ID: 945749747

View in Genome Browser
Species Human (GRCh38)
Location 2:213766853-213766875
Sequence CAGTGTTGAAAGGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945749747_945749750 6 Left 945749747 2:213766853-213766875 CCTGCAGCTTCCTTTCAACACTG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 945749750 2:213766882-213766904 ATTACCTGAGCACAAAGTCTGGG 0: 1
1: 0
2: 2
3: 9
4: 152
945749747_945749749 5 Left 945749747 2:213766853-213766875 CCTGCAGCTTCCTTTCAACACTG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 945749749 2:213766881-213766903 TATTACCTGAGCACAAAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 150
945749747_945749752 10 Left 945749747 2:213766853-213766875 CCTGCAGCTTCCTTTCAACACTG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 945749752 2:213766886-213766908 CCTGAGCACAAAGTCTGGGTTGG 0: 1
1: 0
2: 2
3: 12
4: 221
945749747_945749753 15 Left 945749747 2:213766853-213766875 CCTGCAGCTTCCTTTCAACACTG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 945749753 2:213766891-213766913 GCACAAAGTCTGGGTTGGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 217
945749747_945749754 16 Left 945749747 2:213766853-213766875 CCTGCAGCTTCCTTTCAACACTG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 945749754 2:213766892-213766914 CACAAAGTCTGGGTTGGAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945749747 Original CRISPR CAGTGTTGAAAGGAAGCTGC AGG (reversed) Intronic
900238350 1:1603136-1603158 CACTGTAGCAGGGAAGCTGCCGG + Intergenic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
907127354 1:52062667-52062689 CATTTTAGAAAGGTAGCTGCTGG + Intronic
907515494 1:54990955-54990977 CAGTGTTGGAAGGGACCTTCAGG + Intronic
909771306 1:79425497-79425519 CAGTTTTGAAAGGAAGATCCAGG + Intergenic
909902745 1:81158852-81158874 CTGTGTTGAAAGCAAGCACCAGG + Intergenic
910006253 1:82400756-82400778 CAATGTTGAGAGGAAGCTCACGG - Intergenic
910392287 1:86757514-86757536 CAGCGCTGAAAGGCAGCCGCAGG + Intergenic
913558162 1:119990723-119990745 CATTGTTGAAAGGGAACTCCGGG - Intronic
913574844 1:120161879-120161901 CAGTGCAGAAAGCAAGGTGCAGG - Intronic
913639680 1:120799729-120799751 CATTGTTGAAAGGGAACTCCGGG + Intergenic
914278768 1:146150214-146150236 CATTGTTGAAAGGGAACTCCGGG - Intronic
914296109 1:146326719-146326741 CAGTGCAGAAAGCAAGGTGCAGG - Intergenic
914539815 1:148601156-148601178 CATTGTTGAAAGGGAACTCCGGG - Intronic
914557151 1:148777509-148777531 CAGTGCAGAAAGCAAGGTGCAGG - Intergenic
914615683 1:149352721-149352743 CAGTGCAGAAAGCAAGGTGCAGG + Intergenic
914626831 1:149470064-149470086 CATTGTTGAAAGGGAACTCCGGG + Intergenic
915591773 1:156874937-156874959 CAGCGTAGAAAGGAAGAGGCAGG - Exonic
918310342 1:183281205-183281227 CAGTGATGAGAGAAAGCTGAGGG - Intronic
918437660 1:184533202-184533224 CAGTCAAGAGAGGAAGCTGCAGG - Intronic
918545174 1:185674105-185674127 CAGTGTTCCAAAGAAGCTGAAGG - Intergenic
920388678 1:205585386-205585408 CAGTGTTGTAAACAAGCTTCAGG + Intronic
