ID: 945727911

View in Genome Browser
Species Human (GRCh38)
Location 2:213495566-213495588
Sequence AGGGAGATTACATTGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945727911 Original CRISPR AGGGAGATTACATTGATTGA AGG Intronic
903348613 1:22704046-22704068 AGGGAGTTTATATTTATTGCAGG + Intergenic
906056175 1:42919321-42919343 ATATAGATTACATTAATTGAGGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907772181 1:57476418-57476440 GGGGTGATTACTTTGAATGAAGG - Intronic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911616816 1:100021797-100021819 AGGGAAATTACATTAAATGCAGG - Intronic
912559898 1:110543224-110543246 ATGGACATTACAGTGATTTATGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
913941147 1:125107611-125107633 AGGAAAATTATATAGATTGATGG + Intergenic
915006884 1:152646336-152646358 TGGGAGATGACATTGACTGAGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917087393 1:171317779-171317801 AAGGATATTACATGGGTTGAGGG - Intronic
917152993 1:171964681-171964703 AGTGAGAATACCTTGATTCATGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
921494385 1:215820711-215820733 AGGAAGAATAGATTGATTAATGG - Intronic
923147136 1:231206079-231206101 AGGGAAATTACATTCAGTCATGG - Intronic
1064247047 10:13676829-13676851 ACTGGGATTGCATTGATTGATGG - Intronic
1064320229 10:14297933-14297955 AGAGAGATAACATTAATTGCTGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065421205 10:25546541-25546563 AGGGAGAATTCATTCATTCATGG - Intronic
1066238157 10:33507226-33507248 GAGGATATTACATTGATTTATGG - Intergenic
1067200265 10:44164320-44164342 TGGGAGATTTAATTGATTCAAGG - Intergenic
1069661863 10:70128251-70128273 TGGCAGTTTCCATTGATTGATGG - Intronic
1071757148 10:88555814-88555836 AGGGAGATGCCAGTGAGTGAGGG - Intronic
1072284437 10:93899458-93899480 ATGGAGGTTACAATGGTTGAAGG - Intronic
1072493047 10:95927845-95927867 AGGGAGACTACACAGTTTGAGGG - Intronic
1073320133 10:102610896-102610918 AGGGAGATTTCGTTGACAGAGGG + Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074020636 10:109579103-109579125 AGGAAGAATACATTTATTTATGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1083384740 11:62299196-62299218 AAGGAGGTGACATTGATGGACGG - Intergenic
1084440416 11:69169589-69169611 AGGGAGAGTCCATGGATTGCAGG + Intergenic
1085982582 11:81743296-81743318 AAGGAGATTACATTGTTTAAAGG - Intergenic
1087430074 11:98042472-98042494 ACAGAGATTACATGGAGTGAAGG + Intergenic
1087840240 11:102912887-102912909 AGGAACATGACATTTATTGAAGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1095278495 12:40320664-40320686 GTGCAAATTACATTGATTGATGG + Intronic
1097683465 12:62670663-62670685 GGAAAGATTACATTTATTGATGG - Intronic
1097945905 12:65367108-65367130 AGGCAGATTGCACTGATTCAAGG + Intronic
1098072728 12:66693470-66693492 AGGCAGATAACAGTGAATGAAGG - Intronic
1098624769 12:72650642-72650664 AGGAAATGTACATTGATTGATGG + Intronic
1099089041 12:78281087-78281109 AAGGAGATTACAATGTTAGAAGG - Intergenic
1101079244 12:101165394-101165416 AGGGAGAAAAGATTAATTGAAGG - Intronic
1103492551 12:121333780-121333802 AAAGAGCTTAGATTGATTGAGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108125354 13:47236971-47236993 AAGGAGTTTACATTTAATGAGGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1111057961 13:82974278-82974300 TGTGAGATGACATTGATTGCTGG - Intergenic
1114734737 14:25032686-25032708 AAGGATTTTACATTGATCGAGGG - Intronic
1115933043 14:38519620-38519642 AGAGAAAATAGATTGATTGACGG + Intergenic
1118031157 14:61819445-61819467 AGGTAGTTTACATTTATGGATGG + Intergenic
1119670445 14:76514287-76514309 AGGGAGATTGGATTGAATGTGGG + Intergenic
1121675758 14:95751397-95751419 ACGGAGATTAGATTAATGGAAGG - Intergenic
1202910927 14_GL000194v1_random:115984-116006 AGGTAGATTTGATTGATGGATGG - Intergenic
