ID: 945742912

View in Genome Browser
Species Human (GRCh38)
Location 2:213685301-213685323
Sequence CTTGTAAGAAGGAGAAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945742907_945742912 -1 Left 945742907 2:213685279-213685301 CCAATCCAATATGACGCGTGTTC 0: 1
1: 0
2: 11
3: 40
4: 136
Right 945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 398
945742906_945742912 0 Left 945742906 2:213685278-213685300 CCCAATCCAATATGACGCGTGTT 0: 1
1: 2
2: 67
3: 525
4: 1396
Right 945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 398
945742908_945742912 -6 Left 945742908 2:213685284-213685306 CCAATATGACGCGTGTTCTTGTA 0: 1
1: 0
2: 8
3: 106
4: 706
Right 945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 398
945742905_945742912 1 Left 945742905 2:213685277-213685299 CCCCAATCCAATATGACGCGTGT 0: 1
1: 2
2: 35
3: 473
4: 1366
Right 945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945742912 Original CRISPR CTTGTAAGAAGGAGAAAGGT GGG Intronic
900550688 1:3252904-3252926 CAGGAAAGAAGGAGAAAGGCAGG + Intronic
900994085 1:6110925-6110947 CTTGTAAGAAGAGGAAAATTTGG + Intronic
901110323 1:6788178-6788200 CGTGAAAGAGGGAGAAAGGGAGG - Intronic
902178151 1:14666992-14667014 CTTATAAGAAGAGGACAGGTTGG - Intronic
902514740 1:16984008-16984030 CTTGAAAAAAGGAGGGAGGTTGG + Intergenic
902642989 1:17778673-17778695 CTTGTACGGAGAAGAAAGATAGG - Intronic
904409780 1:30318595-30318617 CTTCTGACAGGGAGAAAGGTGGG - Intergenic
904639611 1:31914977-31914999 CTTGTAGGAGGCAAAAAGGTGGG - Intronic
905336113 1:37245631-37245653 CTTGTAAGAGGGAGACAGGAGGG + Intergenic
906746523 1:48225925-48225947 GTGGTGAGAAGGAGAAGGGTGGG - Intronic
906857773 1:49327088-49327110 CTTGTAAGAGGGAGACTGGAAGG - Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
908546195 1:65164424-65164446 ATTGAAAGAGAGAGAAAGGTAGG - Intronic
908608951 1:65834507-65834529 ATTTTAAGAATGAGAAAGGGCGG + Intronic
908619378 1:65960370-65960392 CTTTTGAGAAAGAGAAAGTTAGG + Intronic
908746387 1:67380841-67380863 CTTATAAGAAGGAGACAATTTGG - Intronic
910907648 1:92198055-92198077 CTTGTAATAAGAAAAAAGGCTGG + Intergenic
910931518 1:92447013-92447035 CGTATAATTAGGAGAAAGGTTGG + Intergenic
911541898 1:99166345-99166367 CATGGAAGGAGGAGAAAGGGGGG - Intergenic
911907243 1:103586069-103586091 TTTGTAAGGAAGAGAAAGGAGGG + Intergenic
913262229 1:117009827-117009849 CTTGTAAGTAGGAGAAAGAAAGG - Intronic
914217299 1:145643715-145643737 GTTGTAAGTAGTAGAAAAGTAGG + Intronic
914469868 1:147966400-147966422 GTTGTAAGTAGTAGAAAAGTAGG + Intronic
915008953 1:152666733-152666755 GTAGGAAGAAGGAGAAAGGGTGG + Intergenic
916292761 1:163184650-163184672 CTTGTAAGAAGAAGGCAGGAGGG + Intronic
916516097 1:165517991-165518013 CCTGGGAGAAGGAGAGAGGTGGG + Intergenic
917482055 1:175420588-175420610 CTTTTCAAAAGGGGAAAGGTAGG - Intronic
917951912 1:180047260-180047282 AATGTAAGGAGGAGAAAGCTTGG + Intronic
918396768 1:184121408-184121430 CTTGAAAGATAGAGAAAGGGAGG - Intergenic
918422683 1:184379987-184380009 ATTATAAAAAGGAGAAAGGAAGG - Intergenic
918554999 1:185788313-185788335 TTTGTAAGAAGGAGAAGGTTGGG - Intronic
918917378 1:190660914-190660936 CATGTTAGAAGCAGAAAGTTAGG - Intergenic
920014297 1:202893682-202893704 CTTCTAATTAGGAGAAAGGGAGG + Intronic
920408366 1:205737563-205737585 CTTGTAAGATGGAGAAATACAGG - Intronic
920504021 1:206504091-206504113 CTAGTAAGAAGGAAAACGGAAGG - Intergenic
921612755 1:217231651-217231673 CTTGTAAGAAGAAGAGATTTGGG + Intergenic
922945451 1:229509965-229509987 CTTGTAAGAATGAAACAGGGAGG - Intergenic
923276823 1:232403731-232403753 CTTCTGAGAAGGAGAAAGCATGG + Intronic
924146713 1:241084124-241084146 CATGTAAGAAGGAGCAAACTTGG - Intronic
924695198 1:246392218-246392240 CATGTAGGAAGGACCAAGGTTGG + Intronic
1063661672 10:8038400-8038422 CTTTTAAGAAGGAGAGAGAAAGG - Intergenic
1064428946 10:15254980-15255002 CTTGTGAGAGGGAGCAGGGTGGG - Intronic
1065872698 10:29969552-29969574 GTTGCAAGCAGGAGAAAGGGTGG + Intergenic