922332462 1:224589482-224589504 CAGCTTTGAAAAGAGGCTGCAGG - Intronic
923204850 1:231749164-231749186 GAGTGTTGAAGGGAGGGTGCTGG - Intronic
923274541 1:232385065-232385087 CAGTGTAGAAAAGGAGGTGCAGG + Intergenic
923939934 1:238810287-238810309 CAGGGTTGAAAGAGAGGTGCGGG - Intergenic
1062816930 10:507711-507733 CAGTACTGAAAGGAATGTGCGGG - Intronic
1063092217 10:2875247-2875269 CAGGGTGGAAAGGCAACTGCAGG + Intergenic
1063752024 10:8960532-8960554 CAATATTGAAATAAAGCTGCAGG + Intergenic
1064023138 10:11825281-11825303 CAGTGTTGTGGGGCAGCTGCCGG + Intronic
1064581378 10:16796413-16796435 CAGTGTTGAGAGAAAGGTGGAGG - Intronic
1065081788 10:22136447-22136469 CAGGGATGATAGGAAGCAGCAGG - Intergenic
1068663465 10:59647624-59647646 CAGTGTTGAAGGGAGAGTGCTGG - Intergenic
1070569145 10:77627880-77627902 CAGTGGTGGAAGGAAGCTTTGGG - Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1073145942 10:101282054-101282076 CTGTCTTGAGAGGAAGCTACTGG + Intergenic
1073301646 10:102474607-102474629 CAGTGTTGGAAGCAAGCTGTTGG + Intronic
1075837947 10:125472411-125472433 CAGTGATGAAAGTGAGCTGAAGG - Intergenic
1076403726 10:130199197-130199219 CAGTGGTGAGAGGAAGGGGCCGG - Intergenic
1076915546 10:133421624-133421646 CAGTGTGGACGGGAGGCTGCAGG + Exonic
1077027163 11:445999-446021 CACAGTTAAAAGGAGGCTGCAGG - Intergenic
1079574695 11:21988974-21988996 AAGTGATGTAGGGAAGCTGCAGG - Intergenic
1080896678 11:36453965-36453987 CAGAGTTGCAAGGAAGCTGATGG + Intronic
1081184334 11:40023528-40023550 AAGTGTTGAGAGGAAACAGCAGG - Intergenic
1082006511 11:47422349-47422371 CTGTTTTGAAAGGAACATGCTGG + Intronic
1083980570 11:66164968-66164990 CAGTGTGGAGACCAAGCTGCAGG + Intronic
1086129783 11:83389451-83389473 CTTTGTTGAAGGGAAGCTACGGG + Intergenic
1088972781 11:114788180-114788202 CCGTGTTGAAAGGCTGATGCTGG - Intergenic
1091074847 11:132605915-132605937 CAGAGCTGAAAGGAAGCTGCTGG - Intronic
1094388404 12:29920742-29920764 AAGAGATGAAATGAAGCTGCTGG - Intergenic
1094412785 12:30185103-30185125 CTGAGTTGAAATGTAGCTGCAGG + Intergenic
1094487014 12:30933485-30933507 CAGTGCTGAGAGGAAGGAGCTGG - Intronic
1095047192 12:37520484-37520506 CTATGATGATAGGAAGCTGCAGG - Intergenic
1095829651 12:46570319-46570341 GAGTGTTGAAAGGAGAGTGCTGG - Intergenic
1096103685 12:48984341-48984363 CAGAGTTGAGATGAAGCAGCAGG + Intergenic
1096407211 12:51352595-51352617 TAGTGTTAAAAGAAAGCTCCTGG - Exonic
1096805277 12:54137104-54137126 CAGTTTTAAAAGGAAGCTGCAGG - Intergenic
1097867166 12:64568486-64568508 CCGTGAGGAAAGGGAGCTGCAGG - Intergenic
1100332369 12:93596523-93596545 GAATGTTCAAAGGAAACTGCAGG + Intergenic
1101791477 12:107931636-107931658 CAATGGTCGAAGGAAGCTGCAGG + Intergenic
1102739821 12:115197202-115197224 CAGGGTTGCAAGGAAGCATCAGG - Intergenic
1102770260 12:115470197-115470219 TAGTGTTTAAAGGAAGCTGAGGG - Intergenic
1102805121 12:115773061-115773083 CAATGTTTAGAGGAAGCTTCAGG + Intergenic
1104199979 12:126579131-126579153 CATAGCTGAATGGAAGCTGCTGG + Intergenic
