ID: 945744928

View in Genome Browser
Species Human (GRCh38)
Location 2:213708822-213708844
Sequence CACTTGCCATTTAACATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 471}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945744928_945744936 22 Left 945744928 2:213708822-213708844 CCCAAAATGTTAAATGGCAAGTG 0: 1
1: 0
2: 3
3: 53
4: 471
Right 945744936 2:213708867-213708889 TAGTTCATGTCCCATCTTACTGG 0: 1
1: 0
2: 0
3: 6
4: 87
945744928_945744935 -2 Left 945744928 2:213708822-213708844 CCCAAAATGTTAAATGGCAAGTG 0: 1
1: 0
2: 3
3: 53
4: 471
Right 945744935 2:213708843-213708865 TGAGTGGAGGGAAACAGAAGGGG 0: 1
1: 0
2: 4
3: 85
4: 588
945744928_945744933 -4 Left 945744928 2:213708822-213708844 CCCAAAATGTTAAATGGCAAGTG 0: 1
1: 0
2: 3
3: 53
4: 471
Right 945744933 2:213708841-213708863 AGTGAGTGGAGGGAAACAGAAGG 0: 1
1: 1
2: 7
3: 70
4: 581
945744928_945744934 -3 Left 945744928 2:213708822-213708844 CCCAAAATGTTAAATGGCAAGTG 0: 1
1: 0
2: 3
3: 53
4: 471
Right 945744934 2:213708842-213708864 GTGAGTGGAGGGAAACAGAAGGG 0: 1
1: 2
2: 7
3: 72
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945744928 Original CRISPR CACTTGCCATTTAACATTTT GGG (reversed) Intronic
900935743 1:5765357-5765379 CACTTGCCAATTTATATGTTTGG + Intergenic
903449958 1:23446385-23446407 AATTTTCCATTTAATATTTTTGG - Intronic
903496684 1:23773168-23773190 AAATTTCCATTTAATATTTTTGG + Intergenic
904343760 1:29854997-29855019 AATTTTCCATTTAATATTTTGGG + Intergenic
905080597 1:35316763-35316785 CACTTGCCTGTCACCATTTTTGG - Intronic
905500168 1:38430128-38430150 CACTTGTCATTTAGAATTATTGG - Intergenic
906095923 1:43223908-43223930 CACTTAGCATTCAACATTTCTGG - Intronic
906573558 1:46866533-46866555 CATTTTTCATTTAATATTTTTGG + Intergenic
906598306 1:47100372-47100394 CATTTTTCATTTAATATTTTTGG - Intronic
906912609 1:49971153-49971175 AATTTTCCATTTAATATTTTTGG - Intronic
907164742 1:52400413-52400435 AATTTTCCATTTAATATTTTTGG + Intronic
908118382 1:60963140-60963162 GACTTGCCACTTTACACTTTTGG + Intronic
908405427 1:63809811-63809833 CGTTGGACATTTAACATTTTAGG + Intronic
909253953 1:73394017-73394039 CTCTTGCCATGTAAAATTTTGGG + Intergenic
910393159 1:86764832-86764854 CACTAGCTATGTACCATTTTTGG + Intergenic
910782858 1:90959879-90959901 AATTTTCCATTTAATATTTTTGG - Intronic
910882828 1:91937902-91937924 AACTTTCCATATAATATTTTTGG - Intergenic
911205793 1:95090478-95090500 AACTTTTCATTTAATATTTTTGG - Intergenic
912010585 1:104956441-104956463 AACTTTCCATTTAATATTTTAGG + Intergenic
912424091 1:109571099-109571121 CACATGTCATTTAACATTTTTGG + Intronic
912600442 1:110926962-110926984 CACTTGCCATATAATAAATTTGG + Intergenic
912883173 1:113439262-113439284 AATTTTCCATTTAATATTTTTGG + Intronic
913073361 1:115320669-115320691 AATTTACCATTTAATATTTTCGG + Intronic
914405182 1:147363493-147363515 CTCTTGCCATCTAATATTTTTGG + Intergenic
914734817 1:150405696-150405718 AATTTTCCATTTAATATTTTAGG - Intronic
914910974 1:151786494-151786516 AACTTCCCATTTAATCTTTTTGG + Intronic
915228993 1:154431934-154431956 AATTTCCCATTTAATATTTTTGG + Intronic
918000258 1:180487310-180487332 AATTTTCCATTTAATATTTTGGG - Intronic
918048950 1:180957724-180957746 GTCTTGCCTTTTAACATTTTGGG + Intergenic
918291773 1:183115498-183115520 CAATAGGCATTTTACATTTTAGG + Exonic
918693818 1:187516946-187516968 AATTTTCCATTTAATATTTTTGG - Intergenic
919066950 1:192704044-192704066 ATCTTTCCATTTAATATTTTTGG + Intergenic
919423407 1:197400135-197400157 CACTTGCCATGTATAATATTAGG - Intronic
920109697 1:203578767-203578789 CACTTGCAGTTTATCTTTTTGGG - Intergenic
920601381 1:207328377-207328399 CACTTTCCATTCAATCTTTTTGG - Intronic
921618904 1:217305033-217305055 AACTTCACGTTTAACATTTTAGG + Intergenic
922307203 1:224354497-224354519 AATTTTCCATTTAACATTTTAGG - Intergenic
922395076 1:225190480-225190502 AATTTTCCATTTAATATTTTTGG + Intronic
922660212 1:227423527-227423549 GCCCTGCCATTTAATATTTTTGG + Intergenic
923399109 1:233598897-233598919 AACTTGGCACTTAACATGTTTGG - Intergenic
923615326 1:235532653-235532675 AACTTTCCATTTAATATTTTTGG + Intergenic
924124222 1:240833364-240833386 AATTTTCCATTTAATATTTTTGG + Intronic
924164543 1:241268189-241268211 CACCTGCCATTCAGCATTCTGGG + Intronic
924856549 1:247880206-247880228 CACTTGGCATTAAACATTATTGG - Intergenic
1063211520 10:3885381-3885403 TATTTGCCATTTAGCTTTTTAGG + Intergenic
1066024058 10:31335152-31335174 AATTTTCCATTTAATATTTTCGG - Intronic
1066241735 10:33543054-33543076 AATCTTCCATTTAACATTTTTGG + Intergenic
1068049981 10:51937820-51937842 AATTTTCCATTTAATATTTTCGG - Intronic
1068065522 10:52126083-52126105 AATTTTCCATTTAATATTTTTGG + Intronic
1068130269 10:52887927-52887949 CTCTCTCTATTTAACATTTTAGG - Intergenic
1068506757 10:57910095-57910117 AATTTTCCATTTAATATTTTTGG + Intergenic
