ID: 945734604

View in Genome Browser
Species Human (GRCh38)
Location 2:213584121-213584143
Sequence TTTGGCCAATACTACATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945734604_945734606 15 Left 945734604 2:213584121-213584143 CCTAACATGTAGTATTGGCCAAA 0: 1
1: 0
2: 0
3: 15
4: 127
Right 945734606 2:213584159-213584181 TTTATTTTGCATTTCTTCATTGG 0: 1
1: 0
2: 7
3: 146
4: 1256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945734604 Original CRISPR TTTGGCCAATACTACATGTT AGG (reversed) Intronic
902664035 1:17925036-17925058 TTTGCCCAAGACTACATATTGGG - Intergenic
908653816 1:66366002-66366024 TTTGGCAAATACAATATGTAAGG + Intronic
908715824 1:67068256-67068278 TTTGGCCAATTTTTCCTGTTTGG + Intergenic
909249548 1:73334343-73334365 TTAGCCCATTACTAGATGTTGGG + Intergenic
909467793 1:75992797-75992819 TTTTGCCAATAATACATTTATGG + Intergenic
911471075 1:98318868-98318890 TTTAGACAATGCTACATATTAGG - Intergenic
913963904 1:143359157-143359179 ATTGGCATTTACTACATGTTAGG - Intergenic
914058268 1:144184761-144184783 ATTGGCATTTACTACATGTTAGG - Intergenic
914120880 1:144781610-144781632 ATTGGCATTTACTACATGTTAGG + Intergenic
918539530 1:185614720-185614742 TTTACCCAATACGTCATGTTTGG + Intergenic
919652143 1:200160731-200160753 TTTAGCCCATACTAGATGTCTGG - Intronic
922096126 1:222444444-222444466 TTTGGGCTAAACTACATGCTTGG - Intergenic
922613658 1:226947826-226947848 TTGGGCCCATACTACATGCCAGG - Intronic
924198329 1:241633856-241633878 TTTGGCCATTACTACATTATTGG + Exonic
924802759 1:247339553-247339575 ATTGGCAAATACTAGATGTGAGG - Intergenic
1063869070 10:10398826-10398848 ATTGGCAAACACTACATGTTGGG - Intergenic
1065484494 10:26224517-26224539 TGTGGCCATTACTACATTTCAGG + Exonic
1066187103 10:33020957-33020979 TTTGGCCAATGGTACAAGATTGG - Intergenic
1068038676 10:51794275-51794297 TCTGTCCATTACTACATGTAGGG - Intronic
1069283314 10:66682501-66682523 TTAATCTAATACTACATGTTTGG + Intronic
1073858524 10:107707526-107707548 TTTGGCCAATAGAACAGGTGTGG + Intergenic
1079412191 11:20199536-20199558 TTTGGCCAAAACTCAATGATTGG + Intergenic
1080262263 11:30362106-30362128 TTGGGCCATTACTACATGCCAGG - Intergenic
1082213146 11:49530973-49530995 ATTGGCCATTTCTACATCTTTGG + Intergenic
1084131139 11:67135778-67135800 TGTGGACAGTGCTACATGTTGGG + Intronic
1085779207 11:79393275-79393297 TTTGCCCAAAACTACATGACTGG + Intronic
1085982275 11:81738830-81738852 TTTGGCAAATTCTGCTTGTTAGG + Intergenic
1086150701 11:83607194-83607216 ATTGGCCAAAACTCCATGATTGG + Intronic
1086636453 11:89093544-89093566 ATTGGCCATTTCTACATCTTTGG - Intergenic
1089409663 11:118229970-118229992 TTAGGCAAAGACCACATGTTAGG + Intronic
1092853353 12:12650563-12650585 ATTGGCAAATACTACAAATTAGG - Intergenic
1100188945 12:92169906-92169928 TATGGTCAATAATTCATGTTTGG - Intergenic
1100455074 12:94743625-94743647 TATGGCCATGACTAAATGTTTGG + Intergenic
1101249794 12:102921170-102921192 TTTGGAGAATACCACATATTAGG - Intronic
1101368614 12:104101946-104101968 TTTTGCATATACTACATTTTAGG + Exonic
1101506453 12:105351261-105351283 TTTGGCCAATCCTTCTGGTTTGG - Intronic
1107190667 13:37581026-37581048 TTTGGCCAACACTATCTGTAAGG + Intronic
1107822226 13:44296280-44296302 TTTAGCCAATACTAACTGTGGGG + Intergenic
1108994182 13:56704459-56704481 TTAGGCCAATAACACATTTTGGG + Intergenic
1109913826 13:68953554-68953576 GTTGGCAAACACTACAGGTTGGG + Intergenic
1113028569 13:105969027-105969049 TTTGGCCAATGGCACATTTTTGG - Intergenic
1113105157 13:106763999-106764021 ATTGTCCAATAATAAATGTTGGG + Intergenic
