ID: 945732355

View in Genome Browser
Species Human (GRCh38)
Location 2:213554180-213554202
Sequence AGTGTTGTTAGAGTCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945732355_945732358 7 Left 945732355 2:213554180-213554202 CCATCAAAGACTCTAACAACACT 0: 1
1: 0
2: 1
3: 17
4: 213
Right 945732358 2:213554210-213554232 ACTGTGGACATATACAGTGTTGG 0: 1
1: 0
2: 4
3: 2
4: 107
945732355_945732356 -9 Left 945732355 2:213554180-213554202 CCATCAAAGACTCTAACAACACT 0: 1
1: 0
2: 1
3: 17
4: 213
Right 945732356 2:213554194-213554216 AACAACACTTGCTGCCACTGTGG 0: 1
1: 0
2: 1
3: 17
4: 165
945732355_945732359 16 Left 945732355 2:213554180-213554202 CCATCAAAGACTCTAACAACACT 0: 1
1: 0
2: 1
3: 17
4: 213
Right 945732359 2:213554219-213554241 ATATACAGTGTTGGTTGCTGAGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945732355 Original CRISPR AGTGTTGTTAGAGTCTTTGA TGG (reversed) Intronic
904695759 1:32330350-32330372 AGTGTTACTAGAGTGTTAGAAGG + Intronic
906346478 1:45018646-45018668 AGTGTTGATATAGGCATTGATGG + Exonic
907985980 1:59530931-59530953 ACTGTTGTAAGAGACCTTGAAGG + Intronic
908443340 1:64177561-64177583 GGGGTTGTTATAGTCTTTCAAGG - Exonic
908463487 1:64368900-64368922 AGCTTTGTAAGAGTCTTTGAGGG - Intergenic
913475905 1:119237505-119237527 AGTCTTGTTAGCCTCTATGATGG - Intergenic
913556238 1:119969959-119969981 AATGTTGTTAGAGTTTCTAACGG - Intronic
914982589 1:152428064-152428086 AGTGTTGAGAGTGTATTTGAAGG + Intergenic
916832596 1:168508233-168508255 AGTGCTGTTTGAGTCTTCTATGG - Intergenic
917950505 1:180028001-180028023 AGTGTTCTGAAAGTCTTTGTAGG + Intronic
918023422 1:180717628-180717650 TATGTTTTTAGAGTCTGTGATGG + Intronic
918765642 1:188479830-188479852 AATGTTCTTTCAGTCTTTGAAGG + Intergenic
918965338 1:191339383-191339405 AGTGGTGTTAGAGGTTGTGAAGG - Intergenic
919199792 1:194341533-194341555 AGTGTTGTAAGAGGCTTGTATGG - Intergenic
921358161 1:214305850-214305872 ATTCTTGGTAGACTCTTTGAGGG + Intronic
922018847 1:221683423-221683445 GGTGTTGTTTGAGACTTTGGGGG - Intergenic
922315890 1:224441487-224441509 CCTGTTGTTAGAGTCTATGCAGG - Intronic
923649555 1:235861490-235861512 ACTGATCTTGGAGTCTTTGAGGG - Intronic
923962762 1:239103434-239103456 AGTGTTGTTGTAGGGTTTGAGGG - Intergenic
1063093227 10:2886455-2886477 ACTGTTGTTAGGGTCTCAGATGG + Intergenic
1065051826 10:21800367-21800389 AATGTTTTTAGAGCCTCTGAGGG - Intronic
1065420136 10:25534220-25534242 AGTGTTTTTACAGTCATTTAGGG + Intronic
1066808447 10:39290306-39290328 AGTTTTTTTAGAATCTGTGAAGG - Intergenic
1066810729 10:39330795-39330817 AGTGTTTGTAGAATGTTTGAAGG - Intergenic
1070500923 10:77071768-77071790 AGTGTTGCTAAAGTGATTGAAGG + Intronic
1070527788 10:77310129-77310151 AATGTGCTTAGCGTCTTTGAAGG + Intronic
1073934812 10:108618791-108618813 GGTGATGTTAGTGTCTGTGAAGG + Intergenic
1074435240 10:113428464-113428486 AGTGGTGTTAGAGACTTTCTAGG + Intergenic
