ID: 945752055

View in Genome Browser
Species Human (GRCh38)
Location 2:213799793-213799815
Sequence CAGAATAAATATATGGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945752051_945752055 23 Left 945752051 2:213799747-213799769 CCATAATTGAGGATATCAAGCCA 0: 1
1: 1
2: 0
3: 6
4: 105
Right 945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG 0: 1
1: 0
2: 1
3: 21
4: 201
945752052_945752055 3 Left 945752052 2:213799767-213799789 CCAAATTGTTTTGTATAAAAGTG 0: 1
1: 0
2: 4
3: 27
4: 392
Right 945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG 0: 1
1: 0
2: 1
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945752055 Original CRISPR CAGAATAAATATATGGGTTC CGG Intronic
900284511 1:1892552-1892574 CAGCAGAAATAGCTGGGTTCAGG - Intergenic
900800487 1:4734149-4734171 CAGAACAAGTGCATGGGTTCAGG - Intronic
901578850 1:10223872-10223894 CAGAAAAAATATTTAGGTTTAGG + Intronic
902957962 1:19939545-19939567 CCAAATAGAAATATGGGTTCTGG + Intergenic
904192659 1:28759241-28759263 GATAATAAATATATAGGTACTGG + Intronic
905020672 1:34808896-34808918 CAGAAGAAATCTAAGTGTTCAGG - Intronic
905521067 1:38600782-38600804 GAAAATAAATATATTGATTCTGG + Intergenic
905643088 1:39605598-39605620 CATAATAAATAAATGGGTCCTGG - Intergenic
907032022 1:51181910-51181932 TGGAATAAACATATGGGTACGGG - Intergenic
908342665 1:63197772-63197794 CAGAATTAATATTTGGACTCTGG - Intergenic
908478518 1:64513029-64513051 CAGAATAAAGATTTGGACTCTGG - Intronic
909094399 1:71269903-71269925 CAGAATAAACATATGTTTTCAGG + Intergenic
909174528 1:72339204-72339226 CAGAAAAAATAATTGGGTACTGG + Intergenic
915116547 1:153604631-153604653 CTGAATCAATATATTAGTTCTGG + Intergenic
916089443 1:161295964-161295986 CAGCCAGAATATATGGGTTCAGG + Intergenic
916285626 1:163101855-163101877 CAGAAGATGTGTATGGGTTCAGG + Intergenic
916850819 1:168701787-168701809 CTGAATAAATATATGGCCTGGGG + Intronic
917686326 1:177419734-177419756 AAGAAGAAATATCTGTGTTCAGG - Intergenic
917918696 1:179730656-179730678 CACAAAAAATATATAGATTCTGG - Intergenic
919009794 1:191945515-191945537 AAGAATAAATATTTTGGTTTTGG + Intergenic
919244789 1:194968358-194968380 AGGAATAGATATTTGGGTTCAGG + Intergenic
919541687 1:198854464-198854486 CAGAATAAAAATGTGGTTACTGG + Intergenic
919725460 1:200879898-200879920 CAGATTAAAAAAATGAGTTCTGG + Intergenic
922637919 1:227194960-227194982 CAGAATGAAGATATTGTTTCAGG + Intronic
1067744186 10:48922851-48922873 CAGAACAAATCTATGGTTGCAGG + Intronic
1071225529 10:83524180-83524202 CAGGATAATTATAGGGGTTGAGG - Intergenic
1071675538 10:87652287-87652309 GAGAAGAAATATATGTGTTGGGG - Intergenic
1072283643 10:93893377-93893399 AAGAACATATAAATGGGTTCTGG + Intergenic
1072612159 10:97024967-97024989 CATAAAAAAAATATGGGTGCAGG + Intronic
1072918581 10:99556474-99556496 CATAATAAATATATTGGATGGGG + Intergenic
1073704645 10:105969582-105969604 CAGCCCAAATATATGGGTTAAGG + Intergenic
1075953985 10:126506579-126506601 CAGAATCAATCTCTGGGGTCTGG - Intronic
1078556129 11:12327598-12327620 CAGGAGAAATATATGGGTATTGG + Intronic
1078556154 11:12327845-12327867 CAGGAGAAATATATGGGTATTGG + Intronic
1078650179 11:13183797-13183819 CAGAATAAATCTGTGGATACTGG - Intergenic
1078713837 11:13820458-13820480 CACAATAAACATATGTGTGCAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079648702 11:22899158-22899180 GAGGCTAAATATATGGGCTCAGG + Intergenic
