ID: 945749293

View in Genome Browser
Species Human (GRCh38)
Location 2:213760830-213760852
Sequence ATTTGGCAAGGGACATCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945749288_945749293 -4 Left 945749288 2:213760811-213760833 CCAGAAGCATGGTGCCAACATTT 0: 1
1: 1
2: 9
3: 43
4: 215
Right 945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG 0: 1
1: 0
2: 4
3: 21
4: 143
945749285_945749293 22 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG 0: 1
1: 0
2: 4
3: 21
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945749293 Original CRISPR ATTTGGCAAGGGACATCCTA TGG Intronic
905816516 1:40955012-40955034 ATCTGGCTAGGGTCATCCCAGGG + Intergenic
906043568 1:42809102-42809124 AGATGGCAAGAGACATCCTCAGG + Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
907890445 1:58631624-58631646 ATTTGGCAAGGGTCATCCCATGG - Intergenic
907890698 1:58633650-58633672 ATCTGGCAAGGGTCATCCCATGG - Intergenic
909754931 1:79213733-79213755 GTTTTGCAAGGGACCGCCTAAGG - Intergenic
910219424 1:84875550-84875572 ATCTGGCAAGGGCCATCCCATGG - Intronic
912677320 1:111695873-111695895 TTTTGGCATGGTACATTCTATGG - Intronic
913291183 1:117273799-117273821 ATCTGGCAAGGGTTATCCCATGG - Intergenic
914004478 1:143720616-143720638 ATCTGGCAGGGGAAATCCTATGG - Intergenic
915015692 1:152731081-152731103 ATCTGACAAGGGTCATCCCATGG - Intergenic
919011463 1:191970680-191970702 AATTGGCAATGGACATTCTATGG - Intergenic
921383157 1:214545321-214545343 ATTTGGCCAGGGTCATCCTATGG + Intronic
923080299 1:230646871-230646893 ATTTGGGAAGTGAAATCCTAAGG - Intronic
1063635003 10:7773978-7774000 TTTTGGCAAACGACAGCCTAAGG + Intronic
1066440006 10:35429513-35429535 ATTTGACATGTGTCATCCTAGGG + Intronic
1070551191 10:77491956-77491978 ATTGGGCTTGGGACATCCCAAGG - Intronic
1074969736 10:118526239-118526261 ATCAGGCAAGGGTCATCCCATGG - Intergenic
1076029801 10:127147639-127147661 GTTTTTCAAGGGACCTCCTAAGG - Intronic
1076215230 10:128687869-128687891 TTTTGCCAATGGACTTCCTAGGG + Intergenic
1078847138 11:15128596-15128618 ACTTGGGAAGGGGCATCATAAGG + Intronic
1078942525 11:16023858-16023880 ATTGGTCAAGGGAGATCCTTAGG + Intronic
1079892095 11:26068606-26068628 ATCTGACAAGGGTCATCCCATGG - Intergenic
1081317951 11:41653691-41653713 ATTTGTCAAGGGATATTTTATGG + Intergenic
1082116985 11:48339011-48339033 ATTGGGAAAGGGACTTCCTCAGG - Intergenic
1082256809 11:50041298-50041320 ATTGGGAAAGGGACTTCCTCAGG + Intergenic
1082631540 11:55548174-55548196 ATGTGTCAAGTGCCATCCTATGG - Intergenic
1083034305 11:59622409-59622431 ATTTGGCATTGTACATTCTATGG + Intergenic
1083170036 11:60918371-60918393 ATCTGGCAAGGGTCATCCTATGG + Intronic
1091999838 12:5023003-5023025 ATATAGCAAGGGTCATCCAACGG + Intergenic
1092646424 12:10578940-10578962 ATCTGGCAAGGGTCATCCCATGG - Intergenic
1098318674 12:69218118-69218140 ATCTGGCAAGGGTCATCCCATGG - Intergenic
1099646870 12:85368544-85368566 ATTTGCAAAGAGATATCCTAGGG + Intergenic
1101833137 12:108274835-108274857 ATCTGGCATGGGCCATCCCATGG - Intergenic
1104213330 12:126711549-126711571 ATTTGTCAAGTGGCAACCTAGGG + Intergenic
1104627788 12:130373977-130373999 CTTTGGGAAGGGACAGCCTGAGG - Intergenic