1075203660 10:120427790-120427812 AGTGTTTTTAGAGGCATTAAAGG - Intergenic
1075946653 10:126439134-126439156 AGGGTTCTTAGGGTCTTTGATGG - Intronic
1079662306 11:23054291-23054313 AGTGTAATTCAAGTCTTTGAGGG - Intergenic
1079778447 11:24564659-24564681 ACTGTTGATAAAGTGTTTGAGGG + Intronic
1082295368 11:50435391-50435413 AGTTTTGGTAGAATCTGTGAGGG + Intergenic
1082297113 11:50454884-50454906 TGTTTTGTTAGAATCTGTGAAGG + Intergenic
1082313137 11:50679807-50679829 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1082313165 11:50680321-50680343 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1082313238 11:50681524-50681546 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1082566540 11:54686386-54686408 AGTTTTGTGAGAGACCTTGAAGG - Intergenic
1082574256 11:54783574-54783596 TGTTTTGGTAGAATCTTTGAAGG + Intergenic
1082574339 11:54784788-54784810 TGTTTTGTTAGAATCTGTGAAGG + Intergenic
1082595584 11:55076642-55076664 AGTTTTGGTAGAATCTGTGAGGG + Intergenic
1082596783 11:55091525-55091547 AGTTTTGGTAGAATCTGTGAAGG - Intergenic
1083088154 11:60171487-60171509 AGTTTTGTTTGAATATTTGATGG + Intergenic
1092903391 12:13080772-13080794 AGGCATGTTGGAGTCTTTGACGG + Exonic
1093937919 12:25020721-25020743 GCTGTTCTTAGTGTCTTTGACGG + Intergenic
1094164098 12:27424547-27424569 TTTGTTGTCATAGTCTTTGAGGG + Intronic
1095069136 12:37817846-37817868 AGTGTTTGTAGAATCTTTGAAGG + Intergenic
1095069195 12:37818852-37818874 AGTGTTGGTAGAATCTGTGAAGG + Intergenic
1095069363 12:37821599-37821621 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1095070149 12:37832697-37832719 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1095070414 12:37836827-37836849 AGTGTTTTTCGAATCTGTGAAGG + Intergenic
1095070449 12:37837393-37837415 AGTGTTTGTAGAATCTGTGAGGG + Intergenic
1095070707 12:37841122-37841144 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1095077480 12:37948920-37948942 AGTGTTTGTAGAATCTGTGAAGG - Intergenic
1095077588 12:37950631-37950653 AGTGTTTGTAGAATCTGTGAAGG - Intergenic
1095077776 12:37953212-37953234 AGTGTTTGTAGAGTCTGCGAAGG - Intergenic
1095078017 12:37956823-37956845 AGTGTTTGTAGAATCTTTGAGGG - Intergenic
1095503354 12:42865293-42865315 ATTGATCTTAGAATCTTTGAAGG - Intergenic
1095683298 12:45003664-45003686 AGTGTTGTTAAAGTCTAGGATGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098152598 12:67562699-67562721 AGTATAATTGGAGTCTTTGAAGG - Intergenic
1099552308 12:84062901-84062923 AGTGTTGTTTTAATGTTTGAAGG - Intergenic
1099777985 12:87158647-87158669 ACTGTTGTTAGAGACTTTACTGG - Intergenic
1102507923 12:113395565-113395587 AGTGTTGTGTCTGTCTTTGAAGG + Intronic
1105425559 13:20292159-20292181 AGGGTTTTCAGAGTTTTTGAAGG + Intergenic
1105743651 13:23355711-23355733 TGAGTTGTTTGAGTCTTTTAGGG - Exonic
1106990008 13:35407302-35407324 AGTGGTTTTATAGTCTTTAAGGG - Intronic
1109634349 13:65094229-65094251 AATGTTGTTAGAGTCTTCAGAGG - Intergenic