1068501892 10:57850126-57850148 CTAGTCTGAAGGAGAAAGATTGG - Intergenic
1069309414 10:67015526-67015548 CATGTAAGGAGAATAAAGGTTGG - Intronic
1070362089 10:75700555-75700577 ATTTTAAGAATGAGAAAGGAAGG - Intronic
1070629444 10:78074476-78074498 CTTATAAGAAGGAGGCAGGAGGG + Intergenic
1070640587 10:78166093-78166115 CTTCTAAGCAGGGGAAATGTGGG + Intergenic
1072028360 10:91489168-91489190 CTTTAAAGAAGGAGAATGGCAGG + Intronic
1073278737 10:102335564-102335586 CTTGTAGGAAGCAGTAAAGTCGG + Intronic
1074540902 10:114364544-114364566 CTTATAAGAAGAAGAGAGTTTGG - Intronic
1075206259 10:120451872-120451894 CTTGAAAGAAGGTGAAATGAAGG + Intergenic
1075235852 10:120728031-120728053 CTTATAAAAAGGGGAAATGTAGG - Intergenic
1075484706 10:122812815-122812837 TTTGAAAGGAGGAGAAAGGCCGG + Intergenic
1077225148 11:1436331-1436353 CTTGGAGGCAGGAGAAAGGTGGG - Intronic
1077372677 11:2190827-2190849 CTTTTAACAAGGAGGAAGGAAGG + Intergenic
1078093037 11:8279355-8279377 CTTGAAACAAGGAGAAAGCAGGG - Intergenic
1078450141 11:11434758-11434780 CTTGAATGAAGGAGAAAGACTGG + Intronic
1079591244 11:22185684-22185706 ATTGTAAGCAGGAGGAAGTTAGG - Intergenic
1079612743 11:22453265-22453287 CTACTAAGAGGGAGAAAGATAGG + Intergenic
1080061016 11:27957046-27957068 CTTGTAACACAGAGAAATGTTGG - Intergenic
1080333256 11:31166843-31166865 GCAGTAAGAAGGAGAAAGCTTGG - Intronic
1080514149 11:33004340-33004362 TTTGAAAAAAGAAGAAAGGTTGG - Intergenic
1081434844 11:43015790-43015812 TTTGTAAGAGAGAAAAAGGTGGG + Intergenic
1081485993 11:43529637-43529659 CTTGTAAGAAAGAGATGGATGGG - Intergenic
1082776555 11:57249350-57249372 CCTGGAATAAGGAGAGAGGTTGG - Intergenic
1082919937 11:58482050-58482072 CTTATAAGAAGTAGGAAGCTGGG + Intergenic
1083252314 11:61476454-61476476 CTTGTAGGGAAGAGACAGGTTGG - Intronic
1084187743 11:67483801-67483823 CTGGCAAAAAGGAGAAAAGTGGG - Intronic
1084269868 11:68023030-68023052 TGTGTAAGAAGGACAAAGGCAGG - Intronic
1085452205 11:76641194-76641216 CTTGTAAAAAGGGGACATGTGGG + Intergenic
1086101616 11:83106242-83106264 CTTTTGAAAAGGAGCAAGGTAGG - Intergenic
1087055705 11:93933993-93934015 CTGGAAAGTAGGGGAAAGGTTGG - Intergenic
1087757310 11:102068305-102068327 CTTGTCTGTAGGAGAAAGGGAGG + Intronic
1087805258 11:102548486-102548508 GTTGAAAGAAGGAGAAGGGGAGG + Intergenic
1087957604 11:104308047-104308069 CTTATAAGAAGAAGAAATTTGGG + Intergenic
1088093269 11:106067859-106067881 CTTGTAGGAAGCATAAAGTTGGG - Intronic
1089074724 11:115728935-115728957 CTTGTGAGAGGGTGAAAGATTGG + Intergenic
1090208823 11:124900870-124900892 CTTGTAAGAGGGAGAAGAGAGGG + Intergenic
1091873401 12:3913789-3913811 ATGGTAAGGAGGAGAAAGGGAGG - Intergenic
1092911585 12:13149928-13149950 CTCTTAGGAAGGAGAAAAGTAGG - Intergenic
1092930025 12:13307099-13307121 TCTGTTAGAAGGAGAAAAGTTGG + Intergenic
1094626787 12:32132035-32132057 GTGGTCAGAAGGAGCAAGGTGGG + Intronic
1095241379 12:39863134-39863156 TTTGTAATAAGAATAAAGGTAGG + Intronic
1095279613 12:40334897-40334919 CTTTAAAGAAGGAGATACGTGGG + Intronic
1095985309 12:47995404-47995426 CTTCTATGAAGAAGAAAGATGGG + Intronic
1096936381 12:55283932-55283954 TTTCTAAGAAGGAGAAATTTCGG - Intergenic
1097070984 12:56354773-56354795 CTGGACAAAAGGAGAAAGGTGGG - Exonic
1098965057 12:76778961-76778983 CTTTTAAAAAGGAGAAAATTTGG - Intronic
1099086360 12:78251543-78251565 ATTGTAAAAAGGAGAAAGTGGGG - Intergenic
1099334912 12:81343304-81343326 GCTGTAAGAAATAGAAAGGTAGG - Intronic
1099368032 12:81794030-81794052 CCTGTAGGAAAGAGAAAGTTAGG - Intergenic
1100607691 12:96165329-96165351 CCTGCAGGAAGGAGGAAGGTGGG + Intergenic
1101858838 12:108466068-108466090 CTTGCAAGAAGGAAAGAGGAGGG - Intergenic
1102688755 12:114744115-114744137 TTTGGAAGTAGGAGACAGGTAGG - Intergenic
1103970626 12:124668766-124668788 CTTATAAGAAGGAGGAAGTTTGG + Intergenic
1104247125 12:127054601-127054623 CCTGCAGGAAGGAGGAAGGTAGG + Intergenic
1104337787 12:127916557-127916579 CTTATTAGAAGGAGGAAGGAGGG + Intergenic