1069244676 10:66189005-66189027 TACTAGCCATTTTACATCTTTGG + Intronic
1070017557 10:72549002-72549024 AATTTGCTATTTAAAATTTTTGG - Intronic
1070572189 10:77648714-77648736 AACTTTCCATTGAATATTTTTGG + Intergenic
1070836623 10:79451370-79451392 AATTTTCCATTTAATATTTTTGG + Intergenic
1071446862 10:85756672-85756694 AATTTACCATTTAATATTTTGGG + Intronic
1071487523 10:86112530-86112552 CACTTGCTGTTTGTCATTTTTGG - Intronic
1071966794 10:90859537-90859559 AAATTTCCATTTAATATTTTCGG - Intergenic
1072000547 10:91191468-91191490 AACTTTCCATTTAATATTTTTGG + Intronic
1072267296 10:93742949-93742971 AACTTTCCATTTAATATTTTTGG - Intergenic
1072990935 10:100192878-100192900 CATTTTGCATTTATCATTTTGGG - Intronic
1073584276 10:104693670-104693692 CACTCTCCATTTAACAATTGAGG + Intronic
1074307207 10:112290049-112290071 AATTTTCCATTTAATATTTTTGG - Intronic
1074414567 10:113255999-113256021 CAATTCTCATTGAACATTTTTGG - Intergenic
1074746460 10:116538505-116538527 AATTTTCCAGTTAACATTTTTGG - Intergenic
1074810076 10:117095355-117095377 CAATTACCATTTAACATTAGGGG + Intronic
1074922643 10:118032688-118032710 AATTTTCCATTTAATATTTTTGG - Intronic
1075113213 10:119604658-119604680 CACTTGCTATTTTCCCTTTTGGG - Intergenic
1075406076 10:122196615-122196637 CACTTTCCATTAAAAATTATGGG - Intronic
1075498440 10:122949653-122949675 AATTTTCCATTTAATATTTTTGG + Intronic
1076508497 10:130994703-130994725 CACTTGACCTTTAATATTCTGGG - Intergenic
1078294292 11:10050874-10050896 AATTTTCCATTTAATATTTTTGG + Intronic
1079278644 11:19067170-19067192 CATTTGTCATTTGAAATTTTAGG + Intergenic
1079643241 11:22832351-22832373 AATTTTCCATTTAATATTTTTGG - Intergenic
1079898900 11:26156109-26156131 CATTATCCTTTTAACATTTTCGG - Intergenic
1080632877 11:34095342-34095364 CACTTACAATTTTAAATTTTGGG + Intronic
1081329201 11:41783523-41783545 CAGTTGCAATTTGACATTATTGG + Intergenic
1081480729 11:43486217-43486239 AATTTTCCATTTAATATTTTTGG - Intronic
1084711890 11:70848699-70848721 CACTTGCCATTTACCTTTCAAGG - Intronic
1085153564 11:74272245-74272267 CATTTGCCATTTAAAATTACTGG + Intronic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1086893058 11:92281148-92281170 CTCTTGTCATTTAATATTATAGG - Intergenic
1087105398 11:94402348-94402370 GGCAAGCCATTTAACATTTTTGG + Intergenic
1087256395 11:95959563-95959585 AATTTTCCATTTAATATTTTTGG - Intergenic
1087364875 11:97205763-97205785 AACTTTCCATTTAATACTTTTGG - Intergenic
1087969943 11:104468009-104468031 CAATGGCCTTTTAAAATTTTAGG - Intergenic
1088326897 11:108610006-108610028 AAGTTTCCATTTAATATTTTCGG + Intergenic
1088560458 11:111110278-111110300 GACTTGGCCTTTTACATTTTAGG - Intergenic
1089040047 11:115439217-115439239 CACTTACCCTTTTACATTTTGGG - Intronic
1089726852 11:120488656-120488678 CACATGACAGTTACCATTTTTGG - Exonic
1089881218 11:121775523-121775545 AATTTTCCATTTAATATTTTTGG + Intergenic
1090060008 11:123456435-123456457 CACTTGTCATTTACCTTCTTTGG + Intergenic
1090568998 11:128026958-128026980 AATTTTCCATTTAATATTTTTGG + Intergenic
1091474966 12:763628-763650 AATTTTCCATTTAATATTTTTGG + Intronic
1092174708 12:6395434-6395456 AATTTTCCATTTAATATTTTTGG - Intergenic
1092507896 12:9123599-9123621 AATTTTCCATTTAATATTTTTGG + Intergenic
1092513047 12:9178177-9178199 AATTTGCCATTTAATATGTTTGG - Intronic
1092726428 12:11490323-11490345 CACTTTATATTTAACTTTTTAGG + Intronic
1093651042 12:21646006-21646028 CATTTGATATGTAACATTTTGGG - Intronic
1093710612 12:22326045-22326067 GAATTTCCATTTAATATTTTTGG + Intronic
1096065105 12:48733476-48733498 AATTTTCCATTTAATATTTTTGG - Intergenic
1096988739 12:55780897-55780919 AATTTCCCATTTAATATTTTAGG + Intronic
1097453130 12:59760820-59760842 AATTTTCCATTTAATATTTTTGG + Intronic
1098038616 12:66332395-66332417 AATTTTCCATTTAATATTTTTGG - Intronic
1098204827 12:68097443-68097465 AATTTTCCATTTAATATTTTTGG - Intergenic
1098381417 12:69873720-69873742 AATTTTCCATTTAATATTTTTGG + Intronic
1098468026 12:70810722-70810744 CCATTGTCATTTAAAATTTTAGG - Intronic
1098793969 12:74864941-74864963 CAGTTGACATTAAACATCTTAGG - Intergenic
1099303164 12:80922728-80922750 AATTTTCCATTTAATATTTTTGG - Intronic
1099323641 12:81182999-81183021 CCTTTGCCAGTTAAAATTTTTGG - Intronic
1099412373 12:82347202-82347224 AATTTTCCATTTAATATTTTTGG + Intronic
1099611780 12:84881578-84881600 CAGTTTCCACTTAGCATTTTGGG + Intronic
1099810819 12:87580022-87580044 TACTTAGCATTTAAAATTTTTGG + Intergenic
1100154196 12:91777674-91777696 GATTTTCCATTTAATATTTTTGG - Intergenic
1100213632 12:92425006-92425028 CAGTTGAAATTTAAAATTTTTGG - Exonic
1100965320 12:100006748-100006770 CACTCCCCAGTAAACATTTTAGG - Intergenic
1101070078 12:101064768-101064790 AATTTTCCATTTAATATTTTTGG - Intronic
1102550218 12:113686027-113686049 CACTTGCCATTTTACACATAGGG - Intergenic