1110426789 13:75376233-75376255 AGTCCTGTGACAGTCTTTGAAGG - Intronic
1111335766 13:86820216-86820238 AGAGTTGTTAGAGTCTTTGGTGG - Intergenic
1112964546 13:105171351-105171373 AGTGCTGTTGGAGTCCTTGGTGG + Intergenic
1115274319 14:31590401-31590423 AGTGTTGGAAGGGTCATTGAGGG + Intronic
1115440550 14:33430025-33430047 GGTGTTGTTAGTGTCATTTATGG + Intronic
1116914150 14:50505941-50505963 AATGTTTTTAGACTATTTGATGG - Intronic
1117318895 14:54601819-54601841 AGTGATGTAAGAGTGTCTGAGGG - Intronic
1117424833 14:55582860-55582882 ACTGTTTTTAGTGACTTTGAAGG + Intronic
1120624049 14:86802729-86802751 ATTGTTGTGAGAGCCTTTGGAGG + Intergenic
1126233817 15:46358417-46358439 TGTGTTGTTCCAGTTTTTGAGGG - Intergenic
1127134131 15:55901791-55901813 ATTGTTGTGAGAGTGTCTGAAGG - Intronic
1127337708 15:58005979-58006001 AGTGTTCTCAGAGTCATTTACGG + Intronic
1127890983 15:63250777-63250799 AGTATGCTCAGAGTCTTTGAAGG + Intronic
1130570182 15:85035686-85035708 AGTTATGTTGGAGTTTTTGATGG + Intronic
1133429825 16:5726857-5726879 ATTGTTTTTAGTGTCATTGATGG + Intergenic
1133579930 16:7134353-7134375 AGCGATGTTAAAGTCTTTGACGG - Intronic
1136326422 16:29529303-29529325 AGTGATTTTTGAGCCTTTGAAGG - Intergenic
1136441112 16:30269288-30269310 AGTGATTTTTGAGCCTTTGAAGG - Intergenic
1137040076 16:35602802-35602824 AGTGTTCATATAGTCTTTGAGGG + Intergenic
1137375476 16:47948370-47948392 AGGGTATGTAGAGTCTTTGAAGG - Intergenic
1138928503 16:61622091-61622113 AGTGGGGTTAGAGGTTTTGAGGG - Intergenic
1140937047 16:79682440-79682462 AGTTTTGTAATAGTATTTGAAGG - Intergenic
1143072651 17:4310150-4310172 AGTATTGATAGAGACCTTGAAGG - Intronic
1145290914 17:21545129-21545151 AGAGGTGTTTGGGTCTTTGAGGG + Intronic
1147197669 17:38778463-38778485 AGGCTTGTTAGAGTCCTAGAGGG + Intronic
1148965004 17:51427728-51427750 AGTGTTGCTAGGTTCTTTGGAGG + Intergenic
1150134374 17:62688021-62688043 ACTGTTGTCATAGCCTTTGACGG + Intronic
1155271495 18:24145708-24145730 AGTGTTGGGAGAGGCTTTGCAGG + Intronic
1156263895 18:35468911-35468933 AGTGTTTCTAGAGTCTGGGAAGG - Intronic
1156674256 18:39508466-39508488 ATTTATGTTAGAGTCTTTGCAGG + Intergenic
1156875909 18:42011249-42011271 ATGGTTGTGAGAGTCTTAGATGG + Intronic
1157631070 18:49096439-49096461 AGTGTTGTTACTGTTTTTGGGGG - Intronic
1157728367 18:49982897-49982919 AGTGTCCTTAGAGCCTTGGAGGG + Intronic
1158967733 18:62637248-62637270 ACTTCTGTTAGGGTCTTTGAGGG - Intergenic
1159214727 18:65376490-65376512 AGTGTTTTTAGAGCCTGGGAAGG - Intergenic
1159367301 18:67484616-67484638 AGTGTTGTCAGAATATTTGGTGG - Intergenic
1164334272 19:24295882-24295904 GGTTTTGGTAGAGTCTGTGAAGG + Intergenic
1164337558 19:24344269-24344291 TGTATTGTTAGAATCTGTGAAGG + Intergenic
1164338757 19:24363856-24363878 TGTGTTGGTAGAATCTCTGAAGG + Intergenic
1164363820 19:27550475-27550497 TATGTTGTTAGAATCTGTGAAGG + Intergenic
1164365208 19:27572775-27572797 TGTTTTGTTAGAATCTGTGAAGG + Intergenic