1105799409 13:23890322-23890344 CTTGTAAGAAGAGGAAAATTTGG + Intergenic
1105849638 13:24322716-24322738 CTTGTAAGAAGAGGAAAATTTGG - Intergenic
1106319586 13:28625062-28625084 CCTGGAAGAAGGAGAAAGGGAGG + Intergenic
1106670278 13:31897907-31897929 CTTGTAAGAGGGAGGCAGGAGGG - Intergenic
1107143714 13:37034074-37034096 CTGAGAAGAAGGAGAAAGATAGG - Intronic
1108581203 13:51829887-51829909 CTTTTAAGAAGGAAAAGGGGAGG - Intergenic
1108761771 13:53575771-53575793 GTTGTAAGAAGTAGAAAGCCAGG + Intergenic
1110518046 13:76439864-76439886 TTTGTTAGAAGGAGGAAGGGAGG - Intergenic
1110841731 13:80151880-80151902 TTTGGAAGAAGGAGAAAAATGGG + Intergenic
1111270107 13:85870433-85870455 CTAGTAAGAAAGAGAAACCTTGG + Intergenic
1112488216 13:99838937-99838959 CTTTTAAGAATGTGAAATGTAGG - Intronic
1112802100 13:103124066-103124088 CTTGAGAGTAGGAAAAAGGTAGG - Intergenic
1113352492 13:109542969-109542991 CTGGTGAGAAGAAGAAAGGGAGG - Intergenic
1113670162 13:112170780-112170802 CTTGTAAGAAGGGGAAGCCTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114441936 14:22755594-22755616 CTTGTAAGAAGGAGAAATTTAGG + Intergenic
1115418519 14:33165609-33165631 GTTGAAAGAAGGAAAAAGGCAGG + Intronic
1115846624 14:37542762-37542784 CTCATAAGAAGCAGTAAGGTGGG - Intronic
1115872857 14:37824832-37824854 CTTGTAAGAAAGAGACAAGAGGG + Intronic
1116661988 14:47722042-47722064 CTTATAAGAAGAAGAAATCTGGG + Intergenic
1117157461 14:52954950-52954972 TTTGAAAGAAGGAGAGAGGATGG + Intergenic
1118009233 14:61592476-61592498 CTTATAAGAGGGAGGCAGGTGGG - Intronic
1118445518 14:65847737-65847759 TTTGTACAAAGGGGAAAGGTAGG - Intergenic
1119206135 14:72794959-72794981 CTTGCAAGAGGGAGACAGGACGG - Intronic
1119678676 14:76575550-76575572 CTTGTAAGAAGAAGAAAATTTGG - Intergenic
1120245965 14:82007016-82007038 ATTGTAGGATGGAGAAAGGCAGG - Intergenic
1120453249 14:84698378-84698400 ATTTTAAGAAGGAGCAAGGTAGG - Intergenic
1120848687 14:89149061-89149083 CTTTTCAGGAGGAGAGAGGTAGG + Intronic
1121073605 14:91047941-91047963 CTTGTAAGAGGGAGACAGGAGGG - Intronic
1122052760 14:99071204-99071226 CTTATAAGGAGGAGAAACTTGGG + Intergenic
1122616621 14:103022309-103022331 CTTTTGAGAATGAGAGAGGTGGG + Intronic
1124411319 15:29439806-29439828 CTTCTAACAAGGAGTAAGGGAGG + Intronic
1126180836 15:45783679-45783701 CTTGCTAAAAGGAGAAAAGTGGG + Intergenic
1127344737 15:58083148-58083170 CTTATAAGAAGAAGAAATCTGGG - Intronic
1128446204 15:67763420-67763442 GTTATCAGAAGGAGAAAGGTGGG - Intronic
1130196319 15:81783238-81783260 CTTGTAAGAGGGACACAGGAGGG + Intergenic
1131289722 15:91096664-91096686 CTTGGAAGAAGAAAAAAGGTGGG + Intergenic
1133434728 16:5769338-5769360 CTTATAAGGAGGAGAAATTTGGG + Intergenic
1135353095 16:21746486-21746508 CTTTTAAGAAGGAGCAAGGAGGG + Intronic
1135357064 16:21778088-21778110 CCAGTAAGAAGGATAAATGTAGG + Intergenic
1135451582 16:22562609-22562631 CTTTTAAGAAGGAGCAAGGAGGG + Intergenic
1135455568 16:22594202-22594224 CCAGTAAGAAGGATAAATGTAGG + Intergenic
1135881614 16:26263203-26263225 CATGTAAGAAGGGGAAACCTGGG + Intergenic
1137259839 16:46817028-46817050 ATTGGAAGAAGGATAAAGATAGG - Intronic
1137364323 16:47847637-47847659 GTTGGAAGAAGGAGAAACATGGG + Intergenic
1137612128 16:49825569-49825591 CTTGGAAGAAGCAGGAAGGAAGG + Intronic
1137795630 16:51215401-51215423 CTTGAAATAAAGAGAAAGGCAGG + Intergenic
1137944098 16:52717319-52717341 CTTGGAGGAAGGAGAAGGATTGG - Intergenic
1140606552 16:76546145-76546167 CATGTAAGGAAGAGAAAGGAAGG + Intronic
1140812404 16:78591143-78591165 CTTGAAAAAGGGAGAAAGGGGGG - Intronic
1140876332 16:79155855-79155877 CATATAAGAAGGAGAAAGGGAGG + Intronic
1142655746 17:1392529-1392551 CTTCTAGGAGGGACAAAGGTTGG - Intronic
1143368041 17:6421155-6421177 CTTATAAGAGGGAGACAGGAGGG + Intronic
1143920048 17:10323946-10323968 TCTGTAAGGAGGAGAAAGGGTGG - Intronic
1144158375 17:12531545-12531567 CATCTAAGAAGAAGAAAGGCAGG - Intergenic
1147260062 17:39204727-39204749 CTTGCAAGAAGCAGAGAGGAAGG - Exonic
