ID: 945724081

View in Genome Browser
Species Human (GRCh38)
Location 2:213453697-213453719
Sequence TCAGTGCCACACTCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945724081_945724092 28 Left 945724081 2:213453697-213453719 CCAGGCAGTGAGTGTGGCACTGA 0: 1
1: 0
2: 1
3: 22
4: 279
Right 945724092 2:213453748-213453770 CCTCAAAATAGAGTAGAAAAAGG 0: 1
1: 0
2: 2
3: 25
4: 335
945724081_945724083 -10 Left 945724081 2:213453697-213453719 CCAGGCAGTGAGTGTGGCACTGA 0: 1
1: 0
2: 1
3: 22
4: 279
Right 945724083 2:213453710-213453732 GTGGCACTGATGGCCCACCTTGG 0: 1
1: 0
2: 1
3: 14
4: 154
945724081_945724093 29 Left 945724081 2:213453697-213453719 CCAGGCAGTGAGTGTGGCACTGA 0: 1
1: 0
2: 1
3: 22
4: 279
Right 945724093 2:213453749-213453771 CTCAAAATAGAGTAGAAAAAGGG 0: 1
1: 0
2: 6
3: 68
4: 751
945724081_945724084 0 Left 945724081 2:213453697-213453719 CCAGGCAGTGAGTGTGGCACTGA 0: 1
1: 0
2: 1
3: 22
4: 279
Right 945724084 2:213453720-213453742 TGGCCCACCTTGGTCTCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945724081 Original CRISPR TCAGTGCCACACTCACTGCC TGG (reversed) Intronic
900469958 1:2848894-2848916 TCAGTTCCACACTCCCACCCAGG - Intergenic
900668886 1:3836748-3836770 CCAGTGCAACTCTCACTGGCAGG + Intronic
901481576 1:9528856-9528878 TCTGTGCTCCACCCACTGCCAGG - Intergenic
902331807 1:15734550-15734572 TCGGTGCTACAGGCACTGCCGGG - Exonic
902421941 1:16287786-16287808 TCAGTGTCAAACTCTCGGCCAGG + Intronic
902669649 1:17964240-17964262 TCATGGCCAAACTCACTGTCAGG - Intergenic
903674750 1:25056602-25056624 TCAGTCTCACACCCGCTGCCTGG - Intergenic
903996260 1:27307068-27307090 GCAGTGCCCCACCCTCTGCCAGG - Exonic
904317392 1:29674536-29674558 TCAGTGCCTGCCTCACTACCTGG + Intergenic
905281080 1:36849825-36849847 CCACTGCCACACCCCCTGCCTGG - Intronic
906111392 1:43324550-43324572 TCAGATCCACATTCACTGCAGGG + Intergenic
907257051 1:53187509-53187531 TCCTTGCCAAATTCACTGCCTGG - Intergenic
907744200 1:57196422-57196444 TGCCTCCCACACTCACTGCCAGG - Intronic
907927605 1:58969172-58969194 CCAGTGCCAATCTCAGTGCCTGG - Intergenic
908085322 1:60625815-60625837 TCAGTGCCACAGCCTCAGCCAGG - Intergenic
908472738 1:64459826-64459848 TCACTGCAACACCCACTTCCCGG - Intergenic
908574574 1:65445558-65445580 TCTGTGCGAAACTCACTACCAGG + Intronic
908857678 1:68448351-68448373 TCAGTGCCTAGCTCAGTGCCTGG - Intronic
909546932 1:76858441-76858463 TGAGTGCCACACTGGCTGCCAGG + Intergenic
910970228 1:92848746-92848768 TCAGTGCCTCAAACAGTGCCTGG + Intronic
911232263 1:95373783-95373805 TCAGTGCCACACTGGGTGCTGGG + Intergenic
911604973 1:99894445-99894467 TCTGTGCCATACACACTTCCTGG - Intronic
911707105 1:101026277-101026299 TCAGAAGCACACTCACTGCTGGG - Intergenic
912827639 1:112920578-112920600 ACAGTTTCACTCTCACTGCCAGG - Intronic