1102941216 12:116943857-116943879 CAGTTGCCACTTACTATTTTGGG + Intronic
1103539628 12:121656935-121656957 TACTTGCCAATAAACAATTTGGG + Intronic
1104204125 12:126620047-126620069 CACTTGACTTTATACATTTTAGG + Intergenic
1104523431 12:129496560-129496582 CACTTGCCTATTACCATCTTTGG - Intronic
1105737544 13:23286890-23286912 AATTTTCCATTTAATATTTTAGG + Intronic
1105793670 13:23829477-23829499 CACTTTCCTTTTAATATTGTTGG - Intronic
1105810036 13:23986929-23986951 CACCTACCATTTTACATTATGGG + Intronic
1107004135 13:35588063-35588085 CATTTTACATTTTACATTTTTGG + Intronic
1107298631 13:38941589-38941611 AATTTTCCATTTAATATTTTTGG - Intergenic
1107357696 13:39585322-39585344 TATTTGCCATATCACATTTTTGG - Intronic
1107364982 13:39661743-39661765 TAATGGCCATTTCACATTTTTGG + Intronic
1108090332 13:46842925-46842947 CATTTTCCATTTAATATTTTCGG - Intronic
1108383663 13:49878826-49878848 TACTAGCCATTTAAAATTTGAGG + Intergenic
1108558579 13:51620772-51620794 CACTTCCCATTTAGGATTCTGGG - Intronic
1109872217 13:68347353-68347375 GATTTGTCATTTAACATTTATGG - Intergenic
1110540251 13:76699885-76699907 CATTTGGCATTTATCATTTTGGG - Intergenic
1110656965 13:78011699-78011721 CACTTGTCTATTGACATTTTGGG + Intergenic
1111209479 13:85058418-85058440 CACTTGTCCTCTAGCATTTTGGG - Intergenic
1111263277 13:85772479-85772501 AATTTTCCATTTAATATTTTTGG - Intergenic
1111306345 13:86418047-86418069 AATTTTCCATTTAATATTTTTGG - Intergenic
1111402969 13:87765323-87765345 GACTTGCCCTTTGTCATTTTTGG + Intergenic
1111868806 13:93804226-93804248 AACTTAGCATTTAAAATTTTAGG - Intronic
1112115612 13:96349173-96349195 CAATTTTCAGTTAACATTTTTGG + Intronic
1112205705 13:97321387-97321409 CACTTGACATTTAACAGGCTTGG + Intronic
1113597776 13:111546860-111546882 AACTTTCCACTTAATATTTTTGG + Intergenic
1113956182 13:114100941-114100963 AATTTTCCATTTAACATTTTTGG + Intronic
1114647860 14:24265576-24265598 CCCTTGCCCTTTAACTTATTGGG - Exonic
1114668334 14:24395256-24395278 CACATTACCTTTAACATTTTGGG + Intergenic
1115389510 14:32838780-32838802 AATTTCCCATTTAATATTTTGGG - Intergenic
1115748831 14:36467387-36467409 AATTTTCCATTTAATATTTTTGG - Intergenic
1115817691 14:37180234-37180256 GATTTTCCATTTAATATTTTTGG + Intergenic
1116545461 14:46160467-46160489 CACTTGTTTTTTAACATTTCTGG - Intergenic
1116808330 14:49515198-49515220 AATTTTCCATGTAACATTTTTGG - Intergenic
1117171883 14:53108605-53108627 AATTTTCCATTTAATATTTTTGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118694034 14:68366658-68366680 TTCTTGCTATTCAACATTTTTGG - Intronic
1120258444 14:82151418-82151440 CACAAGGCTTTTAACATTTTTGG + Intergenic
1120501800 14:85306959-85306981 CACTTGCTATTAAGAATTTTAGG - Intergenic
1121722746 14:96122318-96122340 AATTTTCCATTTAATATTTTTGG + Intergenic
1121786404 14:96664565-96664587 CTCTTCACATTTAACATTTCTGG - Intergenic
1122051716 14:99065417-99065439 CACTTTTCATTTCACATTTCTGG + Intergenic
1122071197 14:99206396-99206418 AATTTTCCATTTAATATTTTTGG - Intronic
1124398650 15:29329400-29329422 AATTTGCTATTTAATATTTTTGG + Intronic
1124470722 15:29983292-29983314 AATTTTCCATTTAATATTTTGGG + Intergenic
1124501664 15:30232822-30232844 CACCTGCAATCCAACATTTTGGG - Intergenic
1124741901 15:32305829-32305851 CACCTGCAATCCAACATTTTGGG + Intergenic
1126463681 15:48940292-48940314 CACTTACAATTGAACATTTTTGG + Intronic
1127164320 15:56229132-56229154 TATTTTCCATTTAATATTTTTGG + Intronic
1127943240 15:63722505-63722527 AATTTTCCATTTAATATTTTTGG - Intronic
1128259907 15:66226005-66226027 AATTTGCCATTTAACATTTTTGG - Intronic
1129647062 15:77445905-77445927 AACTTCCCATTTAATATTTTTGG + Intronic
1129965319 15:79729790-79729812 CCTTTTCCCTTTAACATTTTTGG - Intergenic
1130059872 15:80561590-80561612 AATTTTCCATTTAATATTTTTGG - Intronic
1131126334 15:89860564-89860586 AATTTTCCATTTAATATTTTTGG + Intronic
1131247821 15:90811010-90811032 GAATTGCCATTGAACACTTTGGG + Intronic
1131413539 15:92231694-92231716 GATTTTCCATTTAATATTTTTGG - Intergenic
1131538844 15:93259336-93259358 AATTTTCCATTTAATATTTTTGG - Intergenic
1131668937 15:94599037-94599059 AATTTTCCATTTAATATTTTTGG - Intergenic
1131680335 15:94715376-94715398 AACTTGCCATGGAACAATTTGGG + Intergenic
1131719136 15:95148197-95148219 AACTTACCATTAACCATTTTAGG - Intergenic
1132418721 15:101645126-101645148 CAATTGCAATATAGCATTTTGGG + Exonic
1133144261 16:3772011-3772033 AATTTCCCATTTAATATTTTTGG + Intronic
1133252595 16:4493354-4493376 CACTTGCAATTTAAAATTAATGG - Intronic
1133820482 16:9231896-9231918 CATTTGCCATTTACCGTTGTTGG - Intergenic
1135833133 16:25796565-25796587 TAAATGACATTTAACATTTTGGG + Intronic
1135985452 16:27180484-27180506 AATTTTCCATTTAATATTTTGGG - Intergenic
1136121468 16:28138425-28138447 CAATTGCCAGTTAAGATTTTAGG - Intronic
1137227955 16:46532963-46532985 AATTTACCATTTGACATTTTTGG - Intergenic