1147615277 17:41823686-41823708 CTAGCAAGAGGGAGAAGGGTGGG - Intergenic
1148841018 17:50497216-50497238 CTTTTAAGAAGCAGAAGGTTGGG + Intergenic
1149096983 17:52854997-52855019 TTTGAAAGAATGACAAAGGTGGG - Intergenic
1151143661 17:72018963-72018985 TTTGAAAGAGGGAGAAAGGTGGG + Intergenic
1151229008 17:72668638-72668660 CATGAAGGAAGGAGAAAAGTTGG + Intronic
1151647650 17:75444347-75444369 TTTCTAAGATGGAGAAGGGTGGG + Intronic
1152009984 17:77706964-77706986 CTTCTAAGAAGGACAATGGGTGG + Intergenic
1152329018 17:79659851-79659873 CCTTTAGGGAGGAGAAAGGTGGG - Intergenic
1153244186 18:3057479-3057501 GTTGTAAGCTGGAGCAAGGTGGG + Intergenic
1155207189 18:23570297-23570319 CTGATAATATGGAGAAAGGTTGG + Intronic
1155827427 18:30465421-30465443 CTAATAAGAAGGACAAAGATGGG + Intergenic
1156773261 18:40756230-40756252 CTTGTAAGAAGAGGAAAATTTGG + Intergenic
1157263778 18:46198891-46198913 TTTTTAAGAAGGAAAAAGGCTGG - Intronic
1157793112 18:50550616-50550638 CTTGTACTACAGAGAAAGGTGGG + Intergenic
1158696519 18:59708844-59708866 CCTATAAGAAGAAGGAAGGTGGG - Intergenic
1158803551 18:60942928-60942950 AGTGTAAGAAGGAGAACGGGTGG + Intergenic
1159352665 18:67296001-67296023 CCTGTAAGAAGAGGAAATGTGGG - Intergenic
1159940333 18:74402141-74402163 CTAGAAAGAAGGAGGAAGGGTGG + Intergenic
1160067847 18:75594111-75594133 CTTGTAAGAGGGAGAGAGGCTGG + Intergenic
1161880315 19:6945989-6946011 CTTGTAAGAAGCATACAGTTTGG + Intergenic
1162579902 19:11522772-11522794 CTAGTAAAAAGAAAAAAGGTCGG + Intronic
1163130150 19:15267356-15267378 CTTGGAAAAGGGACAAAGGTCGG + Intronic
1166590448 19:43993105-43993127 CTAGTACGAAGGAGGAAGCTGGG - Intronic
926839441 2:17062815-17062837 CTTGTAAGAAGGAGGCAGGAGGG - Intergenic
927642820 2:24856105-24856127 CTTGTAAGAGGGAGACAGTTAGG + Intronic
928744394 2:34394590-34394612 CTTTTAGGAAAGAGGAAGGTAGG - Intergenic
929548174 2:42870206-42870228 CTTGTAAGCAGGATATAGTTGGG - Intergenic
930666273 2:54101742-54101764 ATTTTAAAAAGGAGAAAGGGAGG - Intronic
930758475 2:55004551-55004573 CCTTTAAGAAGGGGAAAAGTGGG + Intronic
930859596 2:56056676-56056698 CTAGGAAGAAGGTGACAGGTAGG - Intergenic
930867303 2:56134592-56134614 CCTGTAATAAGGGGAAAGGAAGG + Intergenic
932448286 2:71793957-71793979 CTAGGAAGAAGAAGCAAGGTGGG - Intergenic
932605950 2:73165874-73165896 CTTCAAAGAAGGGGAAAGGAAGG - Intergenic
932918320 2:75880651-75880673 CTTGCTAGAAGTAGAAATGTTGG - Intergenic
933926475 2:87094576-87094598 CTTCAAAGAAGGGGAAAGGAAGG + Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935327171 2:101947677-101947699 ATTGTAAGAAGGAAAATGGAAGG - Intergenic
936243606 2:110808184-110808206 CTTTTCAGAAGGAGGAAGCTGGG + Intronic
936690493 2:114882500-114882522 TATGGAAGAAGAAGAAAGGTGGG + Intronic
937473778 2:122196057-122196079 CTTATAAGAAGGAGCCAGGTTGG + Intergenic
937760339 2:125593161-125593183 CCTGTGAGAAGGAGGGAGGTGGG + Intergenic
940086675 2:149867081-149867103 CTTCTCAGAAAGAGAAAAGTGGG + Intergenic
940304655 2:152212569-152212591 CTTTTAAGAAGAACAAAGTTGGG - Intergenic
941042499 2:160638333-160638355 CTTGTAAGAAGTATCAAGGATGG - Intergenic
943904035 2:193475119-193475141 CTTGTCAGAACAAGAAAGTTTGG + Intergenic
945487236 2:210411032-210411054 CTGATAAGAAGGAGAGAGATGGG + Intergenic
945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG + Intronic
945885676 2:215373285-215373307 CAGGTAACAAGGAGAAAGATAGG - Intronic
946312370 2:218889901-218889923 CTTGGAATGATGAGAAAGGTGGG + Intronic
946545269 2:220734343-220734365 CTTGAGAGAGGGAGAAAGATGGG + Intergenic
947627871 2:231632277-231632299 CTTGTAAGAGGGAGGCAGGAAGG + Intergenic
948972712 2:241441668-241441690 CTTGTAAAAATGACAATGGTGGG + Intronic
1169055940 20:2621064-2621086 CTTATAAGAAGGAGGGAGGCCGG + Intronic
1169095183 20:2891470-2891492 CAAGTAAGAAGGAGGGAGGTGGG - Intronic
1169453016 20:5728383-5728405 CTTATAAGAGGGAGATAGGAGGG + Intergenic
1170641673 20:18159667-18159689 ATTGTAAGAATGGGGAAGGTTGG - Intronic