1168296615 19:55380180-55380202 AGTGTGGTCTGAGTCTTTGGTGG + Intronic
925731140 2:6920023-6920045 AGTGTGGTTTGGGACTTTGAAGG + Intronic
926955221 2:18287537-18287559 AGTTATGTTAGGGTCTTTGAGGG + Intronic
933826165 2:86162969-86162991 AGTGGTATTAGAGTGTTAGAGGG - Intronic
940743068 2:157534383-157534405 AGTTTTGGTAGAATTTTTGAAGG - Intronic
942479948 2:176374364-176374386 AATGTAGTTACAGTATTTGATGG + Intergenic
943461691 2:188176931-188176953 AGGGTTCTTTTAGTCTTTGAAGG - Intergenic
944763758 2:202843431-202843453 AGAGTTGTTGGGGTCTTTGGTGG + Intronic
945732355 2:213554180-213554202 AGTGTTGTTAGAGTCTTTGATGG - Intronic
1171112294 20:22495222-22495244 AGTGTTGTTAGAGTCAGGTATGG - Intergenic
1182999111 22:34840062-34840084 AGAGTGTTTAGAGTCTTTGGAGG + Intergenic
949140786 3:630289-630311 AGTGTGGTAGGTGTCTTTGAGGG + Intergenic
950349930 3:12339832-12339854 GGCTTTGTTAGAGTATTTGAGGG - Intronic
956356339 3:68397048-68397070 AGTTTTGTTTAAGTCTTTCATGG - Intronic
956590657 3:70911271-70911293 AATGTTGGTATTGTCTTTGAAGG - Intergenic
957196010 3:77069756-77069778 TGTCTTGATAGAGTCCTTGAGGG + Intronic
957492585 3:80948142-80948164 GCTTTTGTTAGAGTCTATGAAGG - Intergenic
963551146 3:146724707-146724729 ATTGATCTTAGAGTCTTTGCTGG - Intergenic
963932584 3:151019352-151019374 AGTCTTGTTAGTCTCTTTAATGG + Intergenic
965565325 3:170110189-170110211 AGTGTTTTTGGAGACTTTGATGG - Intronic
966285909 3:178295199-178295221 AGTGTAGTTATAGTCTTTTCAGG + Intergenic
967441914 3:189518036-189518058 GGTGTTGTTAGAAGCTGTGATGG - Intergenic
967462820 3:189765917-189765939 AGTGTTCTTATAGTCTGTAATGG + Intronic
970888226 4:21011373-21011395 ATTGTTCTGAAAGTCTTTGAAGG + Intronic
972653613 4:41044687-41044709 ATTGTTCTTAGACTTTTTGACGG - Intronic
973014420 4:45119509-45119531 AATCATGTTTGAGTCTTTGAAGG + Intergenic
973713251 4:53650172-53650194 TGTGTTGTCACTGTCTTTGATGG - Intronic
975912630 4:79284994-79285016 AGTGTTGGTAGATTCTTTAGTGG + Intronic
979338688 4:119493808-119493830 AGTGGTGTGGGAGTCTGTGAAGG + Intergenic
979593096 4:122503148-122503170 AGTTTTGTTGGAGTTTTTCAAGG + Intergenic
982006190 4:151065053-151065075 AGTTTTATAAGAGACTTTGAAGG - Intergenic
983416458 4:167461490-167461512 AGTGCTGTTAAAATTTTTGAAGG + Intergenic
986088461 5:4477926-4477948 AATGTTTTTAGTGGCTTTGATGG + Intergenic
986236761 5:5917916-5917938 AATGTTGTGAGGGTTTTTGAGGG - Intergenic
988987456 5:36634599-36634621 AGTATTGTTAGAGTTTTCTAAGG - Intronic
989158521 5:38367796-38367818 AGTGTTTTTAGAGTCTCTTCAGG - Intronic
989832432 5:45937379-45937401 TGTGTTGGTAGACTCTCTGAAGG + Intergenic
989837835 5:46016383-46016405 AGTTTTCATAGAGTCTGTGAAGG + Intergenic
989840385 5:46058765-46058787 AGTTTTGGTAGAATCTGTGAAGG + Intergenic
989848970 5:46183956-46183978 TGTTTTGGTTGAGTCTTTGAAGG + Intergenic
990184993 5:53202585-53202607 ACTATTGTTAAAGACTTTGAAGG - Intergenic
990352209 5:54930094-54930116 AGTGTCTTTAGAGTATTAGAAGG + Intergenic