1137735161 16:50718473-50718495 AATTTTCCATTTAATATTTTTGG + Intronic
1137889166 16:52140464-52140486 GATTTTCCATTTAATATTTTTGG - Intergenic
1138569753 16:57862387-57862409 AATTTTCCATTTAATATTTTTGG + Intronic
1141926521 16:87173782-87173804 TAATTGCCATTTAACCTTTGTGG - Intronic
1142268878 16:89078832-89078854 AATTTTCCATTTAATATTTTTGG - Intergenic
1203061935 16_KI270728v1_random:982201-982223 CAATTGCCCTTTAATATTATAGG + Intergenic
1143766302 17:9139698-9139720 CAATTTACATTAAACATTTTTGG + Intronic
1143797622 17:9350322-9350344 AATTTTCCATTTAATATTTTAGG + Intronic
1146198473 17:30833377-30833399 TACTTACCATTTAATATGTTAGG + Intronic
1147196843 17:38772263-38772285 AATTTTCCATTTAATATTTTTGG - Intronic
1147569716 17:41561620-41561642 AATTTTCCATTTAATATTTTTGG - Intergenic
1149447785 17:56727099-56727121 AATTTTCCATTTAATATTTTTGG + Intergenic
1149881382 17:60295467-60295489 AAATTTCCATTTAATATTTTTGG - Intronic
1149907740 17:60542145-60542167 AATTTTCCATTTAATATTTTTGG - Intergenic
1150028733 17:61708227-61708249 AATTTTCCATTTAATATTTTTGG - Intronic
1150528979 17:65957105-65957127 AATTTTCCATTTAATATTTTTGG + Intronic
1150718008 17:67588393-67588415 AATTTTCCATTTAATATTTTTGG - Intronic
1151271250 17:72997625-72997647 AATTTTCCATTTAATATTTTTGG - Intronic
1151723073 17:75869300-75869322 AATCTTCCATTTAACATTTTTGG - Intergenic
1152057355 17:78040495-78040517 CACTTGCCAGTTTACATATGGGG + Intronic
1153295149 18:3538553-3538575 CAGATGACAGTTAACATTTTGGG - Intronic
1153557663 18:6333128-6333150 CATATGGCATTTAAAATTTTAGG + Intronic
1153723569 18:7932931-7932953 AATTTTCCATTTGACATTTTCGG - Intronic
1154033177 18:10771700-10771722 AATTTTCCATTTAATATTTTTGG - Intronic
1155340061 18:24804825-24804847 ATCATGCCATTTAATATTTTAGG + Intergenic
1155474611 18:26225924-26225946 GATTTTCCATTTAAGATTTTAGG + Exonic
1155652768 18:28160842-28160864 CACTTCCTATTTACCATTTGGGG + Intronic
1155841571 18:30651381-30651403 AATTTTCCATTTAATATTTTTGG - Intergenic
1156415335 18:36882158-36882180 TACTTGCCATTTAATGTTTTTGG + Intronic
1156785732 18:40911944-40911966 AATTTTCCATTTAATATTTTTGG - Intergenic
1157681521 18:49611212-49611234 AACTCCACATTTAACATTTTTGG - Intergenic
1157763027 18:50278258-50278280 AATTTTCCATTTAATATTTTTGG + Intronic
1157946475 18:51986419-51986441 CACTTAATATTTAACATTTTTGG + Intergenic
1158252714 18:55507476-55507498 AATTTTCCATTTAATATTTTTGG + Intronic
1158525427 18:58209055-58209077 CACTCTTCATTTCACATTTTGGG - Intronic
1158595609 18:58813001-58813023 AATTTTCCATTTAATATTTTTGG + Intergenic
1158682988 18:59585325-59585347 CAATGGCCATTTTACATTTTTGG + Intronic
1159164882 18:64686681-64686703 CATTTGCCATTTAGAATTATTGG - Intergenic
1160212494 18:76894185-76894207 AATTTTCCATTTAATATTTTTGG - Intronic
1162662462 19:12181177-12181199 CACTCGCCATTTCCCATCTTCGG - Intronic
1162912179 19:13853967-13853989 AATTTTCCATTTAATATTTTTGG + Intergenic
1164432357 19:28199293-28199315 CCCCTGGTATTTAACATTTTAGG - Intergenic
1164995545 19:32718565-32718587 CACTTGGTCTTTTACATTTTAGG - Intergenic
1166255668 19:41602392-41602414 CACTGACCATTTATCATTGTTGG + Intronic
1168253158 19:55152385-55152407 AATTTTCCATTTAATATTTTTGG - Intronic
1168456955 19:56519771-56519793 AATTTTCCATTTAATATTTTTGG - Intronic
925485912 2:4330970-4330992 CACTTGTCATTTACTTTTTTGGG + Intergenic
925835580 2:7943155-7943177 CATTTGCCTTTTAACATTTTGGG + Intergenic
926324065 2:11769114-11769136 AACTTTACATTTAACATTTGAGG + Intronic
926387237 2:12348402-12348424 CATTTGTCATTTAACACGTTTGG - Intergenic
926662924 2:15488192-15488214 CACTTACATTTTACCATTTTAGG - Intronic
927745625 2:25617467-25617489 CACTTTTCATTTACCACTTTAGG + Intronic
927784226 2:25961476-25961498 CAATTACAATTTTACATTTTGGG + Intronic
927829842 2:26340001-26340023 CACTTTCCCTTTACCAGTTTTGG + Intronic
927958887 2:27227006-27227028 CTCTTGACATTTAAGATTCTTGG - Intronic
928162862 2:28944943-28944965 CATTTTCCATTTAATATTTTTGG + Intronic
928796724 2:35032552-35032574 AATTTTCCATTTTACATTTTTGG + Intergenic
929432560 2:41900054-41900076 CACAAGCCATTTAACCCTTTTGG + Intergenic
930612591 2:53559855-53559877 AATTTTCCATTTAACATTTTTGG + Intronic
930887561 2:56344461-56344483 AATTTTCCATTTAATATTTTTGG + Intronic
931047202 2:58368273-58368295 AACTTTATATTTAACATTTTGGG - Intergenic
931230517 2:60370836-60370858 CAAATGCCACTGAACATTTTGGG - Intergenic
931347522 2:61460208-61460230 AATTTTCCATTTAATATTTTTGG - Intronic
931506351 2:62931611-62931633 AACTTTCCATTTAATATTTTTGG - Intronic
931866289 2:66415106-66415128 CTCTTCCCAATTACCATTTTAGG + Intergenic
931999831 2:67874738-67874760 GACAAGCTATTTAACATTTTAGG + Intergenic
933582306 2:84141554-84141576 AACTTTCCATTTAATATTTTTGG + Intergenic
934583052 2:95462274-95462296 CATTTGCCTTGTCACATTTTGGG - Intergenic
934596398 2:95614440-95614462 CATTTGCCTTGTCACATTTTGGG + Intergenic