913592679 1:120343172-120343194 TCAGTGCCACGTACAGTGCCTGG + Intergenic
913650672 1:120911958-120911980 TCAGTGCCACGTACAGTGCCTGG - Intergenic
914170441 1:145217109-145217131 TCAGTGCCACGTACAGTGCCTGG + Intergenic
914525557 1:148461075-148461097 TCAGTGCCACGTACAGTGCCTGG + Intergenic
914598113 1:149174754-149174776 TCAGTGCCACGTACAGTGCCTGG - Intergenic
914640841 1:149606053-149606075 TCAGTGCCACGTACAGTGCCTGG - Intergenic
915645664 1:157270193-157270215 TCAGTGGCAGGCTCACGGCCAGG - Intergenic
916022621 1:160807605-160807627 CCCATGCCACACTGACTGCCAGG - Intronic
920077679 1:203349049-203349071 CAAGTGCCACACCCAGTGCCAGG - Intronic
920146759 1:203867995-203868017 TCAGTACCTAACTCAATGCCTGG + Intronic
920195524 1:204223666-204223688 TCCCTGCCTCACTCCCTGCCTGG - Intronic
922065148 1:222130299-222130321 TCAGTTCTCCACACACTGCCAGG - Intergenic
922705205 1:227787013-227787035 ATAGTGCCACACTCACCCCCTGG + Intergenic
924406956 1:243758139-243758161 TAAGTGCCAGACTCTCTGACAGG + Intronic
924429934 1:243988243-243988265 ACAGTGCCAGCCTCCCTGCCAGG - Intergenic
1063615833 10:7599841-7599863 ACAGTGTCACTCTCCCTGCCTGG - Intronic
1064252903 10:13720504-13720526 TCAGTGCCTGACACAGTGCCAGG - Intronic
1064453964 10:15469486-15469508 TGATGGCCTCACTCACTGCCAGG + Intergenic
1065306314 10:24372531-24372553 TCAGTTTCATGCTCACTGCCTGG + Intronic
1067793857 10:49306891-49306913 GCAGGGCCACCCCCACTGCCAGG - Intronic
1070262608 10:74872106-74872128 TCTGTGCCAGACACAATGCCGGG - Intronic
1070819484 10:79346666-79346688 CCAGAGCCACCCTCACTGCAAGG - Intergenic
1070857250 10:79615741-79615763 TGAGTGCCACCATCACTGCTGGG - Intergenic
1071776486 10:88794196-88794218 GCTGTGCCACACTCACAGGCAGG - Intergenic
1071941336 10:90594783-90594805 TCAGTGCCACAATGTCTACCTGG - Intergenic
1071978270 10:90977141-90977163 TCTGTGCCCCACTCCCTACCAGG - Intergenic
1073456643 10:103640818-103640840 CCAGTAGCTCACTCACTGCCAGG - Intronic
1073543640 10:104331591-104331613 ACAGTGGGACACTCACTGCCTGG - Intronic
1075406510 10:122199175-122199197 GCAGTGCCACAATCAGTGCCTGG - Intronic
1075645826 10:124095382-124095404 CCAGGGCCACACATACTGCCAGG + Intergenic
1076637187 10:131889796-131889818 TCACTCCCGCGCTCACTGCCGGG + Intergenic
1077297691 11:1833777-1833799 TCAATGCCCCACTCCCTGGCAGG - Intronic
1077457660 11:2690585-2690607 TGTGTGCCCCACTCCCTGCCAGG - Intronic
1077893796 11:6438902-6438924 TCAGTGCCTCTCACAATGCCTGG - Intronic
1079154777 11:17935735-17935757 TCAGTTCTTCAGTCACTGCCTGG - Intronic
1079343413 11:19631688-19631710 TAGGTGCCACACTCAGTGCCGGG - Intronic
1083166520 11:60891426-60891448 CCAGTGCCTCCCTCAGTGCCTGG + Intronic
1083545224 11:63544592-63544614 TCAGAGGCACTCTCACTGGCAGG - Intronic
1084171370 11:67402481-67402503 TCACTGCAACATTCACTTCCCGG + Intronic
1084548910 11:69829061-69829083 TCAGTCCCACACTCACAGTAGGG - Intergenic
