ID: 945749287 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:213760800-213760822 |
Sequence | GGATGAGGAATCCAGAAGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 368 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 30, 4: 336} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
945749282_945749287 | 27 | Left | 945749282 | 2:213760750-213760772 | CCACACACTGGATAATTTATATA | 0: 1 1: 2 2: 125 3: 2000 4: 14089 |
||
Right | 945749287 | 2:213760800-213760822 | GGATGAGGAATCCAGAAGCATGG | 0: 1 1: 0 2: 1 3: 30 4: 336 |
||||
945749285_945749287 | -8 | Left | 945749285 | 2:213760785-213760807 | CCTCACAGTTTTGGAGGATGAGG | 0: 1 1: 0 2: 21 3: 763 4: 14576 |
||
Right | 945749287 | 2:213760800-213760822 | GGATGAGGAATCCAGAAGCATGG | 0: 1 1: 0 2: 1 3: 30 4: 336 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
945749287 | Original CRISPR | GGATGAGGAATCCAGAAGCA TGG | Intronic | ||