTTTTAGATAAGGTGG - Intronic
1011883752 6:92064892-92064914 TGAACTTTGTTAATATAAGCTGG - Intergenic
1012011890 6:93798932-93798954 TGATCTTTCTGTATAAAGGAGGG + Intergenic
1013165458 6:107586584-107586606 AGATCTTTATTTAAAAATGGAGG + Intronic
1013615106 6:111835628-111835650 TGATTTTTTTTTAGATAAGGTGG + Intronic
1013749994 6:113394130-113394152 TGATGTTTGTTTTTAAAACCAGG + Intergenic
1014225598 6:118842818-118842840 TGAGTTTTTTTTAAAAAAGGGGG - Intronic
1014231691 6:118910412-118910434 TGATCTTTGCATTAAAAAGGAGG + Intronic
1014307862 6:119765027-119765049 TGAACTTTCTTTAGATAAGGTGG + Intergenic
1014308694 6:119771725-119771747 TGAACTTTCTTTAGATAAGGTGG + Intergenic
1014382982 6:120767178-120767200 TGAATTTTTTTTATTAAAGGTGG - Intergenic
1014768062 6:125429969-125429991 TGATTTGTGCTTATAAAGGGTGG + Intergenic
1014947866 6:127518014-127518036 TAATATTTCTTTATAAAATGAGG - Intronic
1016905133 6:149140916-149140938 TGAACTTTATTTTTAAAAGCAGG + Intergenic
1017216577 6:151914708-151914730 AGCTGTTTGTTTATAAAATGGGG + Intronic
1018123901 6:160663418-160663440 ATTTCTTTGTTTATAAAATGGGG + Intronic
1018128272 6:160703070-160703092 ATTTCTTTGTTTATAAAATGAGG - Intronic
1018253944 6:161899583-161899605 ATATCTTTGTTTATAAAGGTAGG - Intronic
1018285507 6:162233556-162233578 CCATCTTTGTCTATAAAATGAGG - Intronic
1019749017 7:2717219-2717241 TTTGTTTTGTTTATAAAAGGAGG + Intronic
1020169562 7:5834504-5834526 TGATCTTTGTATGTAAGATGTGG + Intergenic
1021067284 7:16192039-16192061 TGATCTTTCTCTATAAAAAAGGG + Intronic
1021115048 7:16738003-16738025 TGATCTTTTTTTTTTAAAGAGGG + Intergenic
1021783040 7:24124873-24124895 TTAACTTTCTTTATAAAAGGGGG + Intergenic
1023633221 7:42183885-42183907 TGGTCATTGTTTTGAAAAGGTGG - Intronic
1024145294 7:46509963-46509985 TGAGATTTATTAATAAAAGGAGG - Intergenic
1024337114 7:48220260-48220282 TGATATTTGTTAATAAATGGGGG + Intronic
1026542376 7:71290814-71290836 CCGTGTTTGTTTATAAAAGGCGG + Intronic
1027482530 7:78716932-78716954 TGACCGGAGTTTATAAAAGGTGG - Intronic
1027913432 7:84282484-84282506 TTATGTTTGTTAATAAATGGGGG - Intronic
1028309162 7:89308847-89308869 TTATATTTATTTACAAAAGGAGG + Intronic
1028826448 7:95279025-95279047 TTATCATTGTTTATTAAAGCAGG + Intronic
1030636968 7:111961173-111961195 TGATCTTTTTTAAGTAAAGGGGG - Intronic
1030876868 7:114824458-114824480 TAATCTTTTTTTAAAAAAAGAGG - Intergenic
1030918873 7:115354126-115354148 TGTTCTTTTTTTCTAAAAGTTGG + Intergenic
1031218855 7:118936543-118936565 TGTTTTATGTTTTTAAAAGGAGG + Intergenic
1031715011 7:125098097-125098119 AGCTCTTTGTTTGAAAAAGGAGG + Intergenic
1031851103 7:126865191-126865213 TCTTCTTTGTTTATAAAACTTGG + Intronic
1032548585 7:132763473-132763495 TGATTTTTGTATATAAAGGGAGG - Intergenic
1032717585 7:134523531-134523553 TTATTTTAGTTTTTAAAAGGAGG - Intergenic
1033963070 7:146937575-146937597 TTATTTTGGTTTATAAAAAGTGG + Intronic
1034887811 7:154811651-154811673 TTATCTTTGTTTATTAAATCAGG - Intronic
1038945719 8:32357548-32357570 AGATCTTGGTTTGTAAAAGCAGG - Intronic
1039014234 8:33128263-33128285 TCTTGTTTGTTTATAAAATGGGG + Intergenic
1039014366 8:33129536-33129558 TGAACTTTTTTTAGATAAGGTGG + Intergenic
1039368260 8:36955911-36955933 TAATGTTTGTTTAAAAAAGATGG + Intergenic
1039452474 8:37686676-37686698 TCCCATTTGTTTATAAAAGGGGG + Intergenic
1039641144 8:39224681-39224703 TTATCTTATTTTATAAAAGTTGG + Intronic
1040961411 8:53037173-53037195 TGTTGTTTGTTTATAATATGAGG - Intergenic
1041479136 8:58298819-58298841 TTAACTTTATTTATAACAGGTGG - Intergenic
1041758320 8:61337702-61337724 TGATTTTTATTTTCAAAAGGAGG + Intronic
1041932256 8:63299860-63299882 TCATCTTTGTTTATTAAAAATGG - Intergenic
