ID: 945749293 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:213760830-213760852 |
Sequence | ATTTGGCAAGGGACATCCTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 169 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 21, 4: 143} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
945749288_945749293 | -4 | Left | 945749288 | 2:213760811-213760833 | CCAGAAGCATGGTGCCAACATTT | 0: 1 1: 1 2: 9 3: 43 4: 215 |
||
Right | 945749293 | 2:213760830-213760852 | ATTTGGCAAGGGACATCCTATGG | 0: 1 1: 0 2: 4 3: 21 4: 143 |
||||
945749285_945749293 | 22 | Left | 945749285 | 2:213760785-213760807 | CCTCACAGTTTTGGAGGATGAGG | 0: 1 1: 0 2: 21 3: 763 4: 14576 |
||
Right | 945749293 | 2:213760830-213760852 | ATTTGGCAAGGGACATCCTATGG | 0: 1 1: 0 2: 4 3: 21 4: 143 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
945749293 | Original CRISPR | ATTTGGCAAGGGACATCCTA TGG | Intronic | ||