ID: 945749285

View in Genome Browser
Species Human (GRCh38)
Location 2:213760785-213760807
Sequence CCTCATCCTCCAAAACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15361
Summary {0: 1, 1: 0, 2: 21, 3: 763, 4: 14576}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945749285_945749289 5 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749289 2:213760813-213760835 AGAAGCATGGTGCCAACATTTGG 0: 1
1: 1
2: 10
3: 34
4: 179
945749285_945749293 22 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG 0: 1
1: 0
2: 4
3: 21
4: 143
945749285_945749287 -8 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749287 2:213760800-213760822 GGATGAGGAATCCAGAAGCATGG 0: 1
1: 0
2: 1
3: 30
4: 336
945749285_945749294 29 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749294 2:213760837-213760859 AAGGGACATCCTATGGCAGAAGG 0: 1
1: 2
2: 7
3: 35
4: 205
945749285_945749291 11 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749291 2:213760819-213760841 ATGGTGCCAACATTTGGCAAGGG 0: 1
1: 1
2: 12
3: 54
4: 332
945749285_945749290 10 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749290 2:213760818-213760840 CATGGTGCCAACATTTGGCAAGG 0: 1
1: 2
2: 18
3: 50
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945749285 Original CRISPR CCTCATCCTCCAAAACTGTG AGG (reversed) Intronic