1085407372 11:76271311-76271333 TCGGTGCCTCGCTCAGTGCCTGG - Intergenic
1085756058 11:79202199-79202221 CCACTGCCACTCTGACTGCCAGG + Intronic
1086424917 11:86673543-86673565 TCACTGCCTAGCTCACTGCCTGG + Intergenic
1087949806 11:104207075-104207097 TCAGGGCCTGACTCAGTGCCAGG - Intergenic
1088728114 11:112657288-112657310 TCAGTGATACACTCCCTGCTGGG - Intergenic
1089479433 11:118792254-118792276 TCAGTCGCACTCTCACAGCCCGG - Intergenic
1089727056 11:120491300-120491322 TCAGTGCAACCTCCACTGCCGGG + Intergenic
1090799783 11:130163161-130163183 TCAGGGCCCCACTGACAGCCTGG - Intronic
1092477148 12:8828996-8829018 TCTGTACCACAGTCACTGCTGGG + Intronic
1094355474 12:29573430-29573452 TCAGTACCACACACTGTGCCAGG + Intronic
1095941369 12:47729298-47729320 TCAGCATCACACTCAATGCCTGG + Intergenic
1095967550 12:47879142-47879164 TCAGAGCCAGAGTCAGTGCCAGG + Intronic
1097286529 12:57881503-57881525 TCCCAGGCACACTCACTGCCAGG - Intergenic
1098922077 12:76311916-76311938 TCAATGCCACCCTCACTTCTGGG - Intergenic
1101555589 12:105805896-105805918 ACAGTGCCAGACTCTGTGCCAGG - Intergenic
1102101065 12:110279607-110279629 TCTGTGCCACTGTCACTGCTTGG - Intergenic
1103459497 12:121092699-121092721 TAAGTGCAACACACACTGCAGGG - Intergenic
1106836459 13:33640477-33640499 TCAGTGAAACACTCACTGAATGG - Intergenic
1107596507 13:41968446-41968468 AAAGTGCCTCACACACTGCCTGG + Intergenic
1108594352 13:51937178-51937200 TGAGTGGCTCACTCACTGGCTGG - Intronic
1110770976 13:79345732-79345754 TCAGTGCTACAAACAGTGCCAGG + Intronic
1110887182 13:80654864-80654886 TCAGTGCCAGCCTCGCTGCTAGG - Intergenic
1112790904 13:103001376-103001398 TCAGTGTCCCACACAGTGCCAGG - Intergenic
1113960588 13:114123667-114123689 TGAGAGCCACCCTCCCTGCCTGG - Intronic
1114194561 14:20465771-20465793 TCTGTGCCTCACTCAGTGGCAGG - Intergenic
1115761862 14:36583507-36583529 TCAACGGCACTCTCACTGCCTGG + Intergenic
1115845191 14:37523675-37523697 TCAGTGCCTAACACAGTGCCTGG - Intronic
1116169955 14:41387402-41387424 TCATTGCCTCTCTTACTGCCTGG - Intergenic
1116763021 14:49038287-49038309 TCAGAGCCCCACTCCCTGCTAGG - Intergenic
1119543889 14:75458014-75458036 TGAGTGCCACACTCTGTACCAGG + Intronic
1120024874 14:79571496-79571518 TCAGCTACACACTGACTGCCGGG + Intronic
1120216668 14:81687917-81687939 CCACTGCCACCCTCTCTGCCTGG - Intergenic
1120444424 14:84576456-84576478 TCACTGTCAGAATCACTGCCAGG - Intergenic
1121074672 14:91058612-91058634 TTTGTGCCACACTCAGTGTCAGG - Intronic
1121175317 14:91886682-91886704 TCAGTGCCTCACTCCAGGCCTGG - Intronic
1121720502 14:96105471-96105493 TCAGTGCCTGCCACACTGCCTGG + Intergenic
1121726652 14:96157166-96157188 TCAATGCCACACTCCCTCCAAGG - Intergenic
1122052955 14:99072656-99072678 CCTGTGCCACCCTCACTGCCCGG - Intergenic
1122373517 14:101242897-101242919 TCGGAGCCACAGTCACAGCCTGG - Intergenic
