ID: 945749294

View in Genome Browser
Species Human (GRCh38)
Location 2:213760837-213760859
Sequence AAGGGACATCCTATGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 2, 2: 7, 3: 35, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945749288_945749294 3 Left 945749288 2:213760811-213760833 CCAGAAGCATGGTGCCAACATTT 0: 1
1: 1
2: 9
3: 43
4: 215
Right 945749294 2:213760837-213760859 AAGGGACATCCTATGGCAGAAGG 0: 1
1: 2
2: 7
3: 35
4: 205
945749285_945749294 29 Left 945749285 2:213760785-213760807 CCTCACAGTTTTGGAGGATGAGG 0: 1
1: 0
2: 21
3: 763
4: 14576
Right 945749294 2:213760837-213760859 AAGGGACATCCTATGGCAGAAGG 0: 1
1: 2
2: 7
3: 35
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945749294 Original CRISPR AAGGGACATCCTATGGCAGA AGG Intronic