ID: 945745113

View in Genome Browser
Species Human (GRCh38)
Location 2:213711159-213711181
Sequence GAGGCAATAAGTTGGATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945745113_945745116 26 Left 945745113 2:213711159-213711181 CCAGTCATCCAACTTATTGCCTC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 945745116 2:213711208-213711230 CTTTCCTCTCAGTTATCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945745113 Original CRISPR GAGGCAATAAGTTGGATGAC TGG (reversed) Intronic
910927212 1:92409795-92409817 GAGGCAATAAAGTGAATGTCTGG - Intergenic
914217287 1:145643635-145643657 TAGGCAATAAATTTGAGGACTGG - Intronic
914469856 1:147966320-147966342 TAGGCAATAAATTTGAGGACTGG - Intronic
915795497 1:158728936-158728958 GAGGCAATAAGTTTAATTTCTGG - Intergenic
919690868 1:200527336-200527358 GAGGCAAGCAGTTCCATGACAGG - Intergenic
921462998 1:215450951-215450973 GAGGCAATAACTTAAATGACTGG - Intergenic
924396504 1:243626715-243626737 GAGGCAATAACTAGAAAGACAGG + Intronic
924637817 1:245805292-245805314 GAAGCAAGAAGCTGGATGTCAGG + Intronic
1066304467 10:34126893-34126915 CAGGGAATTATTTGGATGACAGG - Intronic
1069986028 10:72284576-72284598 GAGGAAATAAGTTGTTTAACGGG - Intergenic
1073336303 10:102713169-102713191 GTGACTATAAGTTTGATGACAGG + Intronic
1074203331 10:111259034-111259056 GATGCATTAAGCTGAATGACTGG + Intergenic
1080545112 11:33309326-33309348 GAGGCCACAAGTTGGAGGCCAGG - Intronic
1084649646 11:70481690-70481712 GAGGCACGAAATTGGATGAAGGG - Intronic
1087232138 11:95677978-95678000 GAGGCCATAAGGTGGGGGACTGG + Intergenic
1087739324 11:101869729-101869751 GAGGACAAAAGTTGGATGAGGGG - Intronic
1087739653 11:101872764-101872786 GAGGACACAAGTTGGATGAGGGG + Intergenic
1088035531 11:105309066-105309088 AGGGCTCTAAGTTGGATGACTGG - Intergenic
1090264154 11:125343565-125343587 GAAGCAAGCAGTTGGATGAAAGG + Intronic
1091954248 12:4624764-4624786 GAGTCAATAAAATAGATGACTGG + Intronic
1097368791 12:58749676-58749698 GAGGCAGTGAGGTGGAAGACTGG - Intronic
1112585708 13:100716711-100716733 GAGGCAATAAGGTGGCTGGAAGG + Intergenic
1114943035 14:27640057-27640079 GAGGCAAGAATTTGGCTCACTGG - Intergenic
1118231731 14:63957741-63957763 GAGGCAGTAACTGGGATTACAGG - Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1121215914 14:92247816-92247838 GGGGCAAGAATTTGGATGCCAGG - Intergenic
1122080059 14:99260924-99260946 GAGGCAGTGAGTTGGATCTCTGG - Intronic
1124146124 15:27126932-27126954 GGGGCAATAACTTGGAAGGCAGG + Intronic
1125718521 15:41833958-41833980 GAGCCAATCAGTAGGATGACGGG + Intronic
1126558811 15:50020749-50020771 GAGGCAATATGTTGGTGTACTGG - Intronic
1126692152 15:51296046-51296068 GAGGCTAGAAGCTGGATGGCAGG + Intronic
1129557824 15:76531823-76531845 AAGTCAATGAGTTGTATGACTGG + Intronic
1132230325 15:100177922-100177944 GAGGAAAGAAGATTGATGACTGG - Intronic
1133032150 16:3016378-3016400 GCGGCAAAAAGCAGGATGACAGG + Intronic
1133415530 16:5604248-5604270 GAAGCAATAAGATGGTAGACAGG - Intergenic
1135841669 16:25882401-25882423 GAGGAAATGAGTTGGAAGGCAGG + Intronic
1138151048 16:54657436-54657458 GAGCCAATAAATAGTATGACTGG - Intergenic
1140026978 16:71299594-71299616 GAGACTAGAAGTTGGAAGACAGG - Intergenic
1140905485 16:79405857-79405879 GAGGAAATGAGATGGTTGACGGG - Intergenic
1148193586 17:45697604-45697626 GAGGAAATGAGTTGGAGGTCTGG + Intergenic
1151570462 17:74923150-74923172 GAGGCATGAGGTTGGAGGACGGG + Exonic
1153634810 18:7104483-7104505 GAAACAATAAGAAGGATGACAGG + Intronic
1155904576 18:31434098-31434120 GAAGGAAAAAGTTGGAGGACCGG + Intergenic
1156081970 18:33346449-33346471 CAGTCAATAAGCTGGATGATGGG + Intronic
1164457480 19:28420833-28420855 GTGGCAGGAAGATGGATGACTGG - Intergenic
928517295 2:32055587-32055609 CAGGCAATAAGTGGGGTGTCAGG - Intergenic