1122424275 14:101596646-101596668 GCACTGGCTCACTCACTGCCAGG - Intergenic
1122532796 14:102440533-102440555 TCAGGGCCACAAACACTGCCTGG - Exonic
1123885840 15:24727600-24727622 TCCTTGCCACACCCACAGCCTGG + Intergenic
1126273642 15:46849847-46849869 TCACTGCCACATTCCCTTCCTGG - Intergenic
1126650109 15:50911555-50911577 TCACTGCAACATTCACTTCCCGG + Intronic
1127687011 15:61356057-61356079 TCATTCCCAAACTCACAGCCAGG - Intergenic
1128510608 15:68311855-68311877 GCAGTGCCACATTCAGTGCCAGG + Intronic
1129660597 15:77550840-77550862 TCTGTGGCACCCTCACTGGCGGG + Intergenic
1130603032 15:85290679-85290701 TAAATGCCACACTGACTTCCTGG + Intergenic
1132617258 16:847850-847872 ACAGTGCCACCCTCCCTGCAGGG - Intergenic
1133793728 16:9029683-9029705 TCACTGCCACATTCACTTCCTGG + Intergenic
1133965714 16:10530256-10530278 TCAGAGCCTCACACAGTGCCTGG + Exonic
1134558318 16:15185397-15185419 TCGGTGGCACACTCTGTGCCAGG - Intergenic
1134791696 16:16994811-16994833 TTAATGCCTCACTCTCTGCCTGG - Intergenic
1134918850 16:18097000-18097022 TCGGTGGCACACTCTGTGCCAGG - Intergenic
1137777817 16:51071186-51071208 GCAGGGCCACACTCCCTGCGGGG - Intergenic
1139651611 16:68365121-68365143 TCAGGGCCACAGTGACTGGCAGG - Intronic
1140834777 16:78783277-78783299 ACAGTGCCACACACACTGTAAGG - Intronic
1142233288 16:88909804-88909826 TCAGCCCCTCACTCACTGCACGG - Intronic
1144695126 17:17298944-17298966 TCACTGCAACATCCACTGCCCGG + Intergenic
1147170759 17:38617433-38617455 TCAGTGCCCCACCCACAGGCTGG - Intergenic
1147571335 17:41572833-41572855 TCAATTCCACACTCCCTGCTGGG - Intergenic
1147641437 17:42003617-42003639 TCTGTCACTCACTCACTGCCAGG + Intronic
1148675421 17:49442054-49442076 ACAGAGCTACACTAACTGCCAGG + Intronic
1149691605 17:58581830-58581852 TCAGTGTCACACTGACTGCTGGG - Intronic
1149709524 17:58727851-58727873 TCACTGCCACCCTGACTTCCAGG - Intronic
1150124864 17:62629100-62629122 TCTGTCCCACATTCAATGCCAGG - Intronic
1150318097 17:64186876-64186898 TCAGAGTCACAGTCTCTGCCTGG - Intronic
1151989266 17:77563933-77563955 TCAGTGCCACACTCACCCTGGGG + Intergenic
1152102164 17:78308382-78308404 TGGGTGCCAAACTCACTCCCAGG + Intergenic
1152286239 17:79414866-79414888 TCTGTCCCAGACCCACTGCCAGG - Intronic
1152568142 17:81109291-81109313 TGAGTGCCACAGACACTGCAGGG - Intronic
1153665253 18:7362411-7362433 TCACTGCAACACTCACCGCGAGG + Intergenic
1154172979 18:12063983-12064005 TGAGTGACACACACACAGCCAGG - Intergenic
1154415890 18:14175013-14175035 TCTGTGCCACAGAGACTGCCTGG - Intergenic
1155361896 18:25011321-25011343 TCTTTGCCACACTCAATCCCCGG + Intergenic
1156091990 18:33482549-33482571 CCAGTACCATGCTCACTGCCTGG - Intergenic
1156520916 18:37721718-37721740 TCACTACCACATTCACAGCCAGG - Intergenic
1157305925 18:46517623-46517645 TCAGTGCCTGAGTCAGTGCCTGG + Intronic