1170757239 20:19214825-19214847 AAGGTAGGAAGGAGAAAGGTAGG - Intronic
1172046317 20:32083171-32083193 CTTGTTAGAAGGAGGTAGGAAGG - Intronic
1172893925 20:38286396-38286418 CTTATAAAAAGGGGAAATGTGGG - Intronic
1172901336 20:38337024-38337046 CTCTTAGGAAGGAGAAAGGCAGG - Intronic
1173344123 20:42183101-42183123 ATTTTAAGAAGTAGAAAGGAAGG - Intronic
1173830639 20:46084577-46084599 CTTAAAAGAATAAGAAAGGTAGG - Intronic
1178661980 21:34514513-34514535 CCTGAAAGAAGGAGAAACGGTGG + Intronic
1178738001 21:35170257-35170279 CTTGTAAATTGAAGAAAGGTAGG - Intronic
1178846100 21:36175409-36175431 CTTGTAAGAAGAGGAAATCTGGG - Intronic
1181908734 22:26220833-26220855 ATTGAGAGAAGGAGAAAGGAAGG + Intronic
1181995857 22:26881828-26881850 CATTAAAGAATGAGAAAGGTGGG - Intergenic
1182924603 22:34110514-34110536 CTTGTAAGAGGAAGACAGGAGGG - Intergenic
1184092800 22:42301205-42301227 TGTGTAAGCAGGAGAGAGGTCGG + Intronic
949783221 3:7712973-7712995 CTTATAAGAAGAAGAAAACTTGG - Intronic
949973340 3:9430358-9430380 CATATAAAAAGGAGAAAGGAGGG + Intronic
950766237 3:15275103-15275125 CTTGTAAGAAGGGGAAGAGAGGG + Intronic
951077768 3:18417476-18417498 CATGTAAGCAGTAGAAAGGTGGG - Intronic
951369560 3:21828951-21828973 CTTGTAAGAGGGAGACAAGAGGG - Intronic
952765834 3:36953330-36953352 CATGTGAGAAGCAGAAAGATAGG - Intergenic
953039102 3:39239002-39239024 CCTATAGGAGGGAGAAAGGTGGG - Intergenic
954396469 3:50295942-50295964 CTTGGAAGAGGGAACAAGGTGGG - Intronic
955572475 3:60323058-60323080 GTTGGAAGTAGGAGAAAGGGTGG - Intronic
957368053 3:79252348-79252370 CTTCTAAGAAGGGGAAAATTTGG + Intronic
958424857 3:93968266-93968288 CTTATAAAAAGGGGAAATGTGGG + Intronic
958634126 3:96721004-96721026 CTTCAGAGATGGAGAAAGGTAGG + Intergenic
958675883 3:97267976-97267998 CTTATAACAAGAACAAAGGTAGG + Intronic
959424807 3:106173998-106174020 ATTAAAAGAAGGAGAAAGCTTGG + Intergenic
959988375 3:112602270-112602292 CTGAGAAGAAGGAGAAAGATTGG - Intergenic
960265665 3:115618377-115618399 TTTCTAAGAAAGAGAAAGATGGG + Intergenic
960320330 3:116226917-116226939 TTTGTAACAAGGTGAAAGCTGGG + Intronic
960722390 3:120637794-120637816 CCTGTAAGAGGCAGAAAGGCTGG - Intronic
961322610 3:126086093-126086115 CTTCTAAGAAAAAAAAAGGTGGG + Intronic
961392592 3:126563363-126563385 CTTGTAAGAAGGGAAAATTTTGG + Intergenic
962575771 3:136753379-136753401 GTTGTAAGCAGGTGAAAGGTAGG - Intergenic
963912007 3:150823061-150823083 ATTGTCAGAAGGAGCAAGGTAGG - Intergenic
964026871 3:152084802-152084824 CTAGTAACCAGAAGAAAGGTTGG - Intergenic
964476475 3:157102177-157102199 CTTATAACAAGGAGAAATTTGGG + Intergenic
965206678 3:165728131-165728153 ATTTTAATAAGGAGAAAAGTTGG + Intergenic
969382625 4:6814616-6814638 CTTGTGAGAGGTTGAAAGGTAGG + Intronic
969864630 4:10066538-10066560 ATTGAAAGAAGAAGAAAGGGAGG + Intergenic
972021507 4:34321993-34322015 ATTGTAATAAAGACAAAGGTAGG - Intergenic
972702947 4:41511473-41511495 CTTGTTTGAAGGAGAAATTTTGG + Intronic
973106034 4:46338859-46338881 CTACTGAGAAGTAGAAAGGTTGG + Intronic
973811780 4:54577863-54577885 CTTTTAGGAAGGAGAAAGAGAGG - Intergenic
974153391 4:58039772-58039794 CTTGAAAGAAGAAGAAAAGAAGG - Intergenic
974240578 4:59240696-59240718 CTTGTAAGAAAGAGAATGCAAGG - Intergenic
974589375 4:63923391-63923413 CTTATAAGAAGGAGAAACATTGG - Intergenic
974866651 4:67589316-67589338 CTTTTAGGAAGGAAAAGGGTTGG + Intronic
975325485 4:73054058-73054080 CCTGTAAGGACGAGAAGGGTGGG + Intergenic
975506400 4:75143476-75143498 CATGCAAGAAGGAGAAAGAGAGG + Intergenic
975712482 4:77174388-77174410 CTTGTAAAAGGGAAAAAGGGAGG + Intronic
976179437 4:82385109-82385131 CTTGTAAGAGGGGGACAGGAGGG + Intergenic
976809178 4:89082041-89082063 CTTATAAGAAGGAGGCAGGAAGG + Intronic
978282160 4:107031263-107031285 CTCCTAAGCAGGAGAAAGTTGGG + Intronic
978876446 4:113645559-113645581 CAGGAAAGAAAGAGAAAGGTTGG - Intronic
979153295 4:117348265-117348287 CTTGTAAGAAGAAGGAAATTTGG - Intergenic
979351580 4:119649905-119649927 CTTATAAGATGGAGATAGGAGGG + Intergenic