1104245130 12:127032321-127032343 CCCTGTTGAAAGGGAGCAGCTGG - Intergenic
1104437742 12:128769235-128769257 CCATGTTGTAAGGAAGCTGAGGG - Intergenic
1105545681 13:21348973-21348995 CAGTGATGAAACGCAGCAGCTGG - Intergenic
1105565416 13:21541740-21541762 AAGTGTTGAAAGTAGGCCGCAGG - Intronic
1107593971 13:41942444-41942466 CAGGGGTGAAAGTTAGCTGCGGG - Intronic
1108985452 13:56580596-56580618 CAGTGTGGAATGGAAGATGGAGG + Intergenic
1110390989 13:74973820-74973842 TAGAGTTGAGAGGAAGATGCAGG + Intergenic
1110454363 13:75673505-75673527 CAGGGTTGCAAGGTAGCTGTTGG - Intronic
1114382306 14:22220164-22220186 CAGAGATGACAGGGAGCTGCAGG - Intergenic
1114876662 14:26728594-26728616 CAGTGTCGAAAGAATGCCGCAGG - Intergenic
1115509005 14:34121329-34121351 CAGTGTTTGAGGGAACCTGCAGG - Intronic
1116888125 14:50240357-50240379 CAGAGTTGAAGGGAATCTGGAGG - Intronic
1117613220 14:57505184-57505206 CAGGGTGGAAGGGAAGCTCCAGG + Intergenic
1118012741 14:61626559-61626581 CAGTGTAGAAAGGAGACTGCAGG - Intronic
1121414780 14:93771863-93771885 CAGTGCTGAGAGGCAGCTTCAGG - Intronic
1122379349 14:101290489-101290511 CCCTGTACAAAGGAAGCTGCGGG + Intergenic
1123427883 15:20187671-20187693 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
1123991793 15:25689033-25689055 CAGTGTTAAAAAGAGGCTGATGG + Intronic
1124010835 15:25837464-25837486 CAGAGTAGAAAGGAGGCTCCCGG + Intronic
1124659909 15:31538775-31538797 TTATGTTGAAAGGAACCTGCTGG - Intronic
1125050682 15:35295009-35295031 CAGAGTTGAAGGGCAGTTGCTGG + Intronic
1125051657 15:35305955-35305977 CAGTTTTGAAAGGAACCAGCTGG - Intronic
1125750841 15:42027172-42027194 CAGTGTTGACAGGAAGAGGCAGG + Intronic
1126212420 15:46114728-46114750 CAGTGTGGAAGGGAAGCAACTGG - Intergenic
1127495397 15:59506532-59506554 CTCTGTTGAGAAGAAGCTGCTGG - Intronic
1128058322 15:64717512-64717534 CAATGTTGAAAGGCAGCTTTGGG - Intergenic
1128617305 15:69120350-69120372 CAGTGTTTAATGGAAGGGGCAGG + Intergenic
1128675939 15:69608431-69608453 GAGTGTGGAAAGGAATCTGGAGG + Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129361522 15:75027605-75027627 GACTGGTGAAAGGAAGCGGCAGG - Intronic
1129660046 15:77548417-77548439 CAGTGCTGGGAGGAAGCTCCTGG - Intergenic
1131666006 15:94571675-94571697 CAGTGTGGTATGGAGGCTGCGGG + Intergenic
1132198202 15:99929567-99929589 CTGAGCTGAAATGAAGCTGCTGG - Intergenic
1132217594 15:100077721-100077743 CAGTGTTGAATGGGAGTAGCAGG - Intronic
1132625849 16:891143-891165 CAGTGCTGACAGGCAGCTGTGGG + Intronic
1135003331 16:18796378-18796400 CATTGTTGAAAAGAAGTTCCAGG - Intronic
1135109404 16:19678996-19679018 TTGTGTTGAAATGAAGTTGCTGG + Intronic
1135842448 16:25888958-25888980 CAGTTCTGAAAGGAAGCGGTAGG - Intronic
1136856412 16:33662090-33662112 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1139648799 16:68351409-68351431 AAGTGTGGAAGGGAACCTGCAGG - Intronic
1140702378 16:77592872-77592894 CAGTGTTAAAAGGAAAGTGAAGG - Intergenic
1203117992 16_KI270728v1_random:1510567-1510589 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1143178675 17:4970887-4970909 GAGAGTTGAAAGGGAGCTGGGGG - Intronic