934786371 2:97011106-97011128 CATTTGCCTTGTCACATTTTGGG - Intronic
935119249 2:100167058-100167080 AATTTTCCATTTAACATTTTTGG + Intergenic
937588725 2:123588472-123588494 AATTTTCCATTTAATATTTTTGG + Intergenic
938815516 2:134900202-134900224 AATTTTCCATTTAATATTTTTGG - Intronic
938878827 2:135563515-135563537 TAGTAGCCATTTAAAATTTTTGG + Intronic
938964947 2:136380165-136380187 AATTTGCCATTTAAAAATTTTGG + Intergenic
939161096 2:138589792-138589814 AATTTTCCATTTAATATTTTTGG + Intergenic
939802873 2:146734274-146734296 CACTTTACAGATAACATTTTTGG - Intergenic
939903684 2:147882928-147882950 CATTGGCCATACAACATTTTAGG - Intronic
940456304 2:153906065-153906087 AATTTTCCATTTAATATTTTTGG + Intronic
940690680 2:156915755-156915777 CACTTGGTATATAACCTTTTTGG + Intergenic
940739351 2:157489406-157489428 CACATTCCATTAAACAATTTGGG - Intergenic
940836838 2:158531323-158531345 CTCTTGACATTTAAAATTTTTGG + Intronic
941712280 2:168726672-168726694 CACTTGATCCTTAACATTTTTGG - Intronic
941829647 2:169940826-169940848 AATTTTCCATTTAATATTTTCGG - Intronic
942297308 2:174530225-174530247 AATTTTCCATTTAACATTTTTGG + Intergenic
942572358 2:177327185-177327207 CTCTTGCCAGTTAAACTTTTTGG - Intronic
942641921 2:178069622-178069644 AAGTTGCCTTTTAATATTTTTGG - Intronic
944790827 2:203123931-203123953 CAGTTGTCATTTAACTTTTTTGG - Intronic
945033844 2:205687303-205687325 CAATGGCCATCTCACATTTTGGG - Intronic
945665468 2:212735982-212736004 AATTTTCCATTTAATATTTTTGG + Intergenic
945744928 2:213708822-213708844 CACTTGCCATTTAACATTTTGGG - Intronic
945792581 2:214323566-214323588 CACCTGCTATTTAACTTTCTAGG - Intronic
946265853 2:218540677-218540699 AATTTTCCATTTAACATTTTTGG + Intronic
946755591 2:222943642-222943664 CACCTGGCATCTGACATTTTAGG - Exonic
947183637 2:227434853-227434875 CCCTTGTCATTTAACCTTCTGGG + Intergenic
1168866855 20:1094044-1094066 AATTTTCCATTTAATATTTTTGG + Intergenic
1169642677 20:7772284-7772306 CCTTTGCCATGTAACATTTCTGG + Intergenic
1170450498 20:16478482-16478504 AATTTTCCATTTAATATTTTTGG - Intronic
1170838692 20:19906550-19906572 CAGTTGCCATTTATCAACTTTGG - Intronic
1170840094 20:19918083-19918105 CACTTCCCTTTTACCATTTCTGG - Intronic
1173159374 20:40640874-40640896 CACCTGTCATCTCACATTTTTGG - Intergenic
1173699196 20:45052512-45052534 TACTTGGCATTTAACATTTGGGG + Intronic
1174616714 20:51841149-51841171 AAGTTGCCATTCAACCTTTTTGG - Intergenic
1174679542 20:52392896-52392918 AATTTTCCATTTAATATTTTTGG + Intergenic
1177544903 21:22544090-22544112 CACTTTCCAGTTTACTTTTTGGG + Intergenic
1177758467 21:25374610-25374632 AATTTTCCATTTAATATTTTTGG + Intergenic
1179092833 21:38283808-38283830 CACATGTCTTTTAAAATTTTCGG + Intronic
1179274731 21:39881849-39881871 TACTTGCCATTTAATCTTTCCGG - Intronic
1182939610 22:34262909-34262931 AATTTTCCATTTAATATTTTTGG + Intergenic
1184501651 22:44878362-44878384 AAATTTCCATTTAATATTTTTGG - Intergenic
949281357 3:2351668-2351690 AATTTCCCATTTAATATTTTTGG + Intronic
949693216 3:6664330-6664352 AATTTTCCATTTACCATTTTTGG + Intergenic
949742406 3:7251780-7251802 CAGTTGCCAGAGAACATTTTGGG - Intronic
950149418 3:10675069-10675091 CAATTCCTATTAAACATTTTAGG + Intronic
951141047 3:19160645-19160667 GATTTTCCATTTAATATTTTTGG - Intronic
951402805 3:22255066-22255088 AACTTTCCATTTAGTATTTTTGG + Intronic
952574422 3:34758238-34758260 CATTTTACATTTAAAATTTTTGG - Intergenic
955191921 3:56769611-56769633 GACTGGGCTTTTAACATTTTTGG + Intronic
955417078 3:58702471-58702493 CTCTTGCCAGTGATCATTTTAGG + Intergenic
955425609 3:58786440-58786462 AATTTTCCATTTAATATTTTTGG - Intronic
955553100 3:60105955-60105977 GATTTTCCATTTAATATTTTTGG - Intronic
956463757 3:69498298-69498320 AACTTATCATTTAATATTTTTGG + Intronic
956758383 3:72413278-72413300 AATTTTCCATTTAATATTTTTGG - Intronic
956957978 3:74363317-74363339 CTCTTGACATATAACATTTTGGG + Intronic
956971605 3:74532742-74532764 AATTTTCCATTTAATATTTTTGG + Intergenic
957280928 3:78150589-78150611 CTCTTTCCTTTTAACATGTTAGG + Intergenic
957501780 3:81067053-81067075 CTCTTGCCATTTGACATTTCTGG - Intergenic
957938829 3:86978404-86978426 CACTTGCTTTTTAATATTTAAGG - Intronic
958067845 3:88567343-88567365 AACTTTATATTTAACATTTTAGG - Intergenic
958788646 3:98626157-98626179 TAGTTGCTATGTAACATTTTAGG + Intergenic
960804227 3:121567306-121567328 AAGTTTCCATTTAATATTTTTGG + Intergenic
961023154 3:123527310-123527332 AATTTTCCATTTAATATTTTTGG - Intronic
961854723 3:129858360-129858382 AATTTCCCATTTTACATTTTTGG + Intronic
963507503 3:146205740-146205762 AATTTTCCATTTAATATTTTTGG + Intronic
963676309 3:148315817-148315839 GATTTTCCATTTAATATTTTTGG - Intergenic
964038453 3:152228577-152228599 CAGATGCAAATTAACATTTTTGG + Intergenic
965573719 3:170196903-170196925 CATTTTCCATTTAATATTTTTGG - Intergenic