1105624550 13:22100303-22100325 ATCTGGCAAGAGTCATCCTACGG - Intergenic
1106196441 13:27498071-27498093 ATTAGGCCAGGGGCGTCCTATGG + Intergenic
1114726292 14:24941294-24941316 ATGTGGCAAGGGCCATGATAGGG + Intronic
1119428280 14:74550074-74550096 CTTTGGCTGGGGACATCCTCTGG - Intronic
1119556487 14:75557395-75557417 ATCTGGCCAGGGTCATCCCATGG + Intergenic
1120471345 14:84928813-84928835 ATTAGGAAAGGGACATCTTTGGG + Intergenic
1121820505 14:96962050-96962072 ATCCAGCAAGGGTCATCCTATGG - Intergenic
1124080145 15:26486357-26486379 ATTTGTTAAGGAACATCTTAAGG - Intergenic
1126364517 15:47880631-47880653 GTTTGGTGAGGGACATCATATGG + Intergenic
1129118591 15:73380884-73380906 ATCTGGTAAGGGTCATCCTGTGG + Intergenic
1129754623 15:78089961-78089983 TCTTGCCAGGGGACATCCTAAGG - Intronic
1131280015 15:91013574-91013596 ATCTGGCGAGGGTCATCCCATGG - Intronic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1138592887 16:58012111-58012133 AGTTGGGCAGTGACATCCTATGG - Intronic
1142572632 17:884979-885001 ATCTGGCCTGGGGCATCCTATGG + Intronic
1142918467 17:3163216-3163238 ATTTCCCAAGGGACACCCCAGGG - Intergenic
1146110579 17:30085398-30085420 ATTTGGACATGGACATCTTATGG - Intronic
1147034266 17:37668573-37668595 ATTTGGCAAAGAACAGCTTATGG - Intergenic
1147306707 17:39569123-39569145 TATTGGCATGGGACATCCTAAGG + Intergenic
1147438844 17:40434830-40434852 ATCTGGCAAGGGTCCTCCCATGG + Intergenic
1147786057 17:42979719-42979741 ATTTGGGAAGGGACTACCCAGGG + Intronic
1150149272 17:62795862-62795884 GTTTGGCCAGTGACTTCCTATGG - Intronic
1153447500 18:5190056-5190078 ATTTGGCAAGGGTCACCCCATGG + Intronic
1153602582 18:6795863-6795885 ATATGGCCTGGGACATCCCAAGG + Intronic
1154936479 18:21063060-21063082 ATCTGGCAAGGGTCATTCAATGG + Intronic
1155408798 18:25519352-25519374 AAATGGCAAAGGACTTCCTAAGG - Intergenic
1157753943 18:50201566-50201588 ATTAGGCAAGGGTCATTCTCAGG + Intergenic
1157962776 18:52175312-52175334 ATTTTGTAAGTGATATCCTAAGG + Intergenic
1160630292 18:80242190-80242212 ATTTGGGAAGTCACATCTTAGGG - Intronic
1165177927 19:33943628-33943650 ATTAGGCAAGGGGCATATTAGGG - Intergenic
1166233987 19:41442735-41442757 TCTTGGCACGGGTCATCCTAGGG - Intergenic
925285302 2:2711880-2711902 ATTTGGGAACGGAAATCCTAGGG + Intergenic
927359932 2:22221358-22221380 ATCTGGTGAGGGTCATCCTATGG + Intergenic
929026208 2:37604956-37604978 ATTTTTCAAGGCACTTCCTAGGG + Intergenic
930876319 2:56221908-56221930 ATCTGGCAAGGGTCATTCCATGG + Intronic
931381045 2:61753704-61753726 ATCTGACAAGGGTCATCCCATGG + Intergenic
931937813 2:67217585-67217607 TTCTGGGAAGGGTCATCCTAAGG - Intergenic
932510839 2:72288012-72288034 ATTTGGCAAGGGACATGAAATGG + Intronic
933792898 2:85897232-85897254 ACATGGCAAGGAACTTCCTATGG - Intergenic
934638100 2:96009478-96009500 AATTTGCATGGGACATCCAAAGG - Intergenic
934795556 2:97095932-97095954 AATTTGCATGGGACATCCAAAGG + Intergenic
937992318 2:127671538-127671560 AACTGGCAAGGGACAGCCCAGGG - Intronic
938418308 2:131122950-131122972 GTGTGGCAAAGGACATCCAAAGG - Intronic
940307367 2:152240725-152240747 ATCTCGCAAGGGTCATCCCAGGG - Intergenic
