ID: 945761409

View in Genome Browser
Species Human (GRCh38)
Location 2:213920406-213920428
Sequence ATGCACACACACGTTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945761409 Original CRISPR ATGCACACACACGTTGGCAT GGG Intronic
900947566 1:5839898-5839920 ATGCACACACACATTCACACAGG + Intergenic
901811720 1:11771010-11771032 ATACACACACACGCTGCCAGAGG - Intronic
901857523 1:12053885-12053907 ATGCACACACACGTACACATAGG - Intergenic
904374354 1:30070697-30070719 ATACACACACACGTGTACATGGG - Intergenic
908993252 1:70120250-70120272 ATGCCCACAGAAGTTGGCATTGG - Intronic
909851848 1:80476216-80476238 ATACACACAGTAGTTGGCATAGG - Intergenic
910881684 1:91927443-91927465 ATGCACACATACTTTGTCAATGG - Intergenic
913702530 1:121386351-121386373 AGGCTCACACAAGTTGGCTTTGG + Intronic
914043094 1:144066846-144066868 AGGCTCACACAAGTTGGCTTTGG + Intergenic
914134992 1:144893642-144893664 AGGCTCACACAAGTTGGCTTTGG - Intronic
916463863 1:165053415-165053437 ACACACACACACGTGGGCAGAGG - Intergenic
920489959 1:206405094-206405116 AGGCTCACACAAGTTGGCTTTGG + Intronic
1063393732 10:5666852-5666874 ACGGACACACACGTTTACATAGG - Intergenic
1064711713 10:18134183-18134205 ACGAACACACACGTGGGTATGGG + Intergenic
1072197670 10:93130515-93130537 ATGCACAAACAAGTTTGAATTGG - Intergenic
1072369304 10:94747626-94747648 ATTCTCACACACTTTCGCATTGG + Intronic
1072821398 10:98561326-98561348 AGAAACACACACGTTGGCCTGGG - Intronic
1075297744 10:121292969-121292991 ATGCTCACACACATAGGCACAGG + Intergenic
1076042342 10:127261042-127261064 ATGCACACACACATGAGCACGGG - Intronic
1076321436 10:129584975-129584997 ACACACACACACGTAGGCCTAGG + Intronic
1077321396 11:1944015-1944037 CTGCACACACATGTTTGCAGAGG + Intergenic
1084149686 11:67282353-67282375 GGGCACTCACACGCTGGCATGGG - Exonic
1085908585 11:80794486-80794508 ATGCACACCCACATTGGCAAGGG + Intergenic
1087432457 11:98070773-98070795 ATGAACACACACATTAGCCTGGG - Intergenic
1087917917 11:103831600-103831622 ATGCACATACTCCCTGGCATAGG - Intergenic
1091025872 11:132140760-132140782 ATACCCACACACGCTGCCATGGG - Intronic
1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG + Exonic
1095943085 12:47739035-47739057 GTGCACACACAGATAGGCATGGG + Intronic
1098253239 12:68590374-68590396 CTGCACTCACGAGTTGGCATTGG - Intergenic
1101464702 12:104936389-104936411 ATACACACACACATTAGCATAGG - Intronic
1101917596 12:108907960-108907982 AGGTACAGACACGGTGGCATTGG - Intergenic
1102547046 12:113664737-113664759 ATGCACACACAAGGTGAGATAGG - Intergenic
1104823300 12:131691158-131691180 GTGCACACAGACGTTGTCCTGGG - Intergenic
1106075601 13:26458350-26458372 ATGCACACACACGCACACATTGG - Intergenic
1109480058 13:62940521-62940543 ATGCACATATAATTTGGCATTGG + Intergenic
1110621914 13:77606057-77606079 ATGCATACACACATAAGCATAGG - Intronic
1111053515 13:82917571-82917593 GTGCACACACACATTAGCCTAGG - Intergenic
1111141325 13:84123005-84123027 ATATACACACACATTGGCTTTGG - Intergenic
1113409804 13:110074959-110074981 ATACACACACATCTAGGCATGGG - Intergenic