966080410 3:175993337-175993359 AATTTTCCATTTAATATTTTTGG + Intergenic
967283033 3:187840976-187840998 CACTTGCTATTTGAGATTATGGG + Intergenic
969689579 4:8696831-8696853 AATTTTCCATTTAATATTTTAGG - Intergenic
971526583 4:27626720-27626742 CAACTGACATTTAACATATTTGG - Intergenic
971537398 4:27771047-27771069 CACTTGCAATTTAAATTTCTGGG + Intergenic
971739403 4:30501440-30501462 CATATGCCTTTAAACATTTTTGG + Intergenic
971878243 4:32332281-32332303 GACTAGCAATTTAACAATTTTGG + Intergenic
972627231 4:40811611-40811633 CATTTGGCATTTTACATTCTTGG + Intronic
972812145 4:42601857-42601879 AATTTGCTGTTTAACATTTTGGG - Intronic
973553726 4:52060760-52060782 AACTCGTCATTTAACATTTTAGG + Exonic
973576224 4:52292095-52292117 CACATGCTGTTTCACATTTTTGG + Intergenic
973642740 4:52919272-52919294 CACTTGCTTCTTGACATTTTTGG + Intronic
973729657 4:53811113-53811135 CACATGCCTTTCAACATTTCAGG - Intronic
973897671 4:55431476-55431498 CACTTGCCATTTTAAGTGTTTGG - Exonic
974662059 4:64903010-64903032 GACTTGCCATTTGACCTTTAAGG + Intergenic
974753051 4:66166314-66166336 AATTTTCCATTTAATATTTTTGG - Intergenic
974856611 4:67468534-67468556 AATTTTCCATTTAACATTTTTGG + Intergenic
974937636 4:68427106-68427128 CAATTACCATTTACCATTTCAGG - Intergenic
975208126 4:71667687-71667709 CATTTTCCTTTTAACATTCTAGG + Intergenic
977072586 4:92410109-92410131 CACATGCCATTAAACTTTTTGGG + Intronic
977604527 4:98969246-98969268 GACATGCCATAAAACATTTTTGG - Intergenic
977977496 4:103284441-103284463 AATTTTCCATTTAATATTTTTGG - Intergenic
978367897 4:108001822-108001844 AATTTCCCATTTAATATTTTTGG + Intronic
978767780 4:112422212-112422234 AATTTTCCATTTAATATTTTTGG + Intronic
979356050 4:119707061-119707083 AATTTTCCATTTAATATTTTTGG + Intergenic
979918056 4:126463938-126463960 GACTTGCCTTTTAACAAGTTTGG + Intergenic
980179094 4:129382382-129382404 CACTTGACATTTCACTTTTCTGG + Intergenic
980661269 4:135862040-135862062 AAATTTCCATTTAATATTTTTGG - Intergenic
982338524 4:154268547-154268569 ACCTTCCCATTTAACATTTTTGG + Intronic
983109872 4:163736466-163736488 AATTTTCCATTTAATATTTTTGG + Intronic
983378144 4:166956593-166956615 AATTTTCCATTTAATATTTTTGG + Intronic
983484044 4:168312614-168312636 CACTTGCCATTCAATATGTTAGG + Intronic
984049989 4:174854005-174854027 AACTTTCCATTTAATATTTTCGG + Intronic
984128818 4:175847338-175847360 AATTTTCCATTTAATATTTTTGG - Intronic
984396107 4:179201797-179201819 AATTTTTCATTTAACATTTTTGG + Intergenic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
986079433 5:4374970-4374992 AATTTTCCATTTAACATTTTTGG - Intergenic
986317881 5:6603113-6603135 AACTTGCTGTTTAATATTTTTGG - Intronic
986482070 5:8199473-8199495 CAATTTCCATTTTAAATTTTGGG + Intergenic
986925073 5:12737477-12737499 CACTTGGCAAATAATATTTTAGG + Intergenic
987027050 5:13938000-13938022 AATTATCCATTTAACATTTTTGG - Intronic
987030949 5:13976291-13976313 AATTTTCCATTTAATATTTTTGG - Intergenic
987794912 5:22615056-22615078 AATTTTCCATTTAACATTTTTGG + Intronic
988206968 5:28150300-28150322 AACTTTCCATTTAATATTTTTGG + Intergenic
988215802 5:28270551-28270573 TATTTGCCAGTTTACATTTTAGG - Intergenic
988373541 5:30404286-30404308 CAATTTCTATTTAAAATTTTGGG + Intergenic
988883826 5:35533589-35533611 AATTTTCCATTTAATATTTTTGG + Intergenic
988999189 5:36743441-36743463 CACTTCCCATATATTATTTTAGG + Intergenic
989162343 5:38403692-38403714 AATTTCCCATTTAATATTTTTGG + Intronic
989329762 5:40243021-40243043 AACCTGCCATTTACCATTTCTGG - Intergenic
989436019 5:41414675-41414697 AATTTTCCATTTAACATTTTTGG - Intronic
989441000 5:41472119-41472141 CATTTGTCAATTAACATTTTAGG - Intronic
989491821 5:42064881-42064903 AATTTCCCATTTAATATTTTTGG - Intergenic
989790044 5:45387956-45387978 AACTTTCCATTTGATATTTTTGG + Intronic
990545697 5:56818282-56818304 TACTTACCATTTAAAGTTTTAGG + Intronic
990602633 5:57376390-57376412 CACTGAACATTTAATATTTTTGG + Intergenic
991099089 5:62772143-62772165 AATTTTCCATTTAATATTTTTGG + Intergenic
991374828 5:65955811-65955833 AATTTTCCATTTAATATTTTTGG - Intronic
991528868 5:67593777-67593799 CACTTGCCCATGTACATTTTGGG - Intergenic
991903984 5:71489257-71489279 CATTTCCCATTAGACATTTTAGG + Intronic
992111139 5:73495341-73495363 CATTTGGGATTTAAAATTTTTGG + Intergenic
992211358 5:74482994-74483016 AATTTTCCATTTAATATTTTTGG - Intergenic
992446154 5:76835792-76835814 TACAGGCTATTTAACATTTTGGG + Intergenic
993185394 5:84612144-84612166 CACGTGGCATTTTACATTTAAGG - Intergenic
993351917 5:86860029-86860051 CACTTGCATTTTAACATTTGAGG - Intergenic
993523208 5:88931164-88931186 ATCGTTCCATTTAACATTTTGGG + Intergenic
994423667 5:99557636-99557658 CACTTCACATTTAATGTTTTAGG - Intergenic
994708883 5:103241578-103241600 CAGTGGTCTTTTAACATTTTGGG - Intergenic
995057883 5:107781465-107781487 CACTTACCATTTAATTATTTTGG + Intergenic