1157883778 18:51346667-51346689 TCACTGCAGCACTCACTGCAAGG - Intergenic
1158088523 18:53682815-53682837 TCAGAGCCACCCACACTGCCTGG - Intergenic
1158555993 18:58475183-58475205 TCACTGCCACATCCACTTCCAGG - Intergenic
1158574921 18:58628822-58628844 TCAATGCCTCACACACAGCCTGG - Exonic
1161363321 19:3863782-3863804 CCAGTGCCTCACTCACAGTCAGG - Intronic
1163007653 19:14406615-14406637 GCAGTGCCACACACAATGTCCGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1164849326 19:31468436-31468458 TGAGTCCCACGCTCACTACCTGG + Intergenic
1165141227 19:33701089-33701111 TCACTGCCACACTCCCTGGGAGG + Intronic
1166356302 19:42229492-42229514 TCCTGGCCACACTCACTGCTCGG + Intergenic
1167194683 19:48019964-48019986 TCAGTGCCCAACTCAGTGCCTGG - Intronic
1167703113 19:51062576-51062598 TCAATGCCAGACACAGTGCCTGG - Intronic
1168445145 19:56405292-56405314 ACACTGTCACACTCACTGTCGGG - Intronic
1168595736 19:57675027-57675049 TCATTGCCACGCCCACTTCCCGG + Intronic
1168714383 19:58518501-58518523 TCTGTGCCACACCCACACCCTGG - Intronic
925388337 2:3479048-3479070 TAAGGGCCACAGCCACTGCCTGG - Intronic
927300493 2:21506623-21506645 TCAGTACCACACTCAATTCTAGG - Intergenic
927797983 2:26068519-26068541 TCACTGTCACAGTCACTGACAGG - Intronic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
928951836 2:36820149-36820171 TCAGTGCCCACCTCAATGCCTGG - Intergenic
929627495 2:43424532-43424554 TCAGAACCACAAGCACTGCCTGG + Intronic
931757914 2:65390380-65390402 CCAGTCCCACAGTCATTGCCAGG - Intronic
932289552 2:70565154-70565176 TCTGGGCCAATCTCACTGCCTGG + Intergenic
932403220 2:71496356-71496378 TCAGTGCCAGAATCAGTGCAGGG + Intronic
932502818 2:72199270-72199292 TCAGCACCACACTCAATTCCAGG + Intronic
934951780 2:98580565-98580587 CCACTGCCACATTCCCTGCCAGG - Intronic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
936864864 2:117065862-117065884 TCAATGACATACTCACTGCCAGG + Intergenic
936867180 2:117087996-117088018 TCAGAGCCACACTCGCTTACAGG - Intergenic
937333219 2:121044936-121044958 TCAGTGGCACACTCAGGGCTGGG - Intergenic
937411401 2:121679992-121680014 TCACTGCAACACCCACTTCCTGG + Intergenic
937971000 2:127549414-127549436 TGAGTGCCACGCTCACTACCTGG - Intronic
939125307 2:138171181-138171203 TCAGTACCATGCTCACTGTCTGG + Intergenic
943613577 2:190065279-190065301 TCAGTGCCTCACCCAGTCCCTGG - Intronic
945724081 2:213453697-213453719 TCAGTGCCACACTCACTGCCTGG - Intronic
948043982 2:234928640-234928662 AGAGCGCCACCCTCACTGCCTGG + Intergenic
948233014 2:236365649-236365671 TCACTGCCACACACTCTCCCGGG - Intronic
948449884 2:238062482-238062504 TCACTGCAACATCCACTGCCCGG + Intronic
1169193435 20:3671511-3671533 CCAGTGTCCCCCTCACTGCCTGG - Intronic
1170971843 20:21124248-21124270 TCACTGGCATGCTCACTGCCCGG + Intergenic
1171361212 20:24587563-24587585 TCTGTGCCACACTCTCTCCTTGG - Intronic