1115449910 14:33535565-33535587 TTGGGCCACTACTATGTGTTGGG - Intronic
1116606738 14:47008313-47008335 TTCTGCCAACACTACCTGTTAGG - Intronic
1117591354 14:57271390-57271412 ATTGGCAAAAATTACATGTTAGG - Intronic
1118897895 14:69962034-69962056 TTTGGCCATTTCTATATCTTTGG + Intronic
1121915051 14:97831138-97831160 TTCAGTCAATACTACATGCTAGG + Intergenic
1123152834 14:106199377-106199399 TTTCGCCAATACTACTTGGAAGG - Intergenic
1126228376 15:46296991-46297013 TTTTGCCAATTCTGCATTTTTGG + Intergenic
1130571056 15:85044204-85044226 TTTGCCCAACACTACGGGTTTGG + Intronic
1134306213 16:13034693-13034715 TTTGGCCAATAGAATATGGTAGG + Intronic
1134847162 16:17449654-17449676 TTAAGCACATACTACATGTTAGG - Intronic
1135586329 16:23674368-23674390 TTTGGCAAATATTAGAAGTTAGG - Exonic
1138954594 16:61955302-61955324 TTTGGCCAAAACTCAATGATTGG - Intronic
1139499015 16:67345368-67345390 TTTGCCCAATACTAAATTTCAGG - Intronic
1144446369 17:15333469-15333491 TTTGGCCAGTATAACACGTTTGG - Intronic
1144605100 17:16658028-16658050 TTTGGCCAATTTTTCCTGTTTGG - Intergenic
1149037301 17:52149258-52149280 TTTGTCCAATACTTCATGCCTGG - Intronic
1155968991 18:32063410-32063432 TTTGGACAATACCAAATGTTGGG + Intronic
1156548693 18:37991582-37991604 TTTGGGAAATACTACATGGTAGG + Intergenic
1162195429 19:8980928-8980950 CTTGGCCAGTCCTACATCTTCGG - Exonic
1202697749 1_KI270712v1_random:137418-137440 ATTGGCATTTACTACATGTTAGG - Intergenic
934278922 2:91594414-91594436 ATTGGCATTTACTACATGTTAGG - Intergenic
939737580 2:145867674-145867696 TTTGTCCAATAATATATATTAGG - Intergenic
941025932 2:160456212-160456234 TTTAGCACACACTACATGTTAGG + Intronic
941481837 2:166025036-166025058 TTTGGCAAATAATCCTTGTTAGG - Intronic
943000109 2:182316435-182316457 TTTGCCCAAGACTATATGTTTGG + Intronic
945734604 2:213584121-213584143 TTTGGCCAATACTACATGTTAGG - Intronic
947955624 2:234188029-234188051 ATTGGCAAATACTACAAGTCAGG - Intergenic
1170336077 20:15271605-15271627 TTGAGCCCATACTACATGTCAGG - Intronic
1170363514 20:15574180-15574202 TTGGGCCAATACTGCATACTTGG + Intronic
1170399615 20:15966760-15966782 CTTGGCCATTATTAAATGTTTGG + Intronic
1170995423 20:21351378-21351400 TTTGGCCATTTCTAAATCTTTGG + Intronic
1173097911 20:40054586-40054608 TTTGGCCTATACTAGATTATGGG - Intergenic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
1183777661 22:39977609-39977631 ATTGGCAAATACCACAAGTTAGG - Intergenic
949237607 3:1829100-1829122 TTTGACCTATGCTAGATGTTAGG + Intergenic
949477377 3:4461443-4461465 TGTGGCAAATACTTCCTGTTAGG + Intronic
952786796 3:37163744-37163766 TTTGGCCAAAAATACATGTATGG + Intronic
959346393 3:105200447-105200469 TTTGGCCAATAAAACATGGGAGG + Intergenic
960429667 3:117553561-117553583 TTTGGCCTATCCTACACGTTGGG - Intergenic
961400011 3:126633730-126633752 GTTTGCTAATTCTACATGTTTGG - Intronic
964603916 3:158538254-158538276 TTGAGCATATACTACATGTTAGG + Intronic
964857020 3:161157565-161157587 TTTTGCCAATACTACTTCATAGG - Intronic
965552403 3:169981243-169981265 TTTGGCCCATACTACTTATTTGG - Intronic
966401859 3:179555629-179555651 TGTAGCGCATACTACATGTTAGG + Intergenic
967518847 3:190404120-190404142 CTTGGCCAATATTACATATTAGG - Intronic
969031869 4:4222079-4222101 ATTGGCATTTACTACATGTTAGG + Intronic
970815253 4:20148647-20148669 TTAGGTCTATGCTACATGTTAGG - Intergenic
976985777 4:91295182-91295204 TATGACCAATACTACCTTTTTGG + Intronic
977323911 4:95550670-95550692 TTTGGCAAATACTACCTTTTCGG - Intergenic
978326246 4:107560457-107560479 TTTGGCCAAAACTCAATGATTGG - Intergenic
978851435 4:113341777-113341799 TTTGGCAAACACTACAAATTTGG - Exonic