991263601 5:64691303-64691325 AGTATTTTAAGACTCTTTGAGGG + Intronic
991647569 5:68816553-68816575 AGGGTTTTTAGAGTCTATGGGGG - Intergenic
997726180 5:136121553-136121575 AGGGTGCTAAGAGTCTTTGAAGG + Intergenic
998264217 5:140655116-140655138 AGTCTTATTAGAGTATTTTATGG - Intronic
999508558 5:152223876-152223898 AGTGTTTTTAGAGTGCATGAGGG + Intergenic
1000614473 5:163412273-163412295 AGTGTGGATAGAGTTTCTGAGGG - Intergenic
1004845545 6:19638044-19638066 AGTGTTGATATAGTCATTGTTGG - Intergenic
1005621496 6:27624517-27624539 AGTGTTCTTACGGTCTGTGATGG + Intergenic
1008041487 6:46805874-46805896 TGTGCAGTTAGAGTCTCTGATGG - Intronic
1009251656 6:61308561-61308583 AGTTTTTGTAGAATCTTTGAAGG + Intergenic
1009254030 6:61352776-61352798 AGTGTTTCTAGAATCTGTGAAGG + Intergenic
1009254051 6:61353117-61353139 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1009254095 6:61353805-61353827 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1009254114 6:61354148-61354170 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1009258716 6:61454597-61454619 AGTGTTTCTAGAATCTGTGAAGG + Intergenic
1009258737 6:61454938-61454960 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1009258781 6:61455626-61455648 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1009258800 6:61455969-61455991 AGTGTTTGTAGAATCTGTGAAGG + Intergenic
1011711745 6:90061865-90061887 AGTGGTGTCAGAGACTTTAATGG + Intronic
1012188049 6:96246324-96246346 TGTGTTCTTAGAGACTTTGCTGG + Intergenic
1014562558 6:122908671-122908693 AATGTTGTAAGAGTCCTGGATGG - Intergenic
1014583831 6:123172600-123172622 TGTGTTGTTTGATTCTCTGAAGG + Intergenic
1014644146 6:123953499-123953521 GGTGTTGTTAGTGGCTGTGATGG + Intronic
1015854579 6:137609807-137609829 AGTGTTGTTGGAGTCATTCCTGG + Intergenic
1016439787 6:144071110-144071132 AGTGGTCTTAGTTTCTTTGACGG + Intergenic
1018402428 6:163437931-163437953 AGTGTTGGAAAAGTATTTGACGG + Intronic
1018943250 6:168325056-168325078 AAAGTTGTTAGATTCTTTGTTGG - Intergenic
1020614630 7:10442580-10442602 AGTGTTGTTGGAATATTTGGTGG - Intergenic
1020666533 7:11050956-11050978 AGTAGTGTTAGGGTCCTTGAAGG + Intronic
1024616507 7:51118745-51118767 AGTGTTGGTGGAGTCTGGGATGG + Intronic
1025573282 7:62602145-62602167 AGTGTTTTTAGAATCTGGGAAGG - Intergenic
1025574459 7:62618581-62618603 AGTGTTTGTAGAATCTGTGAAGG - Intergenic
1025574758 7:62622313-62622335 AGTGTTTGTAGAATCTGTGAAGG - Intergenic
1025579552 7:62694798-62694820 TGTTTTGGTAGAGTCTGTGAAGG - Intergenic
1025580302 7:62705894-62705916 AGTTTTGATAGAATCTGTGAAGG + Intergenic
1025583796 7:62755213-62755235 TGTTTTGTTAGAATCTGTGAAGG + Intergenic
1025584018 7:62758689-62758711 TGTTTTGGTAGAATCTTTGAAGG + Intergenic
1025592706 7:62882838-62882860 AGTTTTTTTAGATTCTGTGAAGG + Intergenic
1025593539 7:62895292-62895314 TGTTTTGTTAGAGTCTGTGAAGG - Intergenic
1025599899 7:62983509-62983531 TGTTTTGCTAGAATCTTTGAAGG + Intergenic