1173550656 20:43931062-43931084 TCAGAGCGACTCTGACTGCCAGG + Intronic
1173569808 20:44068797-44068819 GCAGTGACACACCCATTGCCCGG + Exonic
1174272660 20:49380843-49380865 TCAGGGCCACACTTCCTGCCTGG + Intronic
1176173165 20:63705438-63705460 TCAGTGCTGGACTCAGTGCCTGG + Intronic
1176857452 21:13984282-13984304 TCTGTGCCACAGAGACTGCCTGG + Intergenic
1176867154 21:14059940-14059962 TCTGTGCCACAGAGACTGCCTGG - Intergenic
1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG + Intergenic
1177519332 21:22197629-22197651 TCAGTGCCACACCCTGGGCCTGG + Intergenic
1178233707 21:30817817-30817839 TCACTGCCTCACTCACTACTGGG + Intergenic
1178384349 21:32137288-32137310 TCAGGGCCACACTCCCTACAGGG - Intergenic
1178556388 21:33594226-33594248 TCACTGCAACCTTCACTGCCTGG + Intronic
1179837868 21:44049445-44049467 TCTGTGCCAGGCACACTGCCAGG - Intronic
1180231225 21:46427845-46427867 TCTGTGTCACCCTCTCTGCCAGG - Intronic
1181023372 22:20114709-20114731 TCAGTGTCACAGTCCCTGCAGGG + Intronic
1181489973 22:23255650-23255672 TCAGTGCCCCAGTCCCTGTCCGG + Intronic
1182288141 22:29260036-29260058 CCTGTGCCCCACTCTCTGCCTGG + Exonic
1182807834 22:33090508-33090530 CCAGTGCTACTCTCTCTGCCAGG - Intergenic
1183154342 22:36063598-36063620 TCAGTGCAACTCTCCCTCCCCGG + Intergenic
1183663682 22:39235442-39235464 CCAGTGCCACCCTCCCTGGCTGG + Intronic
1184062187 22:42090316-42090338 TCAGTGACACACTCACTTTGTGG - Intronic
1184414502 22:44344415-44344437 TCTGTGCCTCTGTCACTGCCAGG + Intergenic
1184478394 22:44733882-44733904 ACCGTGCCTCACTCCCTGCCTGG + Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
1185427909 22:50783803-50783825 TCGGTACCACACCCACAGCCAGG - Intergenic
949503030 3:4700383-4700405 TCAGTGCCAGTCACAATGCCAGG - Intronic
953477867 3:43221295-43221317 TCAGAGCCCCACTCACGGACTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954821897 3:53336943-53336965 TCACTGCAACCTTCACTGCCTGG + Intronic
959628414 3:108480376-108480398 TCAGTTTCTCACTCACTCCCTGG - Intronic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
967341061 3:188398495-188398517 TAAGTGCCCCACTCTCTGCATGG - Intronic
967818726 3:193820778-193820800 TCACTGCAACATTCACTTCCCGG + Intergenic
968038152 3:195565958-195565980 ACGAAGCCACACTCACTGCCGGG - Intergenic
971886250 4:32452502-32452524 TCACTGCCAAAGTCACTGCTGGG - Intergenic
972532021 4:39969814-39969836 TCAGTGCCAAGCTTAATGCCTGG - Intronic
974153310 4:58038452-58038474 TGAGTACCACACTCACCACCAGG - Intergenic
978534646 4:109748300-109748322 TCAGTGCCTAACACAGTGCCTGG - Intronic
980612401 4:135176048-135176070 TCACTGCAACCCTTACTGCCTGG - Intergenic
985031400 4:185794287-185794309 GCCGTGCCCCACCCACTGCCTGG - Intronic
988217493 5:28294158-28294180 TCACTGCCACCTTCACTTCCCGG + Intergenic
990007290 5:50958577-50958599 TTTCTGCCACACTCACTGTCAGG - Intergenic
