ID: 945749289 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:213760813-213760835 |
| Sequence | AGAAGCATGGTGCCAACATT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 225 | |||
| Summary | {0: 1, 1: 1, 2: 10, 3: 34, 4: 179} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 945749285_945749289 | 5 | Left | 945749285 | 2:213760785-213760807 | CCTCACAGTTTTGGAGGATGAGG | 0: 1 1: 0 2: 21 3: 763 4: 14576 |
||
| Right | 945749289 | 2:213760813-213760835 | AGAAGCATGGTGCCAACATTTGG | 0: 1 1: 1 2: 10 3: 34 4: 179 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 945749289 | Original CRISPR | AGAAGCATGGTGCCAACATT TGG | Intronic | ||