940566714 2:155372372-155372394 ATTTAACAAATGACATCCTAAGG - Intergenic
940748518 2:157597437-157597459 ATTTGCGAAGGGACACCCTGCGG + Intronic
940987554 2:160063612-160063634 TGTTGGTAAGGGAGATCCTAGGG + Intergenic
941237160 2:162988828-162988850 ATTTGCCACGGAACATCCAAAGG + Intergenic
943919826 2:193691649-193691671 TTTTAGCAAGTGATATCCTAAGG + Intergenic
944184571 2:196932714-196932736 ATCTGGAGAGGGTCATCCTATGG - Intergenic
944430686 2:199630240-199630262 ACATGGCAAAGGGCATCCTATGG - Intergenic
944700631 2:202242938-202242960 ATTTGGAATGGGACATCTAAGGG - Intergenic
945035864 2:205703578-205703600 ATTTGGCAGGGGACATGATATGG + Intronic
945511587 2:210709644-210709666 ATCTGGTGAGGGTCATCCTATGG + Intergenic
945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG + Intronic
1174188353 20:48722771-48722793 GTGTGGCAGGGGACATCCTGGGG - Intronic
1174217742 20:48930160-48930182 ATCTGGCCAGGGTCATCCTATGG + Intronic
1176997077 21:15567940-15567962 ATCTGGTGAGGGACATCCCATGG + Intergenic
1177866466 21:26518501-26518523 ATCTGGCAAGGGTCATCCCAAGG - Intronic
1185133390 22:49053415-49053437 ATCTGGCAAAGGTCATCCCATGG - Intergenic
953703433 3:45213834-45213856 ATGTGCCAAGGAACACCCTAGGG + Intergenic
955115212 3:55991578-55991600 ATGTGCCAAGAGACATCCAAAGG + Intronic
955827659 3:62965311-62965333 ATTGGGGAAGGGGCATGCTATGG + Intergenic
958858281 3:99414186-99414208 ATTTGGAAAAGGAAATTCTATGG - Intergenic
960156366 3:114300696-114300718 ATTTGGCGAGGTTCATCCCACGG + Intronic
960498375 3:118404817-118404839 ATTTGGCATGATTCATCCTATGG - Intergenic
961240034 3:125402732-125402754 TCTTGGCAAGGGGCATCCAAGGG - Intergenic
965441460 3:168720451-168720473 ATCTGGCAATGGTCATCCCATGG + Intergenic
965473074 3:169119443-169119465 GATTGGAAAGGGACACCCTATGG + Intronic
967417837 3:189238889-189238911 ACTTGTCCAGGGACATCCCAGGG - Exonic
968536006 4:1130073-1130095 ATCTGGCAAGGGTCAGCCCACGG - Intergenic
972928099 4:44037519-44037541 ATTTGGCAAAGGCCATGCTTTGG - Intergenic
973696337 4:53494450-53494472 AGTCAGCAAGGGTCATCCTAAGG - Intronic
974087047 4:57272802-57272824 ATCTGGCAAGGGCAATCCCATGG - Intergenic
982214464 4:153068514-153068536 ATGTTGCAATGGACATCCTTTGG + Intergenic
984260333 4:177436937-177436959 ATCTGGCAAGGGCCATCCCAAGG - Intronic
986070743 5:4280154-4280176 ATTTGGTAAGGAAAATCTTATGG - Intergenic
987104099 5:14619953-14619975 ATTTGTTAAGGTACATCCTGGGG + Intergenic
987557611 5:19474764-19474786 ATTTAGCAAGAGCTATCCTAAGG - Intronic
990370705 5:55115218-55115240 ATTTGCCAAAGAACATTCTATGG + Intronic
990605862 5:57409334-57409356 ACTTTGCAAAGGAAATCCTAAGG - Intergenic
992480779 5:77150529-77150551 GTTTGTCAAGGGACAAACTAGGG + Intergenic
993254806 5:85576711-85576733 ATTTGGTAAGGGTCATTATATGG - Intergenic
998266575 5:140671602-140671624 CTTTGGCAAGGGACAAGTTAGGG - Exonic
1002071767 5:176682746-176682768 ATCTGGCCAAGGACATGCTATGG - Intergenic
1005095842 6:22114688-22114710 ATTTGGCAAGGCATCTCCCAAGG - Intergenic
1005602237 6:27439179-27439201 ATTTGCCAAGAAACATTCTAGGG - Intergenic
1005722656 6:28618135-28618157 ATTTAGCAGGGGACAAGCTAAGG - Intergenic
1007622126 6:43221679-43221701 ATTTGGCACAGGTCATGCTATGG - Exonic