1080533734 11:33201317-33201339 AAGAATACATATATAGGGTCAGG - Intergenic
1080647647 11:34198495-34198517 GAGAATGAATATATGGGGTCAGG - Intronic
1081417640 11:42834971-42834993 CTGAATAAAAATGGGGGTTCTGG + Intergenic
1083211660 11:61191381-61191403 CAGCACAAATATATTGGTTAAGG + Intergenic
1086047716 11:82552363-82552385 GATAATAAATATAAGGCTTCTGG + Intergenic
1086270334 11:85055775-85055797 GAGAGTAAAAAAATGGGTTCAGG + Intronic
1087946553 11:104166637-104166659 CAGAATAATTGGTTGGGTTCAGG - Intergenic
1088542825 11:110931147-110931169 CACAATAAAAATTTGGGTTTGGG - Intergenic
1091962552 12:4710150-4710172 CAGAACTAAAATATGGGGTCTGG - Intronic
1092466184 12:8734380-8734402 GAAAGTAAATATATTGGTTCTGG + Intronic
1094249501 12:28342754-28342776 AAGACTACATATGTGGGTTCAGG + Intronic
1094270871 12:28612777-28612799 CATAAGAAATATATGGCATCTGG + Intergenic
1095309290 12:40678663-40678685 CAGAGTAAATATATGCATTAAGG - Intergenic
1096050178 12:48600605-48600627 CAAAATGAATATATGGTTTTAGG - Intergenic
1097990544 12:65827062-65827084 CTGGATAAATATTTGGGATCTGG + Intronic
1098414749 12:70220286-70220308 TAGAATAAATTTATTGATTCTGG + Intergenic
1098568690 12:71964488-71964510 CAGAATATATATATATATTCTGG + Intronic
1099856218 12:88170199-88170221 CAGGAAAAATCTATAGGTTCTGG - Intronic
1104419118 12:128620639-128620661 CAGACTAAATATATCAGTCCCGG - Intronic
1106968317 13:35101970-35101992 CAGAATAATCTTATGGCTTCAGG - Intronic
1108986858 13:56601409-56601431 AAGAAGAAATATATATGTTCAGG - Intergenic
1109035222 13:57249784-57249806 TGCAATAAATATATGGGTGCAGG - Intergenic
1109913418 13:68947387-68947409 CAAAATAAATATAGAGGCTCAGG + Intergenic
1110234396 13:73201291-73201313 CACAATAAATATATGGGACAAGG + Intergenic
1111054114 13:82925782-82925804 CTTAAGAACTATATGGGTTCAGG + Intergenic
1111057499 13:82970707-82970729 CAGGAGACGTATATGGGTTCAGG - Intergenic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1112780056 13:102890617-102890639 CAGAATATATAAATGGGATGGGG - Intergenic
1114176440 14:20324777-20324799 TATAGTATATATATGGGTTCTGG - Intronic
1116982984 14:51190752-51190774 CTGAATAAATATAAGTTTTCAGG + Intergenic
1117456258 14:55899712-55899734 CAGCAAAAATGTGTGGGTTCAGG + Intergenic
1117968988 14:61233917-61233939 AAGAATAAATAAATGGGTTATGG - Intronic
1119795594 14:77393557-77393579 CAGAATTAAAATATGAGTCCAGG - Intergenic
1120448895 14:84640442-84640464 CTGAATAAATGCATTGGTTCTGG + Intergenic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1120682399 14:87495870-87495892 CAGAATAAATGTATAAGTTCTGG + Intergenic
1121526917 14:94625561-94625583 GAGAATAACTATTTGGGTTTGGG + Intergenic
1121676899 14:95760655-95760677 CAGCATAAATAGAGGGGTACGGG + Intergenic
1124108439 15:26763248-26763270 CAGAAAAAATATCTGAGTTTTGG - Intronic
1131756588 15:95570279-95570301 CACAAAAAATATATGGTTTTGGG + Intergenic
1134126239 16:11618165-11618187 CAGAATAAATAAATGGGTTATGG - Intronic
1135503491 16:23016879-23016901 GAGAATATGAATATGGGTTCGGG - Intergenic
1136352157 16:29717818-29717840 CTGAATCAATATACTGGTTCTGG + Intergenic
1137517233 16:49157086-49157108 CAGAATGAAAATATTGGTTCAGG - Intergenic
1139178515 16:64718111-64718133 CAGAATATATCTATGACTTCAGG + Intergenic
