ID: 945763258

View in Genome Browser
Species Human (GRCh38)
Location 2:213941742-213941764
Sequence CAGTATATGAATAAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945763258 Original CRISPR CAGTATATGAATAAAATGGA AGG (reversed) Intronic
901932478 1:12604437-12604459 CAGTATTTGCATACAATGAATGG - Intronic
907073643 1:51559566-51559588 ATGCATATGAATAAAATGGGGGG - Intergenic
908126152 1:61032022-61032044 CAGAATATGTAGAAAAGGGACGG + Intronic
908744000 1:67357928-67357950 GAGTAGAGGAAAAAAATGGAGGG + Intronic
908945393 1:69490014-69490036 AAATATATGAATAAAATTGATGG + Intergenic
909818882 1:80033021-80033043 CAGGATATGAAAGAAAGGGAAGG - Intergenic
910037661 1:82807488-82807510 AAGAAAATGAATAGAATGGAAGG + Intergenic
910544842 1:88403169-88403191 CAGTATATTAATTACATAGAGGG + Intergenic
911105392 1:94126573-94126595 TAGTATATGAATAAAATTCCTGG + Intergenic
911835048 1:102608010-102608032 CAGTATAAGAATAAAATGGAAGG + Intergenic
912911377 1:113762308-113762330 AAATGTATGAAGAAAATGGAAGG + Exonic
913005351 1:114624938-114624960 AGATATATTAATAAAATGGAAGG + Intronic
915883293 1:159696819-159696841 CAAGACATGAATAAATTGGAGGG - Intergenic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916654464 1:166861477-166861499 AACTAAATGAATAAAATGAATGG + Intronic
917206474 1:172578138-172578160 CAGTAGATGACTTAAATGTAAGG + Intronic
917208506 1:172604877-172604899 AGGTACATAAATAAAATGGATGG - Intronic
918062026 1:181070226-181070248 CAATATATGAATAAATTCCATGG - Intergenic
918300269 1:183197710-183197732 AAGTAAATAAATAAAGTGGATGG + Intronic
918565319 1:185922977-185922999 CAATGTATGAATAAAATGAGAGG - Intronic
919709684 1:200713457-200713479 AAGTATACAAATAAAATGTATGG + Intergenic
919711423 1:200733215-200733237 AAATAAATAAATAAAATGGAAGG - Intergenic
922224962 1:223638075-223638097 AAATATTTGAAAAAAATGGATGG + Intronic
923180505 1:231513703-231513725 CAATATATGCATAAAAAGAAAGG - Intergenic
1063790119 10:9435186-9435208 GAGTATATAGAAAAAATGGATGG - Intergenic
1063987423 10:11520182-11520204 GAGTATATGAAGAAAAGGGACGG + Intronic
1064884101 10:20090409-20090431 CAGTCAATGAATGAGATGGAGGG + Intronic
1067916858 10:50409005-50409027 ATCTATATGAATAAAATGAATGG - Intronic
1068245075 10:54354849-54354871 AAATATATGTATTAAATGGAAGG + Intronic
1071250237 10:83810598-83810620 CATCGTAAGAATAAAATGGATGG - Intergenic
1071929298 10:90448954-90448976 CAGTAGATCAATAAATTGGAAGG + Intergenic
1072848242 10:98856623-98856645 CAGAATATGAATAAGATGGATGG + Intronic
1073563666 10:104517760-104517782 CAGTATATGAAAATATTCGAAGG + Intergenic
1074656344 10:115592379-115592401 CACTAAATGGATAAAATGTATGG - Intronic
1075980945 10:126738772-126738794 CAGTAAAAGAGTAAAATAGATGG + Intergenic
1078016045 11:7615860-7615882 CAATTTAAAAATAAAATGGATGG + Intronic
1078255215 11:9653027-9653049 CAGTATGTGAAAACATTGGATGG - Intergenic
1080953092 11:37059054-37059076 CAGTATACTAATAAAATGCATGG + Intergenic
1082715757 11:56611276-56611298 CAGTATCTGAAAAAGAAGGAAGG - Intergenic
1084196890 11:67527998-67528020 CAATAAATAAATAAAATGGCTGG - Intergenic
1084906314 11:72350595-72350617 CAGGAAATCAATAAAAAGGAAGG + Intronic
1086066024 11:82745747-82745769 CAGCATATCAATAGAATGAAGGG + Intergenic
1086921098 11:92587977-92587999 CAGACTTTGAGTAAAATGGAGGG - Intronic
1087676880 11:101173874-101173896 GAATGTATGAAGAAAATGGAGGG + Intergenic
1089440175 11:118508842-118508864 CAGTATTAGAAAAAAATGAAAGG - Intronic
1090084782 11:123641341-123641363 GACGATATGACTAAAATGGAAGG - Intronic