1143691336 17:8568769-8568791 CAGTGTTGAAGGTGAGCAGCTGG + Intronic
1144620607 17:16816131-16816153 CAGTGTTGACAGACAGGTGCAGG - Intergenic
1144885035 17:18452016-18452038 CAGTGTTGACAGACAGGTGCAGG + Intergenic
1145147184 17:20492361-20492383 CAGTGTTGACAGACAGGTGCAGG - Intergenic
1145410486 17:22656993-22657015 CTATGATGATAGGAAGCTGCAGG - Intergenic
1147571995 17:41577030-41577052 CAGTGTTGACAGACAGGTGCAGG - Intergenic
1148346960 17:46909803-46909825 TTCTGTTGAAAGGAAGGTGCTGG - Intergenic
1148987130 17:51632748-51632770 CAGTGTGGAAAGAAAGATGGAGG - Intronic
1149541879 17:57473651-57473673 CAGTGGTGAGAGGAAGGTTCCGG - Intronic
1149655641 17:58308450-58308472 CAGCGTGGAATGGGAGCTGCTGG + Intronic
1150918116 17:69456897-69456919 AAGTGTCCAAAGGAAGCAGCAGG - Intronic
1151048140 17:70945867-70945889 AAGTGCTGAAAGGTAGCTGTTGG - Intergenic
1151756755 17:76079643-76079665 CTGTGTTGAAAGAACGCAGCAGG - Intronic
1155710170 18:28867417-28867439 CAGTCTTAAAAGTAAGCTGAGGG - Intergenic
1155948388 18:31882025-31882047 CAGTGTGGAAAGGAATTTGGAGG + Intronic
1158426036 18:57340363-57340385 TTGTGGTGAATGGAAGCTGCAGG + Intergenic
1159741653 18:72178704-72178726 CAGTGTTGAAAGGGATCTGGAGG - Intergenic
1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG + Intergenic
1160122336 18:76142049-76142071 CAGTGTGGAAACAAAACTGCTGG + Intergenic
1161906857 19:7163237-7163259 CAGTGTGCAAAGAAAGCTGGTGG + Intronic
1165682077 19:37786100-37786122 CTGTGATGATAGGAAGCTGCAGG - Intronic
1166161299 19:40955491-40955513 CTATGTTGAAGGGAAGCTTCAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
925026025 2:607914-607936 CAGTGTTGTGAGGAAGGTGGAGG + Intergenic
925875953 2:8311384-8311406 CAGTGTTGAGAGGGAAGTGCAGG + Intergenic
926212687 2:10882832-10882854 TATTATGGAAAGGAAGCTGCTGG - Intergenic
927155062 2:20216579-20216601 CAGGGATGACAGGAAGCTACTGG + Intronic
928204545 2:29274650-29274672 CTGTGTTGAAAGGAAGCTTTGGG + Intronic
929712223 2:44277037-44277059 TAGTGATTAAAGAAAGCTGCAGG - Intronic
930260175 2:49136970-49136992 CAGTGTTGAATGGAAGTAGTGGG - Intronic
930376864 2:50578907-50578929 CAGTGTTGAGAGCAAGTTGTAGG - Intronic
931988063 2:67760039-67760061 TAGTATTGAAAGGAAGCTTGGGG - Intergenic
932297886 2:70641998-70642020 CTGAGATGAAAGGAAGCTCCAGG - Intronic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
934847998 2:97675085-97675107 CAATGCTGAGAGGAAGCAGCTGG + Intergenic
935955841 2:108375906-108375928 CAGAGTTGAAAGGGAGGTTCAGG + Intergenic
936163708 2:110102976-110102998 CAGTGTTGGAGGGAGGCTGGTGG + Intronic
937032742 2:118753993-118754015 TAGTGGGGAAAGGAGGCTGCTGG - Intergenic
937251682 2:120527858-120527880 CAGTTTTGACAGGAAGAGGCTGG - Intergenic
937924880 2:127160406-127160428 CAGTTTTGCATGAAAGCTGCTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
939425521 2:142031680-142031702 GAGTTTGGAAAGGCAGCTGCGGG - Intronic
940907310 2:159180727-159180749 CAATGTTGGAAGGAAGCTACTGG + Intronic
