ID: 945749296 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:213760847-213760869 |
| Sequence | CTATGGCAGAAGGCATTAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 302 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 35, 4: 265} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 945749288_945749296 | 13 | Left | 945749288 | 2:213760811-213760833 | CCAGAAGCATGGTGCCAACATTT | 0: 1 1: 1 2: 9 3: 43 4: 215 |
||
| Right | 945749296 | 2:213760847-213760869 | CTATGGCAGAAGGCATTAGATGG | 0: 1 1: 1 2: 0 3: 35 4: 265 |
||||
| 945749292_945749296 | -1 | Left | 945749292 | 2:213760825-213760847 | CCAACATTTGGCAAGGGACATCC | 0: 1 1: 1 2: 0 3: 22 4: 163 |
||
| Right | 945749296 | 2:213760847-213760869 | CTATGGCAGAAGGCATTAGATGG | 0: 1 1: 1 2: 0 3: 35 4: 265 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 945749296 | Original CRISPR | CTATGGCAGAAGGCATTAGA TGG | Intronic | ||