990242964 5:53834178-53834200 TCAGGGCCTCCCTCTCTGCCGGG - Intergenic
991616942 5:68506690-68506712 ACAGTGCTAGACACACTGCCTGG - Intergenic
992020512 5:72619371-72619393 TAAGTGCCCCACTCTTTGCCAGG + Intergenic
992190903 5:74290826-74290848 TTAGTCCCTCACTCACTGTCTGG - Intergenic
992221131 5:74574717-74574739 TCACTGCAACCCTCACCGCCCGG - Intergenic
995698772 5:114909151-114909173 TCACTGCAACCCTCACTTCCTGG - Intergenic
995831591 5:116361132-116361154 TCTGGGCCAGACTCCCTGCCTGG - Intronic
997924820 5:138020133-138020155 TCACTGCAACATTCACCGCCTGG + Intronic
998781131 5:145658071-145658093 TCAGTGCCTAACACATTGCCAGG - Intronic
1000319054 5:160119276-160119298 TCAGTGCCGGCCTCACTGCCGGG + Exonic
1001442034 5:171750629-171750651 CCAGTGTCACACTCACTGCCAGG + Intergenic
1003169537 6:3710243-3710265 TCAGTGTCACAATAAATGCCTGG - Intergenic
1005084579 6:21991931-21991953 CAAGTGCCACACACAGTGCCTGG + Intergenic
1005751424 6:28886359-28886381 GAACTGCCACACTCACGGCCAGG + Intergenic
1006409827 6:33866603-33866625 TCAGTGGCTCAGTCACTACCAGG + Intergenic
1007088182 6:39165490-39165512 TCACTGCCACCTTCACTTCCTGG + Intergenic
1007654804 6:43445615-43445637 TCAATGCCACACCCACGGGCCGG + Exonic
1008306851 6:49913820-49913842 ACAGTGCCCCACCCACTGTCAGG + Intergenic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1013164000 6:107573432-107573454 GCAGTGCCCCACACAATGCCTGG - Intronic
1013349157 6:109290431-109290453 CCACTGCCACACCGACTGCCTGG - Intergenic
1016427775 6:143952774-143952796 TCAGTGACACAATCAATGCAAGG + Intronic
1017815359 6:158012261-158012283 TAAGTGCCACATTCACAGCCTGG - Intronic
1018355197 6:163007601-163007623 TCACTGCCCAGCTCACTGCCTGG - Intronic
1018849448 6:167576599-167576621 TCGCTGCCAAACCCACTGCCTGG + Intergenic
1019041342 6:169108600-169108622 CCAGTTCCACAGTCACTTCCAGG - Intergenic
1020085609 7:5308724-5308746 TCCCTGCCACTCTCAGTGCCTGG - Intronic
1022177387 7:27884927-27884949 TCAGTTTCACTCTCTCTGCCGGG + Intronic
1022284051 7:28938298-28938320 GCAAGGCCACTCTCACTGCCAGG + Intergenic
1024635568 7:51287133-51287155 TGGGTACCACACTCACTACCTGG + Intronic
1025663251 7:63568444-63568466 TCCCTGCCACTCTCAGTGCCTGG - Intergenic
1027173127 7:75886865-75886887 ACACTGCCACACCCAGTGCCAGG + Intronic
1027228787 7:76260627-76260649 CCAGAGCCAGACTCACTGACCGG + Intronic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1030329910 7:108260311-108260333 ACAGTGCCAGAGTCAGTGCCTGG + Intronic
1031257625 7:119475897-119475919 TGAATGACACACTCACTGTCTGG - Intergenic
1032539730 7:132693155-132693177 TCAGGGCCTCACTCACAGTCAGG - Intronic
1033958273 7:146879656-146879678 TCAGCTCCACAGTCCCTGCCAGG - Intronic
1034034950 7:147809342-147809364 TCAGTGCCAGACACAGTGCTGGG + Intronic
1034233229 7:149548776-149548798 TAAGTGGCACAATGACTGCCAGG + Intergenic