941037777 2:160586189-160586211 CCTTTTTGAAAGGAAGCTTCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942785955 2:179703021-179703043 CTGTGTTGAAAAGAGGCTGAAGG - Intronic
943188876 2:184650744-184650766 CAGAGTTGAAAGGTCTCTGCAGG + Intronic
943276361 2:185872044-185872066 CATTGTTGAAACGAATCTGGAGG + Intergenic
943625131 2:190189913-190189935 CAATGTAGAAAGGAAGCAGCAGG + Intronic
945357886 2:208860506-208860528 CAGTGTGGAAGGGAAGCTTGGGG + Intergenic
945706690 2:213243529-213243551 AAGTGCTTACAGGAAGCTGCAGG + Intergenic
945749747 2:213766853-213766875 CAGTGTTGAAAGGAAGCTGCAGG - Intronic
948903048 2:240965758-240965780 CAGTGTCACCAGGAAGCTGCAGG + Intronic
1169686912 20:8285671-8285693 CATTATTGAAATGAAGCTCCAGG + Intronic
1170159358 20:13296332-13296354 CAGTGATGAATGGGAGCTGGTGG + Intronic
1170974610 20:21150390-21150412 CAGTGATTCAAGGAGGCTGCTGG - Intronic
1171541752 20:25963946-25963968 CTATGATGATAGGAAGCTGCAGG - Intergenic
1171799306 20:29596367-29596389 CTATGATGATAGGAAGCTGCAGG + Intergenic
1175263185 20:57687545-57687567 CAGTGGGGAGAGGAAGCTCCTGG - Intronic
1175676686 20:60952193-60952215 CAGGTTTGAAATGCAGCTGCAGG - Intergenic
1178126014 21:29516418-29516440 CAGTCTTGAAAGGAGGGTGTGGG + Intronic
1179798957 21:43801874-43801896 GAGTGCTGACAGGAAGCTCCAGG + Intronic
1180701613 22:17784391-17784413 CACTGGGGAAAGGGAGCTGCTGG + Intergenic
1181776193 22:25161608-25161630 GAGTGCTGGAAGGGAGCTGCTGG + Intronic
1182253767 22:29023269-29023291 CAGGGTTGACAGGAAGCAGTTGG + Intronic
1183208561 22:36435672-36435694 CTGTGTTGAAAAGAAGCTAGAGG - Intergenic
1184585001 22:45441969-45441991 GAGTGGTGAAAAGAAGCTGGAGG + Intergenic
1184694255 22:46131009-46131031 CAGTGTGGACAGGAAGCTGGTGG + Intergenic
1184956191 22:47888061-47888083 CAGTGTTCACAGCCAGCTGCAGG - Intergenic
1185180570 22:49358452-49358474 CAGGTTTGACAGGAGGCTGCTGG - Intergenic
949929128 3:9064521-9064543 CAGTGCGGAAAGCAAGCTGAAGG - Exonic
950236604 3:11326983-11327005 CAGTTTTGTATGGAAGCTTCAGG + Intronic
951052854 3:18113997-18114019 ACGTGCTGAAAGGGAGCTGCAGG - Intronic
951097435 3:18648367-18648389 CAGTGTAGAATGGAAGCAGCAGG - Intergenic
951555139 3:23913868-23913890 CAGTGTTGAAAGGAACCTAAAGG - Intronic
953519442 3:43627360-43627382 CAGTCTACCAAGGAAGCTGCTGG + Intronic
957805540 3:85143784-85143806 CAGTGTTGAAAATAAACTGAAGG - Intronic
959585067 3:108018275-108018297 GAGTGATGAAAGGAAGGGGCTGG - Intergenic
959891721 3:111563373-111563395 CATTGTGGAAAAAAAGCTGCTGG + Intronic
960635813 3:119783114-119783136 CAGAGTTGAAAGGATGCTAAGGG + Intronic
960635837 3:119783360-119783382 CAGAGTTGAAAGGATGTTGTAGG - Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962644753 3:137426144-137426166 CAGTGTTGAATGGAAGTGGTGGG - Intergenic
963372083 3:144413065-144413087 GAGTGTTGAAGGGAAAGTGCTGG - Intergenic
963956099 3:151255584-151255606 CACTATAGAAGGGAAGCTGCAGG - Intronic
964624888 3:158749326-158749348 CAGAGTTGAAAGGAATCTTGGGG + Intronic