1125435116 15:39636058-39636080 AGGGAGATAATATTGTTGGAGGG - Intronic
1126943039 15:53786546-53786568 AGGGAGTTTTTATAGATTGATGG - Intergenic
1128324825 15:66717512-66717534 AGGGGAAATACATTTATTGAAGG - Intronic
1136697306 16:32095503-32095525 AGGAAAATTATATAGATTGATGG - Intergenic
1136797805 16:33038794-33038816 AGGAAAATTATATAGATTGATGG - Intergenic
1140707692 16:77646099-77646121 AGGAAGATTACCTTGAGGGATGG + Intergenic
1141375716 16:83528200-83528222 AGGGATATTACTTAGATTTAAGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143671755 17:8401374-8401396 AGAGAGATTAGATGGATAGATGG - Intergenic
1146474483 17:33152021-33152043 AGGGAGCTAACACTGATTAAGGG + Intronic
1147787206 17:42987721-42987743 AGCTAGATTACATTGTATGATGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155115690 18:22764418-22764440 ATGTAGATGACATTGGTTGATGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155520336 18:26661498-26661520 AGAGAGACCACATTGATTTAAGG - Intergenic
1155911589 18:31510539-31510561 ACAAAGAGTACATTGATTGATGG + Intronic
1156966747 18:43103729-43103751 AGGTAGATGACAGTGATGGAAGG + Intronic
1157233337 18:45939927-45939949 ATGGAGCTTACATTTAGTGAAGG + Intronic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1158323860 18:56293385-56293407 AGGAAGATTGCATTGTTTGATGG + Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1161384390 19:3983280-3983302 AGGGAGATGGCACTGATGGAGGG + Exonic
1163383618 19:16985586-16985608 AGGGAGAGTAAATGGATGGATGG + Intronic
1165539277 19:36477892-36477914 AGGAAGACTACATTGTTTAAGGG + Intronic
1165610188 19:37144714-37144736 CAGGAGATAAGATTGATTGAGGG - Intronic
1166718929 19:44986564-44986586 GGGGAGCTTACATTGATCCAGGG - Exonic
1202657301 1_KI270708v1_random:35773-35795 AGGTAGATTTGATTGATTGGTGG + Intergenic
1202668818 1_KI270709v1_random:29342-29364 AGGAAAATTATATAGATTGATGG + Intergenic
925138174 2:1533989-1534011 GGGGAGATTACACAGAGTGATGG - Intronic
925138865 2:1536760-1536782 GGGGAGATTACACAGAGTGATGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
933500016 2:83099822-83099844 ATGGAAATTACTTTGATTTATGG - Intergenic
934974775 2:98793375-98793397 ATGGAGATTACCTTGCTCGAAGG + Intergenic
935179688 2:100678254-100678276 AGGGAGCTCACATTTATTGTGGG - Intergenic
936653133 2:114453096-114453118 AGGGAGATTGGATGGTTTGAAGG + Intronic
936901999 2:117491647-117491669 AGGGAGTTTGCATAAATTGATGG - Intergenic
936912165 2:117604396-117604418 AGGGAGTTTACAGTGCTGGAAGG + Intergenic
938911826 2:135892587-135892609 AAGTAGATTACATATATTGATGG - Intergenic
938919714 2:135984557-135984579 AAGGAGATTAAATTGTGTGAAGG + Intronic
939985095 2:148822137-148822159 GAGGAGCTTACATTTATTGAAGG + Intergenic
940232233 2:151468043-151468065 TGGCAGATGACATTGATAGACGG + Exonic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943712627 2:191114269-191114291 AGGGACATTCTATTGATTTATGG - Intronic
943776458 2:191771972-191771994 ACGCAGATTTCATTTATTGAAGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944365453 2:198913738-198913760 AGGGAGATGACAGTGGGTGATGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
946508974 2:220334284-220334306 AGAGAGACTTCATTGTTTGAGGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947996911 2:234535520-234535542 AGGGGGATAAGAGTGATTGATGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169305523 20:4487060-4487082 AGGGAGAATACATGGGTTAATGG - Intergenic
1169782889 20:9328125-9328147 AGGGAGAGTACATCAAATGAGGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1176597172 21:8758113-8758135 AGGTAGATTTGATTGATGGATGG + Intergenic
1176630279 21:9130681-9130703 AGGTAGATTTGATTGATGGATGG - Intergenic
1176642990 21:9324057-9324079 AGGTAGATTTGATTGATGGATGG + Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1176972189 21:15279680-15279702 AGAGAGAGAACATTGCTTGAAGG - Intergenic
