ID: 945749294 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:213760837-213760859 |
Sequence | AAGGGACATCCTATGGCAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 250 | |||
Summary | {0: 1, 1: 2, 2: 7, 3: 35, 4: 205} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
945749285_945749294 | 29 | Left | 945749285 | 2:213760785-213760807 | CCTCACAGTTTTGGAGGATGAGG | 0: 1 1: 0 2: 21 3: 763 4: 14576 |
||
Right | 945749294 | 2:213760837-213760859 | AAGGGACATCCTATGGCAGAAGG | 0: 1 1: 2 2: 7 3: 35 4: 205 |
||||
945749288_945749294 | 3 | Left | 945749288 | 2:213760811-213760833 | CCAGAAGCATGGTGCCAACATTT | 0: 1 1: 1 2: 9 3: 43 4: 215 |
||
Right | 945749294 | 2:213760837-213760859 | AAGGGACATCCTATGGCAGAAGG | 0: 1 1: 2 2: 7 3: 35 4: 205 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
945749294 | Original CRISPR | AAGGGACATCCTATGGCAGA AGG | Intronic | ||