968424557 4:513682-513704 CGGCGGTGAAAGGATGCTGCTGG + Intronic
969171874 4:5370523-5370545 CAGTGTGTAAAAGAAGCTTCTGG + Intronic
969289994 4:6232735-6232757 CAGTGGGGAAAGGGAGTTGCAGG + Intergenic
976857052 4:89616677-89616699 AGATGTGGAAAGGAAGCTGCAGG - Intergenic
977836809 4:101654966-101654988 CAGTGTCTTAAGGAAGTTGCAGG - Intronic
978152507 4:105453978-105454000 CATTATTGAAATGAAGCTCCAGG + Intronic
978417238 4:108489317-108489339 CAGTGTGGAAAGGACGTGGCTGG - Intergenic
978705606 4:111706188-111706210 CAGTATTGAAAAGAAGTTGTAGG + Intergenic
979929834 4:126617046-126617068 CAGTCTTGGAAGGGACCTGCAGG - Intergenic
981755382 4:148136610-148136632 CAGTGGTCAAGGAAAGCTGCCGG - Intronic
984639015 4:182143378-182143400 CACTGTGGAAAGGAAGGCGCGGG + Intergenic
986553739 5:8988543-8988565 CAATGATAAAAGGAAACTGCAGG - Intergenic
987427297 5:17787531-17787553 CACTTTTAAAAGCAAGCTGCGGG - Intergenic
988854797 5:35217466-35217488 GAGTTTAGAAAGGAAGCTCCAGG + Intronic
989697919 5:44225419-44225441 CAGTGTAGAAAATAAGCAGCTGG - Intergenic
991045423 5:62217989-62218011 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
995027084 5:107436583-107436605 CAGCTTTGATAGGAAGCTCCTGG - Intronic
995082159 5:108064827-108064849 CTCTGCTGGAAGGAAGCTGCAGG - Intronic
995082167 5:108064871-108064893 CTCTGCTGGAAGGAAGCTGCAGG - Intronic
995679722 5:114703614-114703636 CAGTGTTGAAGGGCACCCGCGGG + Intergenic
996301654 5:121994436-121994458 CAGAGTTGAAAGGAAACATCAGG - Intronic
1002711378 5:181197247-181197269 CCCTGTGGGAAGGAAGCTGCAGG - Intronic
1003142662 6:3484593-3484615 CAGAGTGGAAAGAGAGCTGCTGG + Intergenic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1004966245 6:20855075-20855097 GAGTGTTAAAGGGACGCTGCTGG - Intronic
1006751734 6:36382471-36382493 CCGTGTTGAAATGCAGATGCTGG - Intronic
1007176785 6:39902605-39902627 CAATGTTGGAAGGATGATGCAGG + Exonic
1007333748 6:41136237-41136259 CTGTGTTGAAAGTAACCTGAAGG + Intergenic
1010474185 6:76265563-76265585 GAGTGTGGAAAGGGAGCTCCAGG + Intergenic
1010851405 6:80782212-80782234 GAGTGTTGAAGGGAAGAAGCCGG - Intergenic
1010963215 6:82171466-82171488 CATTGTTGAAAGGACACCGCAGG - Exonic
1012509641 6:99988446-99988468 CAGTGTGCAAAAGAGGCTGCTGG - Intronic
1012581884 6:100879946-100879968 CTGTCTTAAAAGGAGGCTGCTGG + Intronic
1013795146 6:113879514-113879536 CAGTGTGAAAAGAAAGCTCCTGG - Intergenic
1015103755 6:129511807-129511829 CAATGTTGATGGGAAGCTTCTGG - Intronic
1016911244 6:149201293-149201315 CAGTGAAGACAGGGAGCTGCGGG - Intergenic
1019394937 7:812968-812990 GAGTGGTGAAAGGAACTTGCCGG - Intergenic
1021551981 7:21880344-21880366 CAGTGATGAAATGAAGATGATGG + Intronic
1021606522 7:22414409-22414431 CAGTGTTGAGTGGAAGGTGGTGG - Intergenic
1024376438 7:48643932-48643954 CAGTGTTCATAGGAATCTCCGGG - Intronic
1024557439 7:50615561-50615583 CAGAGGTGAAAGGGAGCTGGCGG - Intronic
1025033344 7:55574620-55574642 CAGTTTTGCAGGGAAGCTACAGG - Intergenic
1025293205 7:57750269-57750291 CTATGATGATAGGAAGCTGCAGG - Intergenic
