ID: 945749286 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:213760785-213760807 |
| Sequence | CCTCACAGTTTTGGAGGATG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2683 | |||
| Summary | {0: 1, 1: 0, 2: 11, 3: 200, 4: 2471} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 945749282_945749286 | 12 | Left | 945749282 | 2:213760750-213760772 | CCACACACTGGATAATTTATATA | 0: 1 1: 2 2: 125 3: 2000 4: 14089 |
||
| Right | 945749286 | 2:213760785-213760807 | CCTCACAGTTTTGGAGGATGAGG | 0: 1 1: 0 2: 11 3: 200 4: 2471 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 945749286 | Original CRISPR | CCTCACAGTTTTGGAGGATG AGG | Intronic | ||