982973116 4:162016213-162016235 TTTGGCCAAAACTAAATTCTGGG + Intronic
984361889 4:178744488-178744510 TTTGGCCATTATTACATGTATGG - Intergenic
985385515 4:189443155-189443177 TTTTGCCAATTATAAATGTTTGG - Intergenic
992404602 5:76445168-76445190 ATTGGCCAATCCCACAGGTTGGG + Intronic
993778608 5:92035823-92035845 TTTGTCCCATACTTCAGGTTTGG + Intergenic
994304528 5:98186823-98186845 TTTGGGCAATCGTACATGATTGG + Intergenic
994675744 5:102819697-102819719 TTTGGCCAGTACTATATATAGGG + Intronic
999744140 5:154578692-154578714 TTAGGCCAATTTTACAGGTTAGG - Intergenic
1001920780 5:175597699-175597721 CATGGCAAATACTACATGATGGG + Intergenic
1004332342 6:14733353-14733375 TTTTGCCATTTCTAAATGTTAGG + Intergenic
1004407673 6:15349554-15349576 TTTGGCCAAAACTACAATTATGG - Intronic
1007965756 6:46002413-46002435 TTGGGCCAATGCCACATCTTGGG + Intronic
1008894555 6:56537860-56537882 ATTGGCAAATATTACATGCTAGG - Intronic
1013576350 6:111486759-111486781 ATTGGCCAATGCTACAAATTAGG - Intergenic
1016762934 6:147759446-147759468 TTTGGCCAATAACTCTTGTTTGG + Intergenic
1016850586 6:148614719-148614741 ATTGGCCAAAACTCCATGATTGG - Intergenic
1018489464 6:164276680-164276702 GTTGGCCGATGTTACATGTTTGG + Intergenic
1019132343 6:169886246-169886268 ATTGGCAAATACTACAAGTCAGG + Intergenic
1020158956 7:5753152-5753174 TTTTGCCAATAACACATTTTGGG + Intronic
1020497203 7:8870768-8870790 TTTTGCCAATTCTACCTTTTGGG - Intergenic
1020772205 7:12408813-12408835 TTTGGCAAATATTACTTATTGGG - Intergenic
1021461138 7:20888463-20888485 CCTGGTCTATACTACATGTTTGG - Intergenic
1021555995 7:21918688-21918710 TTTTGCCAAGACTACTTTTTAGG + Intronic
1022746169 7:33174593-33174615 TTTGGCCAAAACTCGATGATTGG + Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1029791345 7:102846090-102846112 TTTAGCCCTTACTACATGTCAGG - Intronic
1029972589 7:104803739-104803761 TTTTGCCCTTATTACATGTTAGG - Intronic
1030661809 7:112227510-112227532 ATTGGCCAAAACTGCATGATTGG + Intronic
1030670185 7:112326546-112326568 TTTGACTAAAACTACTTGTTGGG - Intronic
1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG + Intronic
1037144064 8:15552304-15552326 ATTGGTGAATACTACATGTTAGG + Intronic
1038903446 8:31870626-31870648 TTTGGCCAAAACTATATGATTGG - Intronic
1043150530 8:76709173-76709195 TTTGTCTAATACTATGTGTTTGG + Intronic
1043304206 8:78773727-78773749 TGTGGCGATTAGTACATGTTTGG + Intronic
1044670714 8:94677713-94677735 CTTGGCCACTACCACATATTAGG - Intronic
1044686897 8:94834726-94834748 TTTAGTCCACACTACATGTTTGG - Intronic
1046781899 8:118224465-118224487 TGTGACCAAAACTACATCTTTGG - Intronic
1048106316 8:131414159-131414181 CTTGGCCACTACTGCATGCTGGG - Intergenic
1050025101 9:1326052-1326074 TTTGGCCAAAACTCCGTGATTGG - Intergenic
1052796175 9:32925553-32925575 TTCGGCCAAGACTACATGCTTGG + Intergenic
1052962592 9:34313121-34313143 TTTGCCCAATACAATATGGTAGG + Intronic
1053554633 9:39122668-39122690 CTTTGCCAATACAACATGTCTGG + Intronic
1053818755 9:41942924-41942946 CTTTGCCAATACAACATGTCTGG + Intronic
1054109017 9:61086582-61086604 CTTTGCCAATACAACATGTCTGG + Intergenic
1054611840 9:67244543-67244565 CTTTGCCAATACAACATGTCTGG - Intergenic
1055375139 9:75640789-75640811 TTTGGCCAGTAATTCATGTGTGG + Intergenic
1056098949 9:83282134-83282156 TTTGCCCAATGTTACATGGTTGG - Intronic
1188548806 X:31338974-31338996 ATTGGCAAATACTACAAATTGGG - Intronic
1197460395 X:126734456-126734478 TTTGGCTAATCATACATGTCCGG - Intergenic
1199042977 X:143136193-143136215 TTTTCCCAATACATCATGTTTGG + Intergenic