1116258861 14:42595432-42595454 ATGCTCACACACTTTGGGAAGGG + Intergenic
1118322918 14:64763893-64763915 GTGCACACACACGTGGGGAAGGG + Intronic
1122028295 14:98893808-98893830 ATGCCCAAACAGGTTGGCAGAGG + Intergenic
1124615957 15:31242316-31242338 ATGAACACAGACTTTGGTATGGG - Intergenic
1126227625 15:46289755-46289777 GTGCACATGCACGCTGGCATGGG + Intergenic
1126444843 15:48730615-48730637 ATGCACAGACACATCAGCATAGG + Intronic
1128612897 15:69088079-69088101 ATGCACACACAGTGTGGCATCGG + Intergenic
1132316923 15:100897225-100897247 ATGCGCTCACACCTTAGCATTGG + Intronic
1132588605 16:716680-716702 ATGCACACAGACGTGGGCCTGGG - Intronic
1133171577 16:3985467-3985489 ATGCCCACTCACCTTGGCAGAGG + Intronic
1136378575 16:29879907-29879929 ATCCACACATTCGATGGCATTGG + Exonic
1141772144 16:86096001-86096023 ATGCACACACACCCTGGGAGGGG + Intergenic
1141811346 16:86378365-86378387 ATGCTCACACGGGCTGGCATGGG + Intergenic
1142268328 16:89075819-89075841 GTGCACACACACGTGCTCATAGG - Intergenic
1146186524 17:30727921-30727943 CTGCCCACACAACTTGGCATCGG + Intergenic
1146643546 17:34560057-34560079 ATGAACACACACATTAGCCTGGG - Intergenic
1149109893 17:53015996-53016018 ATGCACACACACATATACATAGG - Intergenic
1150875560 17:68966367-68966389 ATTCACACACAAGTTTTCATGGG + Intergenic
1151143625 17:72018571-72018593 ATGCACACTGACATCGGCATTGG - Intergenic
1151391701 17:73791538-73791560 ACGCACACACACAGTGGGATAGG + Intergenic
1152316258 17:79582303-79582325 AGGCACACACACACAGGCATAGG - Intergenic
1152946678 17:83201553-83201575 GTGCACACACAAGTGTGCATGGG - Intergenic
1156802676 18:41136790-41136812 ATGGACACACACGTGACCATAGG + Intergenic
1158724076 18:59952447-59952469 ATGCAAGTACACGTTGTCATTGG - Intergenic
1160156108 18:76434998-76435020 ATGCACACACCATTCGGCATGGG + Intronic
1160345092 18:78125862-78125884 ATGCACAAACACACAGGCATAGG - Intergenic
1162062454 19:8104800-8104822 ATGCAAACACACTGTGGCACTGG + Intronic
1165924488 19:39318781-39318803 ATGGACACACATGTTGGTGTGGG - Intergenic
1168145408 19:54417354-54417376 ATGCACACACACATATGCACAGG + Intronic
925753344 2:7109664-7109686 ATGCACACACACACAGGCTTGGG - Intergenic
928068212 2:28188181-28188203 ATGCTCACAAATGATGGCATGGG - Intronic
931049146 2:58390495-58390517 ATGCTCACACACATTGTCACTGG + Intergenic
932088226 2:68781446-68781468 ATGCACACACATGGTGGAAGTGG + Intronic
935375235 2:102388693-102388715 ACGCACGCACACATTGGCACGGG - Intronic
937001685 2:118473416-118473438 TGGCATCCACACGTTGGCATTGG - Intergenic
937519542 2:122695122-122695144 ATGCACACACACATTGGTCAAGG - Intergenic
940057615 2:149529347-149529369 ATGCACAAACAGGTGGGCACTGG + Intergenic
942394237 2:175529519-175529541 ATGCACACAAAGGTTAGTATGGG - Intergenic
943376077 2:187078431-187078453 ATGGACCCACACGTTGTCCTTGG + Intergenic
945213270 2:207406165-207406187 ACACACACACACGATGGAATTGG - Intergenic
945761409 2:213920406-213920428 ATGCACACACACGTTGGCATGGG + Intronic
947083993 2:226430252-226430274 ATTCACACACACCTCTGCATGGG - Intergenic
947564358 2:231184603-231184625 ATGCACACTCGCACTGGCATAGG - Intergenic