1008745782 6:54667937-54667959 ATTGGGCAAGGCACCTCCTGCGG + Intergenic
1010932631 6:81820636-81820658 ATCTGGCAAGGGTTATCCCATGG - Intergenic
1012453097 6:99374535-99374557 ATTTAGGAGGTGACATCCTAAGG - Intronic
1012861875 6:104570104-104570126 ATCCGGCAAGGGTCATCCTATGG + Intergenic
1012956112 6:105571990-105572012 ATCTGGTGAGGGTCATCCTATGG + Intergenic
1013473263 6:110485039-110485061 ATTTGGCAAACTATATCCTATGG + Intergenic
1015518959 6:134112780-134112802 ATTTGGCAAGGGTCACCCCATGG - Intergenic
1020989424 7:15178873-15178895 ATCTGGCAAAGGTCATCATACGG + Intergenic
1021791839 7:24213675-24213697 CTTTGACAAGGGACATCCAAGGG + Intergenic
1022489228 7:30803972-30803994 ATTTGGCAAGGGAAAGACTTTGG - Intronic
1023206432 7:37755348-37755370 TTTTGGTAACGGCCATCCTAAGG + Intronic
1023557050 7:41434826-41434848 ATCTGGCAAGGGTCTTCCCATGG + Intergenic
1027989665 7:85341651-85341673 TTTTTGCATGGCACATCCTATGG - Intergenic
1031332251 7:120480687-120480709 ATCTGGCAAGAGTCATCCCATGG - Intronic
1031332465 7:120482680-120482702 ATCTGTCAAGGGTCATCCTGTGG - Intronic
1031781716 7:125976245-125976267 ATTTGGCAAAGTACATTCTTAGG - Intergenic
1035472135 7:159117204-159117226 AGATGGCAAGGGACCTTCTAGGG - Intronic
1037312603 8:17572702-17572724 ACTCGTCAAGGGACATCTTAGGG - Intergenic
1038961300 8:32523185-32523207 AGTTGGAAAGGGATGTCCTAAGG - Intronic
1039211360 8:35218649-35218671 ATCTGGCAAGTGTCATCCCAAGG - Intergenic
1040116719 8:43629956-43629978 ATTTGGGAAGGGACATTTTGGGG + Intergenic
1040767721 8:50934971-50934993 ATTGGGAAAGTCACATCCTAAGG + Intergenic
1041718620 8:60955559-60955581 ATTTGGCAAGGGTCATCCCATGG - Intergenic
1044091707 8:88010596-88010618 ATTGGGCAGGGCACATCCTGTGG - Intergenic
1044271435 8:90249178-90249200 ATGTGGTAAGGCACATGCTAGGG - Intergenic
1046130158 8:109956733-109956755 ATTTGGAAAGGGACATGCAGGGG - Intergenic
1047296602 8:123576019-123576041 ATCAGGCAAGGGTCATGCTACGG - Intergenic
1048279593 8:133095226-133095248 AGTTGGGAAGGGACATTCTCTGG + Intronic
1050733085 9:8731946-8731968 CTTTTTCAAGGGACATCTTAAGG + Intronic
1051664604 9:19456923-19456945 TTCTGGCAAGTGACATCTTAGGG + Intergenic
1055126484 9:72724269-72724291 ACCTGGCAAGGGTCATCCAATGG + Intronic
1055256593 9:74379026-74379048 ATTTAGCAATGTACATCCAATGG + Intergenic
1186532940 X:10315644-10315666 ATTTTGAAAAGGACAGCCTAAGG - Intergenic
1187282502 X:17868668-17868690 ATTGGGCAAGGATAATCCTAGGG - Intergenic
1187334590 X:18371126-18371148 ATCTGGCCAGGGTCATCCCATGG - Intergenic
1188430455 X:30101046-30101068 ATCTGGTGAGGGTCATCCTATGG - Intergenic
1189160179 X:38803128-38803150 ATATGGCAAGGGACATGAGATGG + Exonic
1189244613 X:39553886-39553908 ATCTGGCAAGGGTCATCCCATGG - Intergenic
1190510026 X:51165244-51165266 ATTTGGCAAGGGGAATTCTTTGG + Intergenic
1193473400 X:81934187-81934209 ATGTGGCAAGAAACATCCTGAGG - Intergenic
1195913069 X:109908484-109908506 ATTTGGCAAGGGTTATCCCATGG - Intergenic
1197288538 X:124626139-124626161 ATCTGGCAAAGGAAATCCTCTGG - Intronic
1197874551 X:131089335-131089357 ATTTGGAGGGGGAAATCCTAAGG - Exonic
1198009278 X:132534222-132534244 ATCTGGCAAGGGTCACCCCATGG + Intergenic