929892748 2:45932108-45932130 GAGTCAAGAAGTTGGGTGAGGGG - Intronic
939597955 2:144150949-144150971 GAGGCAAGAAGAAGAATGACAGG + Intronic
941808272 2:169732001-169732023 GAGGCTATATGTTGGATAAGTGG + Intronic
944983497 2:205149134-205149156 GAGGAAGGAAGATGGATGACTGG - Intronic
945745113 2:213711159-213711181 GAGGCAATAAGTTGGATGACTGG - Intronic
1170027849 20:11909913-11909935 GAGGCAGTAAATTGAAGGACAGG + Intronic
1172860539 20:38046749-38046771 GAGGCAGGAGGTTGGAGGACGGG + Intronic
1177070522 21:16500372-16500394 GAGGCAGTAAGTGGAAAGACGGG - Intergenic
1182954624 22:34410717-34410739 AAGGCAATAAATGTGATGACAGG + Intergenic
951305786 3:21059948-21059970 GATGCAAAAAGTTGGGAGACTGG - Intergenic
951740825 3:25921408-25921430 GAGCCAAGAAGTGGGATGAATGG - Intergenic
956244561 3:67167628-67167650 CAGGCATTAATTTGGATGGCTGG + Intergenic
963326191 3:143866017-143866039 GAGGAAATAAGTTGAAAGAAGGG - Intergenic
965630270 3:170725803-170725825 TTGGCAATAATTTGGGTGACGGG + Intronic
972987945 4:44787897-44787919 GAAGCAATAAGTTAGCTGAAGGG - Intergenic
975921969 4:79401967-79401989 GAGAGAAAAAGTTGGAGGACAGG - Intergenic
977155720 4:93570451-93570473 GAGACAATAAGTTGGTTAAGGGG + Intronic
985845169 5:2339176-2339198 GAGGCAGGAAGGTGGCTGACAGG - Intergenic
986270013 5:6221742-6221764 GAGGGAATGAGTAGGATGATTGG + Intergenic
989422017 5:41251379-41251401 GATGCAATAGGTTGGATCACTGG + Intronic
990210496 5:53478670-53478692 GAGGGAATGAGTTGGAGGACTGG + Intergenic
993421107 5:87701540-87701562 GAGGCACCAAGATGGCTGACTGG - Intergenic
999110659 5:149118129-149118151 GAGGCAATGAGTTTGATAGCCGG + Intergenic
1004428934 6:15526025-15526047 AAGGAAATAATTAGGATGACAGG + Intronic
1008435308 6:51468886-51468908 GAGGCAGGATGTTGGATGAAAGG + Intergenic
1008595402 6:53036753-53036775 GTTGCAATCAGTTTGATGACAGG + Intronic
1010767656 6:79794774-79794796 GATGCAAGAAGTAGGATGGCAGG + Intergenic
1012505318 6:99939848-99939870 GATGCAATATCTTGGATGGCAGG + Intronic
1013195453 6:107841075-107841097 GATGCAATATGATGGTTGACAGG - Intergenic
1014405682 6:121047458-121047480 GAGGGAATAGGTTGTATGAGAGG - Intergenic
1021103390 7:16609138-16609160 GAGGCATTAAGGTGGATTATAGG + Intronic
1021290208 7:18834051-18834073 CAGGAAATAAGTTGCAAGACTGG - Intronic
1022498690 7:30869091-30869113 CAGGCACCAAGCTGGATGACAGG - Intronic
1024736682 7:52312636-52312658 GTGGCAATAACTTGCATGGCTGG - Intergenic
1025195258 7:56927570-56927592 GAGGCCTGACGTTGGATGACAGG - Intergenic
1025676694 7:63649373-63649395 GAGGCCTGACGTTGGATGACAGG + Intergenic
1031063763 7:117081911-117081933 GAGGCAATGAGTTGGGTTCCAGG + Intronic
1032642456 7:133785099-133785121 GAGGCAGTAATCTGGAAGACGGG - Intronic
1038354347 8:26813374-26813396 GAGGCAGAAAGTTAGATGAGTGG - Intronic
1038786006 8:30617001-30617023 GAGAAAATGAGTAGGATGACAGG + Intronic
1046314556 8:112482100-112482122 CAGGCAATCAGTGAGATGACAGG - Intronic
1047823890 8:128552062-128552084 GAGGCACTAGGTTGGGAGACAGG - Intergenic
1047848384 8:128828340-128828362 AATGCCATGAGTTGGATGACTGG - Intergenic
1053116921 9:35512604-35512626 CTGGCAATAAGTGGGATGATGGG - Intronic
1054986272 9:71265374-71265396 GAGGAAATCATTTGGATGAGAGG + Intronic
1186198310 X:7131564-7131586 GAGACAAGAAGTTGGAAGTCAGG - Intronic
1187706366 X:22013437-22013459 GAGGCAAGGAGATGGATGATAGG + Intergenic
1192055173 X:67766502-67766524 CAAGGAATAAGTTGGAAGACTGG - Intergenic
1194448285 X:94012832-94012854 GAGGCAATAACTTTGCTGGCAGG - Intergenic
1194974538 X:100380267-100380289 GAGGCAAAAAGGTGGGGGACAGG - Intronic
1196483100 X:116173745-116173767 GATGCAATGAGTTGAAAGACTGG - Exonic
1197816071 X:130499913-130499935 GAGGGAAAAAGTTGTAAGACGGG - Intergenic
1199321662 X:146446623-146446645 GAGGCTATAAAATGGTTGACAGG - Intergenic