1168926614 20:1586825-1586847 ACGCACACACACGTGTGCAGTGG - Intronic
1172847059 20:37935851-37935873 GTTCACACACACATTGGCCTGGG - Intronic
1173006491 20:39143263-39143285 AAGCACACACAGCTTGGCACTGG + Intergenic
1175972297 20:62692787-62692809 GTGCACGCACACATGGGCATGGG - Intergenic
1178380686 21:32105129-32105151 ACACACACACACTTTGCCATAGG + Intergenic
1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG + Intergenic
1181882525 22:25992327-25992349 ATGCAAACACACGTTGGCCTTGG - Intronic
1183146753 22:35999744-35999766 AAGCACACACACTGTTGCATAGG + Intronic
950005995 3:9691340-9691362 ATGCACACACAGGATGGGACGGG - Intronic
952652531 3:35743694-35743716 ATGCACATACACATAGGCATGGG + Intronic
952815050 3:37440185-37440207 ATAAACACACACATTAGCATAGG - Intergenic
953780077 3:45860937-45860959 AAGCACAAACATGTTGGCAATGG - Intronic
955751820 3:62191236-62191258 ATGCACACACACGTGTGCAAGGG - Intronic
956056648 3:65305665-65305687 ATACACACACACATTAGCCTAGG + Intergenic
962968575 3:140377533-140377555 ATGAACACACACATTAGCCTAGG - Intronic
963954750 3:151241582-151241604 ATGCACACACACTTTCACAGTGG + Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
969846890 4:9926288-9926310 ATGCAAACACACATTGTCTTGGG + Intronic
970797617 4:19932643-19932665 ATAAACACACACGTTAGCCTCGG + Intergenic
971390708 4:26182826-26182848 AGACACACACACATTAGCATAGG + Intronic
973286898 4:48428595-48428617 ATGAACACACACATTAGCTTAGG - Intergenic
973627039 4:52783246-52783268 ATGCACAGGCACGCAGGCATGGG + Intergenic
975506183 4:75140905-75140927 AGACACACACACGCTTGCATGGG + Intergenic
976985265 4:91287598-91287620 ATGCACAGTCAAGTAGGCATTGG - Intronic
977899832 4:102407223-102407245 ATGCACACACACGTGCACACAGG + Intronic
981335016 4:143559869-143559891 ATTCACCCACACGATGGCATAGG - Intergenic
983063154 4:163180459-163180481 ATGCACACACATGTTGAGACTGG - Intergenic
985311488 4:188604496-188604518 ATGCACACACTCATTAACATGGG - Intergenic
986600079 5:9464362-9464384 ATACATACACACGTTTCCATCGG + Intronic
987595658 5:19995113-19995135 ATGCACACCCACATTGACAAGGG + Intronic
987780773 5:22431715-22431737 AAACACACACACATTGGCCTAGG - Intronic
990516110 5:56532347-56532369 ACACACACACATGTGGGCATGGG - Intronic
992041155 5:72834474-72834496 ACGAACACACACATTGGCCTAGG - Intronic
994111787 5:96014192-96014214 ATGAACACACACATTAGCCTAGG + Intergenic
994860952 5:105193621-105193643 ATATACACACACATTTGCATTGG + Intergenic
996542117 5:124641290-124641312 CACCACACCCACGTTGGCATGGG - Exonic
997719595 5:136066946-136066968 ATGCACACACACCCCTGCATGGG + Intergenic
1008296175 6:49781177-49781199 ATGTACACACACCTTAGCCTGGG + Intergenic
1008408477 6:51145345-51145367 ACACACACACACATTTGCATAGG - Intergenic
1013629445 6:111971886-111971908 ATGCACACACATGTGTGGATGGG - Intergenic
1014722209 6:124931019-124931041 AAACACACACACATTGGCTTAGG + Intergenic
1015119952 6:129690114-129690136 ACACACACACACGTTTACATGGG - Intronic
1017718321 6:157227627-157227649 ATGCACACACACGTGGAGACTGG + Intergenic
1018540557 6:164875001-164875023 ATACACACCCACCTTGCCATTGG - Intergenic