1028669044 7:93380034-93380056 AGAGTTGTTCTAGTCTGTGAGGG - Intergenic
1029357790 7:100065588-100065610 AGTGTCTTTTGCGTCTTTGAGGG + Intronic
1030789144 7:113702174-113702196 TGTCATGTAAGAGTCTTTGAGGG + Intergenic
1031681260 7:124677670-124677692 TGTGTTGTTTCAGTTTTTGATGG + Intergenic
1032173693 7:129607063-129607085 AGAGATGTTAGTGTCGTTGACGG - Intergenic
1032891004 7:136194606-136194628 AGTGTTATTAGAGGCTGGGAAGG - Intergenic
1032924227 7:136584535-136584557 AGCTTTGTTAGTTTCTTTGAAGG + Intergenic
1037977139 8:23221748-23221770 AGTGTTATTAGAGATTTTCAAGG - Intronic
1039255062 8:35709832-35709854 AGTTTGGTTGGAGTCTCTGAGGG + Intronic
1040327099 8:46353593-46353615 AGTTTTAGTAGAGTCTGTGAAGG - Intergenic
1040347240 8:46516760-46516782 ACTGTTCTTAGAATCTGTGAAGG + Intergenic
1043708365 8:83380880-83380902 AGTGTTGCTGGGGTCTTTGGTGG - Intergenic
1048639504 8:136337720-136337742 ACTGTTGTTAGGGTCATTGCTGG - Intergenic
1048643948 8:136396599-136396621 CTTGTTGATTGAGTCTTTGAAGG + Intergenic
1048787874 8:138070528-138070550 AGTGTTGGTAGAGGCATGGATGG + Intergenic
1048821740 8:138386476-138386498 AGTTGTGCTAGAGTCTTGGAGGG + Intronic
1051885986 9:21893599-21893621 AGTGTTCATTTAGTCTTTGAGGG - Intronic
1052551326 9:29953085-29953107 AGTTTTGGTAGTGTCTTTCAAGG + Intergenic
1053585336 9:39452148-39452170 AGTGTTATCAGAGTCCTTGTGGG - Intergenic
1054580979 9:66913076-66913098 AGTGTTATCAGAGTCCTTGTGGG + Intronic
1054829590 9:69608679-69608701 AGTGGTGATAAAGTCTTAGAGGG + Intronic
1056299757 9:85228924-85228946 GATGTTGTTAGAGTGTTAGATGG - Intergenic
1057325185 9:94056542-94056564 AGTGCTGTGAGAGTCTGGGAAGG + Intronic
1058908356 9:109498823-109498845 AGTGAAGTTCGAGTGTTTGATGG - Intergenic
1059510302 9:114839219-114839241 AGTGTTGAAAGAGTATTTGAGGG + Intergenic
1059801993 9:117759325-117759347 AGTGTTTCTAGAGTCTTTGTTGG + Intergenic
1062532541 9:137008208-137008230 AGACTTGCTAGAGTCTTTGAGGG - Intronic
1191237663 X:58148426-58148448 TGTTTTGTTACAGTCTATGAAGG + Intergenic
1191575265 X:62696916-62696938 AGTGTTTGTAGAATCTGTGAAGG - Intergenic
1191575392 X:62698893-62698915 AGTGTTTGTAGAATCTGTGAAGG - Intergenic
1192762325 X:74106014-74106036 AGTGTTGCTAGAGCTTCTGATGG + Intergenic
1192847462 X:74921282-74921304 AGTGATGATAGAGTCTTTTATGG - Intronic
1197345975 X:125326234-125326256 AGGCCTATTAGAGTCTTTGAGGG + Intergenic
1197918188 X:131558732-131558754 TGAGGTGTTAGAGTCTTTCAAGG - Intergenic
1199483085 X:148319649-148319671 AGTGTTGTTTTAGTATTTTAAGG - Intergenic
1199549198 X:149040153-149040175 AGTGTAATTTGAGTCTTTGAGGG - Intergenic
1200277224 X:154745689-154745711 AGTGTCGTTAGTGTCTTTCAAGG - Intronic
1201543512 Y:15134787-15134809 CGGGTTGTTAAAGTCTTTTATGG - Intergenic
1202259595 Y:22956628-22956650 GGTGATGTGAGAGTTTTTGAGGG + Intergenic
1202412581 Y:24590372-24590394 GGTGATGTGAGAGTTTTTGAGGG + Intergenic
1202458199 Y:25079698-25079720 GGTGATGTGAGAGTTTTTGAGGG - Intergenic