1032780133 7:135158695-135158717 CAGTGTGGAAAAGAAGCTGTGGG + Intronic
1032895841 7:136249991-136250013 CAGTGATGACAGGGAGATGCTGG - Intergenic
1033166582 7:139043641-139043663 CAGTGTACAAAGCATGCTGCTGG + Exonic
1033927309 7:146479165-146479187 TAGTTTTGAATGGAGGCTGCAGG + Intronic
1035475254 7:159139263-159139285 CAGTGTCAAAAGGAGGCTGCTGG - Intronic
1036693812 8:10961641-10961663 CAGTGTTGCCAGGAAGCTGGAGG - Intronic
1038530952 8:28317621-28317643 CTGTGTCGAGAGGAGGCTGCTGG + Intronic
1040537782 8:48324591-48324613 AAGTTTTGAAAGAAAGATGCTGG + Intergenic
1041117365 8:54553212-54553234 CAGTTTTTAAAGAAAGCTGGGGG + Intergenic
1041165143 8:55084406-55084428 CAGAGTTGAAATGAAACTCCTGG + Intergenic
1042721393 8:71830507-71830529 CTGGGGTGAAAGGAAGCTGGTGG - Intronic
1043489057 8:80729658-80729680 CAGTGTTGGAACCAATCTGCAGG - Intronic
1046805476 8:118474936-118474958 AATTGTTGAAAAGAACCTGCTGG + Intronic
1047803339 8:128332678-128332700 CAGTGTTGACTGCAAGTTGCGGG + Intergenic
1048398227 8:134035731-134035753 CAGTATTGACAGGCACCTGCTGG + Intergenic
1049955731 9:690873-690895 CAGTGAGAAAAGGAACCTGCTGG - Intronic
1051286163 9:15499042-15499064 CAGAGCTGAAAGGAAACTGAGGG + Intronic
1053453858 9:38215519-38215541 CAGTGTTAAATGGATGCTCCAGG - Intergenic
1053659314 9:40255568-40255590 CAGTGTTGCAAAGATGATGCAGG - Intronic
1053909685 9:42884932-42884954 CAGTGTTGCAAAGATGATGCAGG - Intergenic
1054371441 9:64401870-64401892 CAGTGTTGCAAAGATGATGCAGG - Intronic
1054525284 9:66120648-66120670 CAGTGTTGCAAAGATGATGCAGG + Intronic
1054679062 9:67891585-67891607 CAGTGTTGCAAAGATGATGCAGG - Intronic
1055473981 9:76643231-76643253 CTGTGTTGAAAGGAAGCTCATGG - Intronic
1055781348 9:79824703-79824725 CAGAGTTGATTGGGAGCTGCAGG + Intergenic
1056801576 9:89695722-89695744 CAGTCTTAAAATTAAGCTGCAGG - Intergenic
1057013125 9:91625029-91625051 CAGCGTTGAATAGAAGTTGCTGG + Intronic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1059520058 9:114932576-114932598 GATTGTTGAATGGAAGCTGTGGG + Intergenic
1060991853 9:127854089-127854111 CAGTGTTGAAAGAAAGCCTCGGG - Intronic
1062664050 9:137657357-137657379 CAGTGTTGAGAGTTGGCTGCAGG + Intronic
1185637488 X:1563644-1563666 CAGTGTAGAAAGATAGCTGGAGG + Intergenic
1186293331 X:8122403-8122425 CAGCGTGGAAAGGGAGCTGAGGG - Intergenic
1186350965 X:8739272-8739294 GAGTGTTGAAAGGTAGTTTCTGG - Intergenic
1188237859 X:27751505-27751527 CAGTGTAGACAGGAAGCCACAGG - Intergenic
1189309101 X:40007684-40007706 TAGTCATGAAAGGAAGCCGCGGG + Intergenic
1191129684 X:56994916-56994938 CCGTTTGGAAAGGCAGCTGCAGG - Exonic
1197811208 X:130445066-130445088 CAGTGTTGAAAAGAAGCGAGTGG - Intergenic
1198264256 X:134994833-134994855 GAGTGCTGAAATGAGGCTGCAGG - Intergenic
1199593814 X:149491487-149491509 CAGTGATGAGAAGAAGCTGGTGG - Intronic
1199720595 X:150540548-150540570 CAGTGGTGAAGTCAAGCTGCAGG + Intergenic
1200143551 X:153913846-153913868 CTGCGTTGAAATGGAGCTGCGGG - Exonic
1202109981 Y:21408200-21408222 CAGTGTGGAAAGGGACCTGAGGG - Intergenic