1041953557 8:63532548-63532570 TTACCTTTGTCTGTAAAAGGAGG + Intergenic
1042541334 8:69909887-69909909 TGATCTTTGTTGGTCAAAAGAGG - Intergenic
1043927192 8:86050748-86050770 TGATGTGTGTTTTTAAAAGATGG + Intronic
1044734358 8:95264113-95264135 TTATCTTTGTTTATAATATCAGG - Intronic
1045327480 8:101127498-101127520 AGCTCTTTGTGTATAAAATGGGG + Intergenic
1045702807 8:104886377-104886399 TGTTGTTTGTTTAGAAAAGATGG + Intronic
1047935562 8:129774371-129774393 TGATCTTTGTGTATAAAGTAAGG - Intronic
1047955789 8:129974211-129974233 GGTTCTTTGTTGATAAAATGAGG - Intronic
1049908680 9:244444-244466 TGCTCTGTGCGTATAAAAGGGGG - Intronic
1049938619 9:523471-523493 TGACTTTTGTTTTTAAAAGATGG - Intronic
1050063089 9:1730882-1730904 TGATCTTTGTTTATCCAGGGAGG + Intergenic
1050321854 9:4460290-4460312 TAATCTTTAATTATAAAATGGGG + Intergenic
1050339858 9:4625798-4625820 TGAGATTTATTTATAATAGGGGG + Intronic
1051958140 9:22723898-22723920 TGATTTCTGTTTATAAAATAAGG - Intergenic
1052791889 9:32882912-32882934 TAATCTTATTTTACAAAAGGCGG - Intergenic
1053309154 9:37004748-37004770 TGAGCTTTGGTTATATATGGTGG - Intronic
1054787828 9:69226003-69226025 TGATCTGTGTTTATAAAAAATGG - Exonic
1055280861 9:74672896-74672918 AGTTCTTTGTTTTAAAAAGGGGG + Intronic
1056184827 9:84123871-84123893 TCAGCTTCGTTTATAAAAGGTGG + Intergenic
1056466119 9:86856873-86856895 GGAGATTTGTTTCTAAAAGGTGG - Intergenic
1057091867 9:92265550-92265572 TGAACTTTGTTTTTGACAGGTGG - Exonic
1059347753 9:113642242-113642264 TAATTTTTGTGTATAATAGGAGG + Intergenic
1059884458 9:118729951-118729973 TGGTCTTAGTCTGTAAAAGGTGG + Intergenic
1185454075 X:298938-298960 TGAGCTTTGCTTATAAAGCGTGG - Intronic
1186156269 X:6729844-6729866 TGAACTTTCTTTAGATAAGGTGG - Intergenic
1186651102 X:11560998-11561020 TAAACTTTGTTTATAAAAACAGG - Intronic
1186800656 X:13089272-13089294 TGATCTAGGTTTGTAAAAAGAGG - Intergenic
1187039555 X:15579319-15579341 TCATATTGGTGTATAAAAGGTGG - Intronic
1187610967 X:20942369-20942391 TGATCATTGTTAATTAATGGAGG + Intergenic
1187967263 X:24624411-24624433 GTATCCTTGTTTATGAAAGGAGG + Intronic
1188499725 X:30811867-30811889 TTATGATTGTTTATAAAAGAAGG - Intergenic
1188603387 X:31997236-31997258 TGATCTTCGTCTATAAAATCAGG + Intronic
1188668585 X:32855368-32855390 TGATCCTTGTTTACAAAACTAGG + Intronic
1189447308 X:41092877-41092899 TGATTTTTTTTTTTAAGAGGAGG + Intronic
1191642252 X:63439127-63439149 TAATATTTGTTTATGAATGGTGG - Intergenic
1192442914 X:71188130-71188152 TCATTTCTGTTTATAAAAGTCGG - Intergenic
1193653229 X:84165345-84165367 GGATTTTAGTTTATAATAGGGGG - Intronic
1193818457 X:86131425-86131447 TGAGCTTATGTTATAAAAGGAGG - Intergenic
1194473222 X:94323502-94323524 AAATCTTTATTTACAAAAGGAGG + Intergenic
1194728787 X:97430187-97430209 TGATCCATGTTAATAAAGGGAGG + Intronic
1195365921 X:104125264-104125286 TGTTCTTTTTCTATAAAAGTTGG + Intronic
1197218088 X:123885617-123885639 TGTTCTCTTTTTAGAAAAGGTGG + Exonic
1197332652 X:125173147-125173169 TCATGTCTGTTTATAAAATGTGG - Intergenic
1197342933 X:125295244-125295266 GGATCTTTGGTTATTAAATGTGG + Intergenic
1197450551 X:126609537-126609559 TGGTATTTGTTTTTTAAAGGAGG + Intergenic
1198864310 X:141105224-141105246 TGATTTTTTTTTAGACAAGGTGG - Intergenic
1198898379 X:141482192-141482214 TGATTTTTTTTTAGACAAGGTGG + Intergenic
1199580423 X:149354822-149354844 TGTTCTTTGCTTATTCAAGGAGG - Intergenic
1200751565 Y:6949742-6949764 TTATCTTAGTTTAAAAAATGAGG + Intronic
1201551210 Y:15218726-15218748 AAATCTTTATTTATAAAAGCAGG - Intergenic
1201708084 Y:16958919-16958941 CGATCTTAGTTAATAAAAAGAGG + Intergenic
1202303246 Y:23440392-23440414 TGATCTTGCTTTATAAATGCAGG - Intergenic
1202567565 Y:26230202-26230224 TGATCTTGCTTTATAAATGCAGG + Intergenic