981097312 4:140795348-140795370 CTTGTAAGAAGGGGAAATTTTGG + Intergenic
981179249 4:141719306-141719328 CTAGTAAGAAAAAGAAAGGGAGG - Intronic
981545853 4:145892416-145892438 CTTGGAAGAAGGAGAAAGAAAGG + Intronic
981695872 4:147558223-147558245 CTTGAAGGAAGGAGGAAGGAAGG + Intergenic
981971457 4:150667318-150667340 CTTATAAGAGGGAGGAAGGAAGG + Intronic
981989337 4:150897913-150897935 TTTGTAAGAAATATAAAGGTAGG + Intronic
982602009 4:157463616-157463638 CCTATCAGAAGGTGAAAGGTGGG + Intergenic
983280656 4:165677096-165677118 CTTATAAGAAGGAGGAAATTTGG + Intergenic
984036052 4:174669156-174669178 CTTGCACTAAGGAGAAATGTAGG - Intronic
984145295 4:176053139-176053161 TTTGTAGGAATGAGAAGGGTGGG + Intergenic
984240968 4:177218866-177218888 CTTGTAATCAGCAGAAAGGAAGG - Intergenic
984980486 4:185276106-185276128 GATGTAAGAAGGGGAAATGTTGG + Intronic
986464675 5:8008987-8009009 CTTATAAGAAGAAGGCAGGTTGG - Intergenic
988004343 5:25388461-25388483 CTGGTTAGAGGGAGAAAGGAAGG - Intergenic
988677915 5:33452805-33452827 CTTTGTAGAAAGAGAAAGGTGGG + Intronic
988734406 5:34006624-34006646 CTTGTAATTAGGAGGAAGGTCGG - Intronic
989611923 5:43302263-43302285 GTTGTAAGATGGGGAAAGATTGG - Intronic
990609926 5:57446717-57446739 CTTGGAGGAAGGAGTAAGGAGGG + Intergenic
991553656 5:67871293-67871315 ATGCTAAGAAGTAGAAAGGTGGG + Intergenic
992258009 5:74941551-74941573 CTTGTAAGGAGGAGAAAATTAGG + Intergenic
992318749 5:75588819-75588841 CTTATAAGAAGGAGGCAGGAGGG - Intronic
993225793 5:85166244-85166266 CATGGCAGAAGGTGAAAGGTAGG - Intergenic
993876997 5:93319046-93319068 CGTGTAAGAGGGAGAACTGTTGG + Intergenic
993892785 5:93493813-93493835 CTTTTAATAAGGAGTGAGGTAGG - Intergenic
994094941 5:95839937-95839959 AATGTAAGCTGGAGAAAGGTAGG + Intergenic
996681754 5:126235331-126235353 GTTATCAGAAAGAGAAAGGTAGG - Intergenic
996839440 5:127830521-127830543 CTTGTAAGAAGAGGAAATTTAGG - Intergenic
997851924 5:137340583-137340605 CTTGTAAGAAGGCTAAAGCTAGG + Intronic
998966445 5:147546284-147546306 ATTTTAAGAATGAGAAAAGTGGG - Intergenic
999455023 5:151708096-151708118 ATTCTAAGAAGGAGAAAACTGGG - Intergenic
1000138392 5:158377410-158377432 TTTGGTAGAAGGAGTAAGGTAGG - Intergenic
1001918762 5:175583993-175584015 CTTCTAAGAAGGAAAATGATGGG - Intergenic
1002514945 5:179750798-179750820 TTTGCTAGAAAGAGAAAGGTGGG + Intronic
1003418390 6:5934079-5934101 TTTGTTGGAAGGAGAAAGATGGG + Intergenic
1003576791 6:7304159-7304181 CTTGTTAGAAAGAGAATGATAGG - Intronic
1003870510 6:10398971-10398993 TTTGTGTGAGGGAGAAAGGTGGG - Intronic
1004329471 6:14708385-14708407 ATTGGGAGAAGGAGAAAGGCCGG - Intergenic
1004523109 6:16380989-16381011 CTTGTGAAAAGGGGAAATGTGGG + Intronic
1004540791 6:16547768-16547790 CTTGTAAAAAGGGGAAACTTGGG - Intronic
1004622419 6:17342734-17342756 CATCTAAGAAAGAGAAAGGTAGG - Intergenic
1004687857 6:17964318-17964340 CTTGTAAAAAGTAGAAACTTGGG - Intronic
1004987850 6:21102856-21102878 CTGGCAGGAAGCAGAAAGGTAGG - Intronic
1005139739 6:22614946-22614968 CTTTTACAAAGCAGAAAGGTGGG - Intergenic
1005439476 6:25850419-25850441 CATGCAAGCAGGAGAAAGGAAGG + Intronic
1005565371 6:27087531-27087553 ATTGTGAGAAGTAAAAAGGTAGG + Intergenic
1005727016 6:28659218-28659240 GTTGGGAGAAGGAGCAAGGTGGG + Intergenic
1007080352 6:39096971-39096993 GTTGGAAGATGGAGAAAAGTAGG + Intergenic
1008157967 6:48040341-48040363 CTTGTTATAAGGAAAAAGTTAGG - Intronic
1008589718 6:52981921-52981943 ATTCTCAGAAGGAGAATGGTAGG + Intronic
1008793955 6:55277087-55277109 CTTGTAAAAAGAACAAAGCTTGG - Intronic
1009896255 6:69754122-69754144 GTTGTCAGAAGGAGAGAGGAAGG + Intronic
1011561455 6:88621478-88621500 GGAGTAAGAAGGAGAAAGGGAGG - Intronic
1011735240 6:90303567-90303589 CTGGAAAGATGGAGAAAGGCAGG + Intergenic
1012086756 6:94836534-94836556 ATTGTAATGAGGAGAAAGGAGGG - Intergenic
1012307011 6:97671253-97671275 CTTGAAATAAGGAGAAAAGGAGG + Intergenic
1013705500 6:112828972-112828994 CTTTTAAGAAGAAGGAAGTTTGG + Intergenic