1035557847 8:579746-579768 TCAGTGTCCCATTCGCTGCCTGG + Intergenic
1037754526 8:21702496-21702518 TCACTGCCCCACACACAGCCAGG + Intronic
1038272778 8:26089358-26089380 GCAGTGCCACAACCACTGCAGGG - Intergenic
1039166899 8:34691834-34691856 TCACTGCAACCTTCACTGCCAGG - Intergenic
1039880603 8:41623157-41623179 TCAGTGCTCTCCTCACTGCCCGG - Exonic
1040422529 8:47253344-47253366 TCACTGCAACATCCACTGCCTGG - Intergenic
1041151436 8:54939511-54939533 CCAGTGCCAGTCTCTCTGCCAGG - Intergenic
1041718081 8:60950319-60950341 CCATTTCCAAACTCACTGCCTGG - Intergenic
1042845693 8:73167729-73167751 TCTGCTCCACACTCACTGCTTGG - Intergenic
1042845887 8:73169268-73169290 TCTGCTCCACACTCACTGCTTGG - Intergenic
1042872365 8:73410540-73410562 TCAGCTCCAAACTCACCGCCGGG - Intergenic
1044712202 8:95068776-95068798 TCATTGCCAAACTTTCTGCCTGG + Intronic
1045238970 8:100381567-100381589 ACATGGCCACACTCACTGCAAGG - Intronic
1045351335 8:101343044-101343066 TAAGTGCCTCACACAGTGCCTGG - Intergenic
1045747285 8:105438347-105438369 TCAGTGCCCAACACAGTGCCTGG + Intronic
1048104722 8:131395516-131395538 TAAGTGACTCACTCACTGTCAGG - Intergenic
1048325732 8:133437424-133437446 TCAGTGCCTGACACAGTGCCTGG - Intergenic
1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG + Intergenic
1049283089 8:141760498-141760520 TCAGTGCCACAGACGCTCCCAGG + Intergenic
1049284441 8:141767029-141767051 TCAGTGCCACCCTGGCAGCCTGG + Intergenic
1049287717 8:141785527-141785549 TCTCTGCCACACTCACCCCCAGG - Intergenic
1049716979 8:144097662-144097684 TCTGTCCCACACCCACTGTCTGG - Intergenic
1051922326 9:22282003-22282025 TCAGTGCCATGCTCTCTGCTAGG - Intergenic
1056085430 9:83144224-83144246 TGGGTACCACTCTCACTGCCTGG + Intergenic
1057534535 9:95886633-95886655 TCAGTGCCAATCACAGTGCCTGG - Intronic
1059080596 9:111245058-111245080 TCAGTGCAACACTATTTGCCTGG + Intergenic
1059782781 9:117547259-117547281 TCAGTGGAACAATCACTCCCAGG + Intergenic
1062094799 9:134697636-134697658 TCAGTGCCCCATGCACTCCCAGG + Intronic
1186259098 X:7756839-7756861 TCACTGGCAAACTCACTGCCTGG - Intergenic
1186557681 X:10577110-10577132 TCAGCTCAACACCCACTGCCTGG + Intronic
1187333225 X:18359794-18359816 CCACTGCCACCGTCACTGCCAGG - Intergenic
1187442083 X:19329488-19329510 TCACTTCCACACTCCCTGACTGG + Intergenic
1190770829 X:53512780-53512802 CCAGTGCCACACTCTGGGCCTGG + Intergenic
1190923158 X:54876497-54876519 TCTGTGTCCCGCTCACTGCCGGG - Intergenic
1192375885 X:70561460-70561482 TCACTGCAACCCTCACTTCCTGG + Intronic
1195788267 X:108552096-108552118 TCAGTACGACACTCACTACCTGG + Intronic
1196938249 X:120750934-120750956 TCAGTGCCAAATTCAGGGCCTGG + Intergenic
1199999968 X:153055400-153055422 TTTGTGCCCCACTCACTGCAAGG + Intergenic
1201714094 Y:17024345-17024367 TTTCAGCCACACTCACTGCCTGG - Intergenic