1140016108 16:71187304-71187326 CAGAATAAATACAAGGTTACAGG + Intronic
1142833712 17:2568729-2568751 CCAAATAAATATTTGGATTCAGG - Intergenic
1143004604 17:3821185-3821207 AAGAATAAAAATATGATTTCAGG + Intronic
1147281899 17:39368948-39368970 AAGATTAAAAAAATGGGTTCGGG - Intronic
1149125312 17:53223275-53223297 TACAATAAACATATGGGTGCAGG - Intergenic
1150882123 17:69041970-69041992 TAGAATGCATATAAGGGTTCTGG - Intronic
1151101563 17:71561969-71561991 CAAAAGAAATATATCGGTTAGGG + Intergenic
1152548527 17:81016679-81016701 CAGAATAAATAGATTACTTCAGG - Intergenic
1156043111 18:32846059-32846081 CAGAATGAATATGTGGCTTATGG + Intergenic
1159094004 18:63881625-63881647 CAGATTAAATTTATGGATTAAGG + Intronic
1159514700 18:69443504-69443526 CAAGAAAAAGATATGGGTTCAGG - Intronic
1159710043 18:71747125-71747147 AAGAATAAAAATATGGATTGGGG - Intronic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
1165903656 19:39180401-39180423 CAGAATAAATAAAAGGTTTCAGG + Intronic
925825546 2:7845293-7845315 CAGAAGAAAGAAATGGGCTCTGG - Intergenic
927283074 2:21327760-21327782 CAATTTAAATATGTGGGTTCTGG + Intergenic
931919915 2:67003883-67003905 CAGAAGAAAAATGTGTGTTCCGG + Intergenic
933197324 2:79407066-79407088 CGGAATAAATAAATGAGTCCAGG - Intronic
933792481 2:85894179-85894201 TAGAATGAATATATGGGTGAGGG - Intergenic
933868002 2:86541442-86541464 GAGAATAGAGATAAGGGTTCAGG - Intronic
936457763 2:112688524-112688546 CAGAATGAGAAGATGGGTTCTGG - Intergenic
936720735 2:115249802-115249824 AAGAGTAAATCTATGGGGTCAGG + Intronic
942856003 2:180549133-180549155 CAGAATAAATATTTGTGTTTTGG + Intergenic
943664851 2:190598305-190598327 GAGAATAAATATCTGAATTCTGG - Intergenic
944015532 2:195032196-195032218 AAGATTGTATATATGGGTTCTGG - Intergenic
945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG + Intronic
945999712 2:216471312-216471334 CAGAAAAAATACATGTGTTTAGG - Intronic
946608103 2:221428572-221428594 CAGACAAAATACATGGGCTCTGG + Intronic
1168865278 20:1080908-1080930 CAGAATATGTATATGGGTATGGG + Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1178176737 21:30109513-30109535 ACGAAAAAATATAAGGGTTCAGG + Intergenic
949337281 3:2989302-2989324 CAGAATCAGGATCTGGGTTCAGG - Intronic
950867328 3:16199644-16199666 CTGAACAAATATGTGGTTTCAGG + Intronic
952603985 3:35121735-35121757 CATTATAAATATATGGATGCTGG + Intergenic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
957872555 3:86108112-86108134 GAGAAAAAATATATGTGCTCTGG - Intergenic
957978427 3:87476210-87476232 CATAACAAATTAATGGGTTCTGG + Intergenic
959344773 3:105179687-105179709 AAGAAAAAATATATTGATTCAGG + Intergenic
959973013 3:112428215-112428237 CAGAATAAAAAGGTGTGTTCAGG + Intergenic
961156758 3:124686182-124686204 CAGAATGAATAAATGGCTCCAGG - Intronic
963450094 3:145468390-145468412 CAGAAGAAAGATATGGATTCTGG + Intergenic
963899567 3:150720983-150721005 CATAATAGATATATGTGTTTTGG + Intergenic
965153868 3:165019680-165019702 CAGAATATATATATGGTTTTGGG - Exonic
965837837 3:172870697-172870719 CATAACACATTTATGGGTTCTGG + Intergenic
966316869 3:178657166-178657188 CAGGGAAAACATATGGGTTCTGG - Intronic
966851303 3:184166748-184166770 CAGGATAGATATGGGGGTTCTGG - Intronic
967198705 3:187052030-187052052 CTGAATAAACATATGTGCTCTGG + Intronic