1013993587 6:116281086-116281108 CTTATAAGAAGGAGGCAGGAGGG + Intronic
1013994748 6:116295184-116295206 CTTGAAGGCAGAAGAAAGGTGGG + Intronic
1014946160 6:127500674-127500696 CCTGTGGGAAGGTGAAAGGTGGG - Intronic
1015286176 6:131488945-131488967 CCTATAAGAAGGAGCAAGCTGGG + Intergenic
1015318671 6:131846559-131846581 GTTTAAAGAAGGAGAAAGGTTGG - Intronic
1015505471 6:133981945-133981967 CTTGAATAAAGGAGAAATGTTGG - Intronic
1016883410 6:148934114-148934136 CTTATAAAAAGGGGAAAGTTAGG - Intronic
1016884666 6:148948120-148948142 CTTGTAAGCAGGAGGCAGGATGG - Intronic
1017223499 6:151993428-151993450 CTTTTGAGAAGGAGATAGATAGG - Intronic
1017380279 6:153820500-153820522 CCTCTAAGAAAGAGAAAGGAAGG - Intergenic
1017457305 6:154613348-154613370 CTTGAAAGAAGGAAAGAGGAAGG - Intergenic
1018322562 6:162627480-162627502 CTTGTAAACAGGAGACTGGTAGG + Intronic
1019755201 7:2763674-2763696 CTGGTAAGAATGAGAAAGCCTGG + Intronic
1020224495 7:6269328-6269350 CCTGTCTGAAGGTGAAAGGTGGG + Intronic
1020341516 7:7116157-7116179 AATTTAAGAAAGAGAAAGGTAGG - Intergenic
1020381469 7:7552053-7552075 CTTGGAAGAGGGAGGTAGGTAGG - Intergenic
1021444485 7:20717735-20717757 CTTGTAAGAAGAGGAAATTTGGG - Intronic
1023007059 7:35882559-35882581 CTTGTTAAAAAGATAAAGGTAGG + Exonic
1023013850 7:35946363-35946385 CTTGTTAAAAAGATAAAGGTAGG + Intergenic
1024067140 7:45748621-45748643 CTTGTTAAAAAGATAAAGGTAGG - Intergenic
1024387683 7:48772131-48772153 ATTGCAAGAAGGAGAATGGAAGG + Intergenic
1025702810 7:63835502-63835524 CTTGTAAGAAGAGGAAATTTGGG + Intergenic
1026172059 7:67962613-67962635 CTTGTAAGAAGAGGAAATTTGGG + Intergenic
1026839508 7:73661793-73661815 CTTATAAGAGGGAGGAAGGAGGG - Intergenic
1028225147 7:88241657-88241679 CTTGTTGGAAGGAAAAAAGTGGG - Intergenic
1028678237 7:93493365-93493387 ATTGTATGAATGAGAAAGTTGGG + Intronic
1029049837 7:97673917-97673939 CTTGTAAGAGTGACAATGGTGGG - Intergenic
1030665269 7:112270458-112270480 CTTTTAATAATGAGAAAGCTCGG + Intronic
1031580296 7:123466472-123466494 CTTGAAAGACAGAGATAGGTAGG - Intronic
1032806005 7:135354959-135354981 GTTCTAAGTAGGAGAAAGGTAGG - Intergenic
1032946850 7:136863932-136863954 CCTGTAAAAAGGGGAAATGTAGG + Intergenic
1033209245 7:139448294-139448316 TTTATAAAAAGGAGAAATGTTGG - Intergenic
1033290148 7:140076639-140076661 CTTGTAAGAAGAGGAAATTTAGG + Intergenic
1033898523 7:146106361-146106383 GTTGTATGAGGGAGAAAGGATGG + Intergenic
1035197975 7:157238905-157238927 TTTGAAAGGAAGAGAAAGGTGGG + Intronic
1035988316 8:4459127-4459149 CTTGTGAGGATGAGAAAGGATGG - Intronic
1035990463 8:4484340-4484362 ATTGAGAGAAAGAGAAAGGTGGG + Intronic
1037065899 8:14576868-14576890 CTTGTAAGAAGGAGCTATGAAGG + Intronic
1037499278 8:19469908-19469930 CTTCACAGAAGGAGAAAGGGAGG + Intronic
1037616311 8:20522310-20522332 CTTATAAGAAGGGGAGAGGAGGG + Intergenic
1038660855 8:29495421-29495443 CTTGTAAGAAGAGGAAAATTTGG + Intergenic
1039084996 8:33771169-33771191 CTTGGGAGAAGGAAAAAGGTTGG - Intergenic
1039427398 8:37496909-37496931 CTAGAAAGAAGGAGAGAGGGAGG + Intergenic
1040850574 8:51897995-51898017 GTAGTAAGAAGGAGAAATATGGG + Intronic
1041290954 8:56308022-56308044 GTTCTAAGAAGGAGAGAGGAAGG + Intronic
1041506430 8:58603493-58603515 ATTGTAAGAAAAAGAAAAGTAGG + Intronic
1041941359 8:63391630-63391652 CTCGGAAGAGGGAGAAAGGGAGG + Intergenic
1043201729 8:77378373-77378395 CTTGAAAGAAGGAATAAGATTGG + Intergenic
1044601727 8:94011978-94012000 TTTGGAACAAGGAGGAAGGTCGG + Intergenic
1044852464 8:96442357-96442379 CCTGCAAGAAGCAGAAAGGAGGG + Intergenic
1044931131 8:97252706-97252728 CTTCTAAGCAGGAGAAGGATGGG - Intergenic
1046139168 8:110067464-110067486 CTTGTAATAACTAAAAAGGTGGG + Intergenic
1046192044 8:110809132-110809154 TTTGGAAGAAAGAGAAAGATTGG - Intergenic
1046837998 8:118824612-118824634 CTTGTAAGAAGAAGAGATGAGGG + Intergenic
1047064107 8:121261399-121261421 CTTGGAAGGAGGAGCAAGCTAGG - Intergenic
1047584115 8:126250510-126250532 CTTGCAAGACAGAGAAAGGAAGG - Intergenic