997137300 5:131340218-131340240 AAATTTCCATTTAATATTTTTGG - Intronic
1000457570 5:161470741-161470763 AATTTTCCATTTAATATTTTCGG + Intronic
1001227828 5:169960746-169960768 GATTTTCCATTTAATATTTTTGG - Intronic
1003018707 6:2490826-2490848 CACTTACCATCTACCTTTTTAGG + Intergenic
1003160763 6:3632279-3632301 AACTTTCCATATAATATTTTTGG + Intergenic
1003262514 6:4532677-4532699 CAATTGACATTTTACTTTTTTGG + Intergenic
1003301274 6:4884958-4884980 AATTTTCCATTTAATATTTTTGG - Intronic
1003960426 6:11204102-11204124 CACTTGCCATTTCACAGTTGAGG + Intronic
1007003644 6:38338351-38338373 GATTTTCCATTTAATATTTTTGG + Intronic
1008067485 6:47064621-47064643 AATTTTCCATTTAATATTTTTGG + Intergenic
1008379878 6:50829280-50829302 CACATGCCCTTTAACAGTATGGG - Intronic
1010126178 6:72434573-72434595 CAATTGCCATTTAGGATTGTTGG - Intergenic
1010334906 6:74669177-74669199 AACTTGCAATGAAACATTTTAGG - Intergenic
1012064538 6:94533888-94533910 CACTTGCTTTTATACATTTTAGG + Intergenic
1012318674 6:97814589-97814611 CATTTTCCCATTAACATTTTTGG - Intergenic
1012564642 6:100633134-100633156 AATTTTTCATTTAACATTTTTGG - Intronic
1012708601 6:102567734-102567756 AATTTTCCATTTAATATTTTGGG + Intergenic
1013107509 6:107038179-107038201 CAATTTATATTTAACATTTTGGG - Intronic
1013218449 6:108053259-108053281 AATTTTCCATTTAATATTTTTGG + Intronic
1013219216 6:108062411-108062433 AATTTTCCATTTAATATTTTTGG + Intronic
1013438895 6:110141049-110141071 AATTTTCCATTTAATATTTTTGG + Intronic
1013708067 6:112863083-112863105 AATTTTCCATTTAATATTTTTGG + Intergenic
1013815081 6:114087988-114088010 CAGTGGACATTTAACACTTTTGG - Intronic
1013848874 6:114489462-114489484 CAATTTCCATTTATCAATTTAGG + Intergenic
1016563899 6:145430249-145430271 CAAATGCCATTTCTCATTTTGGG - Intergenic
1017581791 6:155872856-155872878 CACTTCCCACTAAACATATTTGG + Intergenic
1018759537 6:166879490-166879512 CATTTTAAATTTAACATTTTTGG - Intronic
1020503608 7:8955290-8955312 AAATTTCCATTTAATATTTTGGG + Intergenic
1020701600 7:11490721-11490743 CACATGAAAATTAACATTTTAGG - Intronic
1021041481 7:15867694-15867716 AACTACCCATTTAAAATTTTTGG + Intergenic
1021408028 7:20296779-20296801 AATTTTCCATTTAATATTTTTGG + Intergenic
1021511551 7:21438674-21438696 AATATTCCATTTAACATTTTTGG - Intronic
1021846043 7:24763618-24763640 AAATTTCCATTTAATATTTTTGG + Intergenic
1022688499 7:32620417-32620439 TACTTGACATCTAAAATTTTTGG - Intergenic
1022916081 7:34954711-34954733 TACTTGACATCTAAAATTTTTGG - Exonic
1023046967 7:36218644-36218666 AATTTTCCATTTAATATTTTTGG + Intronic
1023629270 7:42147407-42147429 GACTTGCCATTTAACCTTCCCGG - Intronic
1023678804 7:42661602-42661624 AATTTTCCATTTAATATTTTTGG + Intergenic
1024765858 7:52658559-52658581 CATTTTCCATTTAAAATTTTTGG - Intergenic
1027460649 7:78448940-78448962 ACCTTGCCATTTAACAGTGTGGG + Intronic
1027840277 7:83301740-83301762 CATATGCTATGTAACATTTTGGG - Intergenic
1028446145 7:90926628-90926650 CACTTTCAAATTAACTTTTTGGG + Intronic
1028669318 7:93383140-93383162 AACTTGCCACTTAATATTTATGG + Intergenic
1028864658 7:95693678-95693700 CACTTGGCATCTACCATTCTAGG - Intergenic
1029173155 7:98644893-98644915 CTCTTTACATTCAACATTTTGGG - Intergenic
1029339401 7:99930765-99930787 AATTTTCCATTTAATATTTTTGG - Intergenic
1030253459 7:107478475-107478497 AATTTTCCATTTAATATTTTTGG - Intronic
1030731934 7:113000219-113000241 AATTTTCCATTTAATATTTTTGG - Intergenic
1030919712 7:115367099-115367121 GATTTTCCATTTAACATTTTTGG + Intergenic
1031071905 7:117171157-117171179 CACATGCCATGTGACATTTCTGG - Intronic
1033013617 7:137648700-137648722 GATTTTCCATTTAATATTTTTGG + Intronic
1033022943 7:137745420-137745442 AATTTTCCATTTAATATTTTTGG - Intronic
1035052369 7:156006646-156006668 AATTTTCCATTTAAAATTTTTGG - Intergenic
1035274381 7:157738619-157738641 CACTCGATATTTGACATTTTAGG + Intronic
1036614668 8:10379169-10379191 GACTTGCCACTTTCCATTTTTGG + Intronic
1036699810 8:11005271-11005293 AATTTCCCATTTAATATTTTTGG + Intronic
1037500817 8:19483952-19483974 AATTTTCCATTTAATATTTTTGG - Intronic
1040523205 8:48195413-48195435 AATTTTCCATTTAATATTTTTGG - Intergenic
1041512793 8:58670275-58670297 AATTTTCCATTTAATATTTTTGG - Intergenic
1041646489 8:60257974-60257996 AATTTTCCATTTAATATTTTTGG - Intronic
1041789190 8:61672951-61672973 CACTTGACAGTTAACTTTTTGGG - Intronic
1042181983 8:66099285-66099307 GGCTTGCCATTGAACATTTTTGG + Intronic
1042527381 8:69777595-69777617 AATTTTCCATTTAATATTTTTGG - Intronic
1042913930 8:73856245-73856267 CATTTTCAATTTAACATTGTAGG + Intronic
1042936064 8:74059653-74059675 CATTTGAAATTTAACTTTTTTGG - Intergenic
1043038436 8:75228572-75228594 AATTTTCCATTTAATATTTTTGG - Intergenic
1043192246 8:77240411-77240433 AACATTCCATTTAATATTTTTGG - Intergenic
1043453862 8:80394636-80394658 GATTTTCCATTTAATATTTTTGG + Intergenic