967550450 3:190788661-190788683 CAGAAAAAATATATGCTTTATGG - Intergenic
971086439 4:23281585-23281607 GAAAATAAATACATTGGTTCAGG - Intergenic
971583371 4:28372490-28372512 CACAATAAATATATGAGTGTAGG - Intronic
973199832 4:47487585-47487607 AGGAATAAATATATGTGTGCTGG + Intronic
974118105 4:57605804-57605826 CAGAAAAAATATATGGCATGAGG - Intergenic
974794697 4:66733019-66733041 GAGAATAAATTTATGTCTTCAGG - Intergenic
975730287 4:77331098-77331120 CTGAATCAATATACTGGTTCTGG - Intronic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
977102461 4:92834132-92834154 CAATATAAATATAAAGGTTCAGG - Intronic
978154000 4:105468966-105468988 CAGCTTAAGTATATGTGTTCAGG - Intronic
979015286 4:115424552-115424574 CAGAGGAAATATCTGGGTTATGG - Intergenic
980069962 4:128233773-128233795 CAAAATTAGAATATGGGTTCTGG - Intergenic
980979763 4:139644317-139644339 TGGGATAAATATATGGGTACAGG + Intergenic
981911427 4:149985836-149985858 CAGAACAAATAAGTAGGTTCAGG + Intergenic
982598511 4:157415907-157415929 TAGAATAAACATCTGGGTTATGG + Intergenic
982810737 4:159823308-159823330 CAGGATAAATATATAAATTCTGG + Intergenic
984568444 4:181360081-181360103 CAGAGTAAATAAATGATTTCAGG - Intergenic
984922074 4:184774040-184774062 ATGAATAAATATTTTGGTTCTGG - Intronic
985040605 4:185888107-185888129 CAGAATAAATAAATTGGGACAGG - Intronic
985346429 4:189010245-189010267 CAGAATAAATCTGTGGATACCGG + Intergenic
988133323 5:27135974-27135996 GAGAATAAATCTGTGGGTTGTGG + Intergenic
988140548 5:27233521-27233543 CAAAATAAACATAAGGGTGCGGG + Intergenic
989439271 5:41451074-41451096 CAGAGGAAATAAATGGATTCTGG + Intronic
991037994 5:62147101-62147123 CAGAAGATATATTTGGCTTCAGG + Intergenic
991395815 5:66204149-66204171 CAGCATATTTATATGGGCTCAGG - Intergenic
993110264 5:83648454-83648476 CAGAATAAATATATGTAGTTTGG + Intronic
994406706 5:99353555-99353577 CACCATAAATGTAAGGGTTCTGG + Intergenic
994521144 5:100837530-100837552 CAGAATAAACATATGGTTCAAGG - Intronic
996171579 5:120299176-120299198 CATCATAAATCTATGGTTTCTGG + Intergenic
999198683 5:149800809-149800831 AACAATAAATAAATGGGTTCTGG + Intronic
1001018345 5:168161901-168161923 AAGAAAAAATATATGTGCTCGGG - Intronic
1001365056 5:171128954-171128976 CAGTATAAATAAATTAGTTCTGG + Intronic
1001510459 5:172317205-172317227 CTTAATAAACATATGGATTCAGG - Intergenic
1003167214 6:3691039-3691061 AAGAATAAATCTATGGGGCCGGG + Intergenic
1004080366 6:12386597-12386619 TAGACTAAATATATCTGTTCAGG - Intergenic
1004468735 6:15909242-15909264 CATGATAAATATTTGGGTGCTGG + Intergenic
1005049830 6:21674413-21674435 GAGAATAAATCTGTGGGTTTAGG + Intergenic
1009449446 6:63784376-63784398 TAGAAAAAATACATGGGTTTTGG + Intronic
1012682914 6:102205524-102205546 CAGAATATATATTTGGATTGTGG - Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1013694186 6:112681852-112681874 CAGAATAAATATGGGAGTTGGGG + Intergenic
1013787866 6:113802491-113802513 CAAAATAAAAATATGGGTCCGGG + Intergenic
1013850511 6:114507871-114507893 CACAATAACTCTATGGGTTTTGG - Intergenic
1014615331 6:123591236-123591258 AAAAAAAAATATTTGGGTTCAGG - Intronic
1016878338 6:148885708-148885730 CATAATAAATAAGCGGGTTCTGG - Intronic
1020208382 7:6137972-6137994 AAAAATAAATATATGTGGTCGGG - Intronic
1021348703 7:19561224-19561246 CACAATAAATAAATGGGTGGAGG - Intergenic