1047606567 8:126480489-126480511 CTAGGAAGAAGGTGAAAAGTAGG + Intergenic
1048390988 8:133964238-133964260 CTTATAAGAAGGGGGAAGTTTGG + Intergenic
1050185477 9:2968361-2968383 CTTTCAAGAAAAAGAAAGGTTGG - Intergenic
1050186841 9:2983592-2983614 CTTGTAAGAGGGAGGCAGGAGGG + Intergenic
1051157903 9:14171254-14171276 CATGGAAGAAGGGGAAAGGAAGG - Intronic
1051663397 9:19445952-19445974 TATGTGAGAAGGAGAAAGATTGG + Intronic
1051891070 9:21943591-21943613 ATTTTAAGAATGAGAAAGCTCGG - Intronic
1052099534 9:24428182-24428204 ATAGTAAGAAAGATAAAGGTGGG + Intergenic
1055183735 9:73424068-73424090 CTTGGAAGGAGGAGAAAAGATGG - Intergenic
1056132050 9:83596926-83596948 CTTCCTGGAAGGAGAAAGGTTGG - Intergenic
1056755497 9:89379432-89379454 CTTGTCAGAAGGAGACAGTGGGG - Exonic
1056857353 9:90143832-90143854 CATGGAAGTAGGAGAAAGGAGGG - Intergenic
1057538895 9:95945895-95945917 TTAGAAAGAAGGAGAAAAGTGGG + Intronic
1057600642 9:96454159-96454181 CTTGGAGGAAGCAGAAAGGTGGG + Intronic
1057706240 9:97396945-97396967 CTGGTAAGAAAAAGAAGGGTTGG - Intergenic
1057959757 9:99443285-99443307 CCTATCAGAAGGTGAAAGGTGGG + Intergenic
1058067155 9:100562428-100562450 TTTTTAAGCAGGAGAAAGGCAGG - Intronic
1059015609 9:110512306-110512328 GTTGTAAGAAGTAGGAAAGTAGG + Intronic
1059019685 9:110561877-110561899 CTAGAAAGAAAGAAAAAGGTTGG + Intronic
1059496720 9:114716138-114716160 CTTGTAAGAAGAGGAAATTTGGG - Intergenic
1059679710 9:116574306-116574328 TAAGTAAGAAGGAAAAAGGTAGG + Intronic
1059715825 9:116912448-116912470 CTTGTCAGAAAGAGAGAGGCTGG - Intronic
1059730221 9:117049765-117049787 CATGCAAGAATGAAAAAGGTAGG + Intronic
1060756124 9:126215241-126215263 CTTGTCTGAAAGAGAAAGGAAGG - Intergenic
1060827968 9:126697146-126697168 CTTGTCAGAAAGAGAAAAGGAGG + Exonic
1185675116 X:1842865-1842887 CTTATAAGAGGGGGAAAAGTTGG + Intergenic
1186394932 X:9198326-9198348 CATGTAAGAAGGAGACAGGAAGG - Intergenic
1186656267 X:11615041-11615063 CTTGGGAGAAGGAGTAAGCTAGG - Intronic
1186894879 X:13995735-13995757 CTTATAAGAGGGAGGGAGGTGGG - Intergenic
1187034356 X:15522242-15522264 CTTGAAAGAGAGAGAAAGGAAGG - Intronic
1187241970 X:17522084-17522106 CTTGGAAGACAGAGACAGGTAGG + Intronic
1187948111 X:24446179-24446201 CTTATAAGAGGGAGACAGGAGGG + Intergenic
1188254038 X:27937167-27937189 TTTGGAAGAAGGAAAAAGTTGGG + Intergenic
1188316696 X:28683365-28683387 TTTCCAAGAAGGGGAAAGGTAGG + Intronic
1189280715 X:39818701-39818723 TTTTTAAGAAGGATAAAGGGGGG + Intergenic
1189305497 X:39983944-39983966 CTTGTTAGAAGAGGAAATGTGGG - Intergenic
1190105013 X:47553712-47553734 CTTGTAAGAAGAGGAAGGCTGGG - Intergenic
1190429951 X:50369560-50369582 CTTGAAAGAAAGAGGAAGGAGGG - Intronic
1190480796 X:50874861-50874883 CTTGAAAGTAGCAGAAATGTAGG - Intergenic
1190685844 X:52872421-52872443 CTTATCAGATGGAGAATGGTGGG - Intergenic
1192638913 X:72845363-72845385 TTTGTAGGAAGGAGAGAGCTGGG + Intronic
1192642799 X:72875445-72875467 TTTGTAGGAAGGAGAGAGCTGGG - Intronic
1194867935 X:99091803-99091825 CTTTTCAGAAGGTGAAGGGTGGG + Intergenic
1195745476 X:108113201-108113223 CTTGAAAGAAGGAAAAAGTAGGG - Intronic
1195848249 X:109252962-109252984 CTTGTAAGCAGCATACAGGTGGG + Intergenic
1195862047 X:109393284-109393306 CTTGAAAGAACCAGAAGGGTAGG - Intronic
1195925333 X:110019015-110019037 CTGGCAAAAGGGAGAAAGGTAGG + Intronic
1196033916 X:111122351-111122373 CTTGGAAGAAGGAAAAAGGGAGG - Intronic
1198440981 X:136663027-136663049 CATGTAAGAAGCACTAAGGTGGG + Intergenic
1198512820 X:137371389-137371411 CTTATAAGAAGAGGAAATGTGGG - Intergenic
1198573978 X:137989850-137989872 CTCGTAAAAAGGAGAAATTTGGG - Intergenic
1198662395 X:138984105-138984127 TTTTTAAGAAGAAGCAAGGTAGG + Intronic
1199047245 X:143189449-143189471 TTTGTAAGAAGGGGTAAGATGGG - Intergenic
1199249553 X:145644552-145644574 CTTGAAAGAAAGAGCAAGGAAGG + Intergenic
1199892937 X:152105691-152105713 CTTGAAAGAAACAGAAAAGTAGG + Intergenic
1200298711 X:154950063-154950085 CTTATAAGAAGAGGAAATGTGGG - Intronic