1043479919 8:80642579-80642601 AATTCTCCATTTAACATTTTTGG + Intronic
1043802642 8:84629914-84629936 AGCATGTCATTTAACATTTTTGG - Intronic
1044074526 8:87802710-87802732 AATTTTCCATTTAATATTTTTGG + Intergenic
1044323834 8:90837506-90837528 GATTTTCCATTTAATATTTTTGG + Intronic
1044951535 8:97440175-97440197 AATTTTCCATTTAATATTTTTGG + Intergenic
1045332198 8:101165009-101165031 CTCTTGCCTTTTATCTTTTTGGG + Intergenic
1045549556 8:103158808-103158830 AATTTTCCATTTAATATTTTTGG + Intronic
1045558683 8:103239724-103239746 CACTTGCCGATTACCAGTTTGGG - Intergenic
1045985577 8:108246215-108246237 AATTTTCCATTTAATATTTTTGG + Intronic
1046252183 8:111646522-111646544 AATTTTCCATTTAATATTTTTGG + Intergenic
1046254895 8:111682874-111682896 AATTTTCCATTTAATATTTTTGG + Intergenic
1047161357 8:122383735-122383757 TATTTGCCATCTATCATTTTTGG + Intergenic
1048103404 8:131380318-131380340 CAATTGCCCTTTAGCAATTTAGG + Intergenic
1048500712 8:134972354-134972376 AATTTTCCATTTAATATTTTTGG - Intergenic
1048596179 8:135868781-135868803 CACTTGCCATTTGGGATTCTAGG + Intergenic
1049130393 8:140834904-140834926 CTGTTGCCATTTAGCATTTTTGG + Intronic
1049589994 8:143454029-143454051 AATTTTCCATTTAATATTTTTGG - Intronic
1049870644 8:144972780-144972802 CAGCTGCTATTAAACATTTTGGG + Intergenic
1051079903 9:13281625-13281647 AAAATGCCATTTAAAATTTTAGG - Intergenic
1051115029 9:13684871-13684893 GATTTTCCATTTAACATTTTTGG - Intergenic
1051236825 9:15009526-15009548 CATGTGTCATTTAAGATTTTGGG - Intergenic
1051453358 9:17223227-17223249 AACTTATCATTTAATATTTTTGG + Intronic
1052193173 9:25681479-25681501 GACTTTCCATTTAATATTTTTGG + Intergenic
1052717411 9:32133508-32133530 CACTTGCCATGTGACAATCTGGG - Intergenic
1054738014 9:68775660-68775682 AATTTTCCATTTAATATTTTTGG + Intronic
1054844981 9:69785274-69785296 GACTTTCCTTTTAACCTTTTTGG + Intergenic
1054884111 9:70177454-70177476 AACTTTCCATGTAATATTTTTGG + Intronic
1055131942 9:72785796-72785818 AATTTTCCATTTAATATTTTTGG + Intronic
1055407292 9:75988153-75988175 GATTGGCCATTTAACATGTTTGG + Intronic
1055546055 9:77374577-77374599 AATTTTCCATTTAATATTTTTGG + Intronic
1056319549 9:85423488-85423510 CTGGTCCCATTTAACATTTTGGG - Intergenic
1056479789 9:86989841-86989863 CATTTGCCATTTAAAAAATTGGG + Intergenic
1056596005 9:88008065-88008087 AATTTTCCATTTAATATTTTTGG - Intergenic
1057108085 9:92439995-92440017 AATTTTCCATTTAATATTTTTGG - Intronic
1057609602 9:96528885-96528907 CACTGGCCATTTTATATCTTTGG + Intronic
1058261698 9:102841313-102841335 AATTTTCCATTTAATATTTTTGG + Intergenic
1058387541 9:104456147-104456169 CACTTCCCTTTTATTATTTTAGG + Intergenic
1059616388 9:115956038-115956060 CTTTTCCCATTTAATATTTTAGG - Intergenic
1060800385 9:126540969-126540991 AATTTTCCATTTAATATTTTTGG + Intergenic
1185947864 X:4398062-4398084 AACTTAACTTTTAACATTTTGGG + Intergenic
1186847846 X:13548815-13548837 AATTTTCCATTTAATATTTTTGG - Intergenic
1187534796 X:20131117-20131139 CACTTGGCAGTTATTATTTTTGG - Intronic
1187845725 X:23534610-23534632 AGCTTGCCTTTTAACTTTTTGGG - Intergenic
1188032465 X:25279697-25279719 CAGGAACCATTTAACATTTTTGG + Intergenic
1188512193 X:30948510-30948532 CATGTGTCATTGAACATTTTGGG - Intronic
1189737156 X:44083299-44083321 AATTTTCCATTTAATATTTTTGG - Intergenic
1190577171 X:51851819-51851841 AATTTCCCATTTAATATTTTTGG + Intronic
1190794360 X:53727039-53727061 AATTTTCCATTTAATATTTTTGG - Intergenic
1192590886 X:72358622-72358644 AATTTTCCATTTAATATTTTTGG + Intronic
1192710545 X:73579646-73579668 ATGTGGCCATTTAACATTTTAGG + Intronic
1193660133 X:84247512-84247534 AACTTTCCATGTAATATTTTTGG - Intergenic
1194288981 X:92045609-92045631 CAGTTGACATTTACAATTTTGGG + Intronic
1194292669 X:92093738-92093760 CACTAGACATTTATCATTCTTGG - Intronic
1194681147 X:96854821-96854843 AATTTTCCATTTAATATTTTTGG + Intronic
1194974647 X:100381544-100381566 CACATCCCATGGAACATTTTAGG + Intronic
1195262611 X:103148162-103148184 AATTTTCCATTTAATATTTTTGG - Intergenic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1195956926 X:110341445-110341467 AATTTTCCATTTAATATTTTTGG - Intronic
1196674306 X:118403183-118403205 GATTTTCCATTTAATATTTTTGG + Intronic
1196976924 X:121168390-121168412 CACCTGCCATTTCTCATTTAGGG - Intergenic
1197249704 X:124202243-124202265 CATTTGCCTTTAAATATTTTTGG - Intronic
1197290041 X:124644540-124644562 AACTTGCCATTTCAAAATTTTGG + Intronic
1197447550 X:126569110-126569132 AATTTTCCATTTAATATTTTTGG + Intergenic
1197802832 X:130370037-130370059 CTCTTGTCATTTAACAGTCTAGG + Intronic
1198386118 X:136131117-136131139 AATTTTCCATTTAATATTTTTGG - Intergenic
1199013135 X:142780248-142780270 CACTTCCCATTTCTCATTTTAGG - Intergenic
1200606500 Y:5270177-5270199 CAGTTGACATTTACAATTTTGGG + Intronic
1200810664 Y:7481222-7481244 CACATCCCATTTATCAATTTTGG + Intergenic