1019306450 7:337590-337612 TTGCAGACACAGGTGGGCATGGG - Intergenic
1020141677 7:5615200-5615222 ATGCAGTCACGCGTTGGCCTTGG - Intergenic
1020752806 7:12164315-12164337 ATGCACACACATGTTTACAGTGG - Intergenic
1021898232 7:25257658-25257680 GTGCTCACACATGTTCGCATGGG + Intergenic
1022347071 7:29527016-29527038 ACACACACACACGTGGGTATAGG - Intergenic
1024511963 7:50211782-50211804 AGGCATCCACACGCTGGCATCGG + Intergenic
1025735182 7:64140698-64140720 ATACACACACACGTTGGGGGTGG - Intronic
1027643728 7:80770133-80770155 ATGCAAACATACATAGGCATTGG + Intronic
1029088821 7:98032360-98032382 ATGGACACACAGGCTGGCAAAGG - Intergenic
1032470700 7:132176341-132176363 ATGCACACACACATTGGTGCAGG - Intronic
1034988768 7:155534319-155534341 ATGCACACACACGTGCACAGAGG + Intergenic
1035112944 7:156499303-156499325 ATGCAAACACACATGGGCACAGG + Intergenic
1035333309 7:158110522-158110544 AGGCTCCCACACATTGGCATAGG + Intronic
1035710155 8:1707100-1707122 ATACACACACAAGTTGACAGAGG + Exonic
1037112626 8:15182967-15182989 AGACACACACACATTGGCTTAGG + Intronic
1038348234 8:26751856-26751878 ATGAACACTCAGGTTGGCTTAGG + Intronic
1038701205 8:29850892-29850914 ATGCACACACACAATTGCATGGG - Intergenic
1039517000 8:38142482-38142504 ACACACACACACATTGGGATGGG - Intronic
1039859528 8:41445007-41445029 ATGCAAACACACATATGCATAGG + Intergenic
1045763299 8:105636453-105636475 AAGCACATACAATTTGGCATGGG - Intronic
1045857154 8:106777818-106777840 GTGCACACACACACTGGTATTGG + Intergenic
1046717594 8:117584569-117584591 TTTCACACACACTTTGGGATTGG + Intergenic
1047351119 8:124075336-124075358 AAACACACACACGTTAGCCTAGG + Intronic
1047967426 8:130056662-130056684 GTGCACACACACATAGGCATGGG - Intronic
1048004495 8:130408317-130408339 ATGCCCACTCACGTTGGGAAGGG - Intronic
1048251766 8:132871983-132872005 ATACACACACACATTAGCCTAGG - Intronic
1048360551 8:133693966-133693988 ATGCACACACATGGTATCATGGG + Intergenic
1050789545 9:9448808-9448830 ATGCACACACACTGTGGTATAGG + Intronic
1053363986 9:37509850-37509872 ATGCCCTCTCACGTTGCCATGGG - Intergenic
1055247277 9:74262079-74262101 ATGAACACACACATTAGCCTAGG + Intergenic
1055608666 9:77998076-77998098 ATGTACACACACGCTGGCGAGGG + Intronic
1058690755 9:107518523-107518545 ATACACACAAACGTTCACATGGG - Intergenic
1059698951 9:116756799-116756821 ATACACACACACTTGGTCATCGG + Intronic
1059718975 9:116940491-116940513 ATGAACACACACATTAGCTTAGG - Intronic
1060149532 9:121279451-121279473 ATGGACCCAGATGTTGGCATTGG + Intronic
1060224314 9:121782053-121782075 ATGCACACACATGTGAGCAAGGG + Intronic
1060267425 9:122120492-122120514 ATGCATACACAAGCTGTCATGGG - Intergenic
1060707085 9:125813295-125813317 AGCCAAACACACATTGGCATAGG + Intronic
1185483010 X:461609-461631 ATGCACACACACACGTGCATAGG - Intergenic
1185483027 X:461913-461935 ATGCACACACACACGTGCATAGG - Intergenic
1185483045 X:462298-462320 ATGCACACACACACGTGCATAGG - Intergenic
1199561004 X:149162114-149162136 GTGCACACACACATTTGCACTGG - Intergenic
1201437698 Y:13977326-13977348 ATGGATACACACCGTGGCATGGG + Intergenic