ID: 945749288

View in Genome Browser
Species Human (GRCh38)
Location 2:213760811-213760833
Sequence AAATGTTGGCACCATGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 9, 3: 43, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945749288_945749293 -4 Left 945749288 2:213760811-213760833 CCAGAAGCATGGTGCCAACATTT 0: 1
1: 1
2: 9
3: 43
4: 215
Right 945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG 0: 1
1: 0
2: 4
3: 21
4: 143
945749288_945749296 13 Left 945749288 2:213760811-213760833 CCAGAAGCATGGTGCCAACATTT 0: 1
1: 1
2: 9
3: 43
4: 215
Right 945749296 2:213760847-213760869 CTATGGCAGAAGGCATTAGATGG 0: 1
1: 1
2: 0
3: 35
4: 265
945749288_945749294 3 Left 945749288 2:213760811-213760833 CCAGAAGCATGGTGCCAACATTT 0: 1
1: 1
2: 9
3: 43
4: 215
Right 945749294 2:213760837-213760859 AAGGGACATCCTATGGCAGAAGG 0: 1
1: 2
2: 7
3: 35
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945749288 Original CRISPR AAATGTTGGCACCATGCTTC TGG (reversed) Intronic