1179899485 21:44381563-44381585 AGGTAGATTAGATGGATGGATGG + Intronic
1180376307 22:12096979-12097001 AGGGAGATTTGATTGATTGATGG + Intergenic
1180421272 22:12816719-12816741 AGGTAGATTTGATTGATTGATGG - Intergenic
1181404818 22:22675714-22675736 AGGGAGATAACATTGGTGGGGGG + Intergenic
1181904636 22:26184585-26184607 AGGGAGTATACATTTCTTGAGGG - Intronic
1184420397 22:44378996-44379018 TGGTGAATTACATTGATTGATGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953824591 3:46239996-46240018 AGGGAGATAAGATTGACTGCTGG - Intronic
955589974 3:60524749-60524771 AGGGAGATTACATGGAGAAAAGG - Intronic
957116936 3:76038426-76038448 AATGAGATTACATTGTATGATGG + Intronic
957483157 3:80825056-80825078 TGGAAGATGACATTGATTCAAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957582348 3:82090351-82090373 AGGGAGGATACATTTATTAATGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959297606 3:104557032-104557054 AAGGAGAATACTTTGATTTAAGG + Intergenic
959434299 3:106295384-106295406 AAGGAGTTTACATTGAGTTAGGG + Intergenic
960827134 3:121800574-121800596 AGTGTGATGACATTGACTGATGG - Intronic
961225107 3:125237105-125237127 AGGGAGACTGAATTGACTGAAGG + Intronic
961929691 3:130519947-130519969 AAGGAGATTACAATGTTTGGCGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964141026 3:153399524-153399546 GGGTAGAAAACATTGATTGAAGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
1202743895 3_GL000221v1_random:80956-80978 AGGTAGATTTGATTGATGGATGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973320841 4:48808840-48808862 AGGGAGAAAATTTTGATTGAGGG - Intronic
973360471 4:49160335-49160357 AGGTAGATTTGATTGATGGATGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978616124 4:110598111-110598133 AGGGAAACTTCATTCATTGAAGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979111493 4:116762645-116762667 AGAGAGATTCCATTCATTAAGGG + Intergenic
980738588 4:136921525-136921547 AGGGAGATGCCATTGAATCATGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
982074773 4:151727468-151727490 AGGGAGGTTACAGTGGTTGGTGG + Intronic
982380922 4:154745907-154745929 AGGTAGATTACATTGTTTATGGG + Intronic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983157210 4:164363708-164363730 AGGGCATTTACATTGAATGACGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983973360 4:173901352-173901374 AGGGAGTTAACATTCAATGAGGG - Intergenic
984082965 4:175272152-175272174 AGGAAGAATACATTTATTTATGG + Intergenic
984857583 4:184208178-184208200 AGGGAGATTACATTCAAGCAGGG - Intronic
986035877 5:3938423-3938445 AATGAGATTAAGTTGATTGATGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987005467 5:13705536-13705558 AGGGAGATTATAATGATGGAAGG - Intronic
988994426 5:36701054-36701076 AGGGAGATGACAGGGATTGGAGG + Intergenic
990408170 5:55513140-55513162 AGGGAGACTTCATTGGTTAAGGG - Intronic
993482391 5:88439739-88439761 ATGGAGCTAACATTGACTGATGG - Intergenic
994257452 5:97616261-97616283 TGTCAGATTACATTGATAGAGGG + Intergenic
995222839 5:109670429-109670451 AGGGAGCTTACATTGTTTTAGGG + Intergenic
995449600 5:112286160-112286182 AGGGAAATGACATTGGTTGGGGG - Intronic
996994754 5:129681981-129682003 GGGGAGGTTACATTTATTAAAGG - Intronic
999863715 5:155678141-155678163 GGGGAGGATACAATGATTGAAGG + Intergenic
1000312945 5:160062622-160062644 AGGGCCATTACATGGATGGAGGG - Intronic
1000874486 5:166619192-166619214 ATGTAGGTTACATTTATTGAAGG - Intergenic
1007326855 6:41068796-41068818 ATGGAGATTTAATTGATTGGTGG - Intronic
1007335279 6:41151013-41151035 AGGGAGATGAAATAGAATGAGGG + Intronic
1009531771 6:64826899-64826921 AGGGAGACTACATTTATTTCTGG - Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1014518202 6:122405090-122405112 ATGGAGCTTACATTGAGTGGTGG + Intronic
1016119011 6:140324760-140324782 ATGGAGATTACAATGATTTTAGG + Intergenic