1022747687 7:33189434-33189456 CATAATAAATATGTGGTTTATGG + Intronic
1027833873 7:83216453-83216475 GAGAATAGATATATGATTTCAGG - Intergenic
1030432143 7:109463745-109463767 TAAAATAATTATATGGGTTCTGG + Intergenic
1030729985 7:112976141-112976163 CACAATAAATATATGTGTGCAGG - Intergenic
1030772638 7:113493611-113493633 CACAATAAATATATGTGTGCAGG - Intergenic
1031188526 7:118515519-118515541 CAGAATAAATATCCGTGCTCTGG - Intergenic
1031859578 7:126962785-126962807 CAGAGCAAATATGTGGGTTGTGG - Intronic
1032941089 7:136793020-136793042 CAAAATAATTATATGGTTTGTGG - Intergenic
1033631987 7:143167336-143167358 AAGAATAATTATAAGGGTTGGGG - Intergenic
1039578826 8:38647198-38647220 CAGAAGAAATTGATGGTTTCAGG - Intergenic
1039760427 8:40568751-40568773 CAGAATTAGTAGATAGGTTCAGG + Intronic
1043211041 8:77518210-77518232 AAAAATAAATATCTGGTTTCTGG + Intergenic
1043853494 8:85240252-85240274 CAGAACAAATAAATGGCTTTGGG - Intronic
1044391127 8:91652753-91652775 CAGAATAAATATTTTGGTTTGGG - Intergenic
1045635671 8:104185921-104185943 CATGATAAACATATGGGTACAGG - Intronic
1045907249 8:107361663-107361685 TAGAATATATATATGGGATGGGG + Intronic
1046049035 8:108998829-108998851 CAGAAAAAATAAATGTGTACAGG + Intergenic
1046578068 8:116056890-116056912 CTGATTAAAAATATGGGTTTTGG - Intergenic
1047777111 8:128081532-128081554 CAGAATAAACCTTTGGGTTGGGG + Intergenic
1048287826 8:133155459-133155481 CAGAATAAGAATATGGGCTTTGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1048876910 8:138843738-138843760 CTGAATAAATAAATGTGTTTTGG - Intronic
1051972299 9:22904323-22904345 TGCAATAAATATATGGGTGCAGG + Intergenic
1052138460 9:24945839-24945861 CAGAATAGATAAATTTGTTCAGG + Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055403434 9:75948609-75948631 CACAATAAATATACGTGTGCAGG + Intronic
1055541074 9:77305704-77305726 GAGAACAAATATCTGGGCTCTGG - Intronic
1057490972 9:95519259-95519281 CAGCATAAATATCTTGGTTAAGG - Intergenic
1057767873 9:97939102-97939124 CAGGATTAATATATGTGTTCTGG + Intronic
1057954809 9:99399095-99399117 GAGGTTAAATATATAGGTTCTGG + Intergenic
1058743719 9:107969157-107969179 ATGAGTAAATAAATGGGTTCAGG - Intergenic
1059045015 9:110857236-110857258 AAGAAAAAATATATAGCTTCTGG - Intergenic
1059133326 9:111778154-111778176 CAGAATAAATATATTGGACAGGG - Intronic
1060016753 9:120093293-120093315 TAGAATAAAAAGATGGGTTGAGG - Intergenic
1062455515 9:136635517-136635539 CAGAATAAATATAAGGTCACTGG - Intergenic
1189184098 X:39036964-39036986 AATAATGAACATATGGGTTCTGG + Intergenic
1189977432 X:46476699-46476721 CAGAATTTATATTTGGTTTCTGG - Intronic
1191687612 X:63908482-63908504 CACAATAAATATACGTGTGCAGG - Intergenic
1192377923 X:70583561-70583583 TGCAATAAATATATGGGTGCTGG + Intronic
1194142176 X:90220490-90220512 GAGAGTAAATATATGGGTTGGGG + Intergenic
1194418123 X:93638107-93638129 CAGAATAAATATGTGGGGTTGGG + Intergenic
1195628792 X:107032125-107032147 CAGGATAGAAATATGGGTTGGGG + Intergenic
1196694759 X:118599945-118599967 GAGATCAAATATATGGGTTCTGG + Intronic
1197299977 X:124766607-124766629 GATAATAAAAATATGGTTTCTGG + Intronic
1199714168 X:150494501-150494523 CAGAATAATTATCTTGGATCAGG - Intronic
1200487930 Y:3789589-3789611 GAGAGTAAATATATGGGTTGGGG + Intergenic
1201492714 Y:14559786-14559808 TAGAATGATTATATGGGTACTGG - Intronic