ID: 945749288 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:213760811-213760833 |
Sequence | AAATGTTGGCACCATGCTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 269 | |||
Summary | {0: 1, 1: 1, 2: 9, 3: 43, 4: 215} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
945749288_945749294 | 3 | Left | 945749288 | 2:213760811-213760833 | CCAGAAGCATGGTGCCAACATTT | 0: 1 1: 1 2: 9 3: 43 4: 215 |
||
Right | 945749294 | 2:213760837-213760859 | AAGGGACATCCTATGGCAGAAGG | 0: 1 1: 2 2: 7 3: 35 4: 205 |
||||
945749288_945749293 | -4 | Left | 945749288 | 2:213760811-213760833 | CCAGAAGCATGGTGCCAACATTT | 0: 1 1: 1 2: 9 3: 43 4: 215 |
||
Right | 945749293 | 2:213760830-213760852 | ATTTGGCAAGGGACATCCTATGG | 0: 1 1: 0 2: 4 3: 21 4: 143 |
||||
945749288_945749296 | 13 | Left | 945749288 | 2:213760811-213760833 | CCAGAAGCATGGTGCCAACATTT | 0: 1 1: 1 2: 9 3: 43 4: 215 |
||
Right | 945749296 | 2:213760847-213760869 | CTATGGCAGAAGGCATTAGATGG | 0: 1 1: 1 2: 0 3: 35 4: 265 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
945749288 | Original CRISPR | AAATGTTGGCACCATGCTTC TGG (reversed) | Intronic | ||