1016145372 6:140665577-140665599 AGTTAGATTTCATTGTTTGATGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1020345473 7:7157828-7157850 AAAGAGATCTCATTGATTGAAGG - Intronic
1020439826 7:8205611-8205633 AGGGATATTAGTTTGATTTATGG + Intronic
1021045028 7:15912301-15912323 AGGGAAAATGCATTGATTAATGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022785998 7:33637573-33637595 AGGGAGATTACATTGATAGAAGG - Intergenic
1023239934 7:38133382-38133404 AGGAAGCTTACAATGATTGGAGG + Intergenic
1024100267 7:46025110-46025132 AGGGAGATTTAATTGGTGGAGGG + Intergenic
1025319325 7:58076890-58076912 AGGAAAATTATATAGATTGATGG + Intergenic
1025967217 7:66285368-66285390 AGGGAGAATAGATAGAGTGAAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028849071 7:95515946-95515968 AGGGAGATAACATGGCATGAAGG - Intronic
1028869092 7:95747657-95747679 TTGGAGATTACAATAATTGAAGG + Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1033011912 7:137632315-137632337 AGACAGAATCCATTGATTGAAGG + Intronic
1033168270 7:139060422-139060444 TGAGAGATAATATTGATTGAAGG - Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034887439 7:154808699-154808721 TGGGAAATTACAGGGATTGACGG + Intronic
1036526833 8:9542584-9542606 AGGAAGCTAACATTAATTGAAGG + Intergenic
1036598579 8:10238364-10238386 AGGTAGATGACATAGTTTGAAGG - Intronic
1040654848 8:49495604-49495626 AAGGAGATTAAACTAATTGAAGG - Intergenic
1043578321 8:81683247-81683269 AGGGATAAGACATTGATTGAAGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044869889 8:96608296-96608318 GGAAAGATTACATTGATTTAAGG - Intronic
1045724774 8:105159609-105159631 AGGGAGATTTCAGTGATGAAAGG - Intronic
1045984655 8:108235636-108235658 AGGGAAATAAGATTGAGTGACGG + Intronic
1046504674 8:115122224-115122246 AGGGAGATTAAAGTGATTTGGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047256557 8:123217587-123217609 AGGGAGATCACATGGACAGAAGG + Intergenic
1048050940 8:130815477-130815499 AGGGCTATTACATGGATTAAAGG - Intronic
1048786605 8:138057212-138057234 AGGGAGCTTACATTTAATGTGGG - Intergenic
1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG + Intronic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052540109 9:29800233-29800255 AGGGGGATTATATTTATTCAAGG - Intergenic
1053240482 9:36490616-36490638 AGGAAGATGAGATTGATTCAAGG + Intergenic
1056050281 9:82761376-82761398 AGGGGAAATACATTGATTGAAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056478739 9:86979652-86979674 AGAGATAATACATTGCTTGAAGG + Intergenic
1058586888 9:106517377-106517399 AGGGACATTACATAGATAAAAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059841903 9:118226984-118227006 AGGGAGCTCACATTCAGTGATGG - Intergenic
1203689509 Un_GL000214v1:29427-29449 AGGTAGATTTGATTGATTGATGG + Intergenic
1203712527 Un_KI270742v1:110922-110944 AGGTAGATTTGATTGATGGATGG - Intergenic
1203538695 Un_KI270743v1:67283-67305 AGGGAGATTTGATTGATTGATGG + Intergenic
1203556125 Un_KI270743v1:209240-209262 AGGTAGATTTGATTGATTGATGG - Intergenic
1203646766 Un_KI270751v1:74626-74648 AGGTAGATTTGATTGATTGATGG - Intergenic
1187348491 X:18489566-18489588 AGGGAGATTCTATTGATTCCAGG + Intronic
1187889374 X:23919995-23920017 AGAGAGATTCCATTTATTGGGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1191688398 X:63915649-63915671 ATGGAGATGATATTAATTGATGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1194707974 X:97199165-97199187 GGGAAGATTACTTAGATTGAGGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1198872896 X:141194306-141194328 AAGGAGATCATTTTGATTGATGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1198968926 X:142258266-142258288 AAGGAGAATACATAGAGTGAGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1201166760 Y:11215935-11215957 AGGTAGATTTGATTGATGGATGG - Intergenic