1090339553 11:126004842-126004864 CAGTACATGAATGAAATGGGAGG - Intronic
1090937518 11:131357250-131357272 AATTAAATGAATAAGATGGATGG - Intergenic
1090987485 11:131782714-131782736 CTGTATATTAATAAAATGAAGGG + Intronic
1091419409 12:323050-323072 CAGTATATGCATACAAAAGAAGG + Intronic
1091700592 12:2657507-2657529 CACTAGAGGAAAAAAATGGATGG + Intronic
1092891093 12:12969937-12969959 CTGTATATAAATACAGTGGAAGG - Intergenic
1094306862 12:29029711-29029733 AAGTATAAGAATAAACTGGATGG - Intergenic
1095140986 12:38661605-38661627 AAGTAAATAAATAAAATTGAAGG + Intronic
1096046161 12:48564212-48564234 CAATAAATGAAAAAAATGAATGG + Intergenic
1097035340 12:56120167-56120189 CAGTATCTGAATAGTCTGGAAGG - Intronic
1097086912 12:56475654-56475676 CAGTATCTCAACAAAATGGCTGG - Exonic
1097438747 12:59584086-59584108 CAGTGTATGCATTAAATTGATGG - Intergenic
1097581249 12:61459480-61459502 AAGTATAATAATAAAAAGGAAGG + Intergenic
1098754504 12:74342341-74342363 CTATATATTTATAAAATGGAAGG - Intergenic
1099351261 12:81571893-81571915 CAGTATATGAAAGAAGTAGATGG - Intronic
1099928745 12:89049822-89049844 AAGTAAATGAAGAAAATGAATGG + Intergenic
1101103873 12:101421449-101421471 CAGAAAATGAGTAATATGGAAGG - Intergenic
1101556071 12:105810892-105810914 CATTTTATAAATAAAATGGTTGG - Intergenic
1105820512 13:24076980-24077002 CAACATATGAATCAAAGGGAAGG - Intronic
1106547415 13:30742810-30742832 GAGTAAAGGAATAAAATAGAAGG + Intronic
1106605106 13:31221783-31221805 CAGTCTGTGAAGAAAATTGAAGG + Intronic
1107334327 13:39337936-39337958 CAGAATAAGAATATAAAGGAAGG + Intergenic
1108267035 13:48721594-48721616 CTTTATATAAATAAAATGTAGGG + Intergenic
1109155154 13:58900666-58900688 AAGAAGATGTATAAAATGGATGG + Intergenic
1111467336 13:88631939-88631961 GAATATAGGAATAAAATTGATGG + Intergenic
1111850615 13:93568755-93568777 TAGTATATGATTAAACTGGATGG - Intronic
1112248220 13:97753938-97753960 CAATATATGAATATAAGGGTGGG + Intergenic
1112532792 13:100221170-100221192 CAGTATATTAGTAATATGGGAGG + Intronic
1113078918 13:106496120-106496142 TAGTCTATAAATAAAAGGGATGG + Intronic
1114843181 14:26289973-26289995 CATTATATGGATAAAAAGTAAGG - Intergenic
1114956436 14:27826124-27826146 AAGTTTATTAATAAAATTGAAGG - Intergenic
1116031144 14:39573710-39573732 CAGAAGATGAATGAAATGCAAGG - Intergenic
1117392728 14:55277768-55277790 CAGTTTATGAATAAAAATGTAGG - Intronic
1118477774 14:66134255-66134277 CAGTGTATGAGAAAAATTGATGG + Intergenic
1119069130 14:71563850-71563872 CAGTATAAGAAGAAAATGCCTGG - Intronic
1119556838 14:75559886-75559908 CAGTAAATGAATGTATTGGAAGG - Intergenic
1120362098 14:83517049-83517071 TAGTATATTATTAAAAAGGATGG + Intergenic
1120391411 14:83913071-83913093 CCTTATGGGAATAAAATGGAGGG - Intergenic
1120896509 14:89537521-89537543 CAATGGATGAATAAAATGCATGG + Intronic
1124137149 15:27044902-27044924 CAGTATGTAAATAAATTGAAAGG - Intronic
1125859289 15:42983021-42983043 TAGTATAGAAATAAAATGCAGGG - Intronic
1126637448 15:50793091-50793113 CAATATATAAATAAACTGGTTGG + Intergenic
1127455640 15:59153911-59153933 CCGCATTTGAAAAAAATGGAAGG + Intronic
1129480292 15:75819342-75819364 CACTATATTAATAAAATAAAAGG - Intergenic
1129625017 15:77188004-77188026 CAGTATATGACTAAAAGGGTGGG + Intronic
1129654217 15:77512553-77512575 AAGTATATGAATAAAAAATAGGG + Intergenic
1130410301 15:83642182-83642204 CAGTACATGAACAAAATGAGAGG - Intergenic
1131019044 15:89082406-89082428 GAGAAGATGAAAAAAATGGATGG - Intergenic
1131748339 15:95475248-95475270 CAGTTTATGAATAAAGTGCAAGG + Intergenic
1135867388 16:26116494-26116516 CTGTATATCAATAAATTGAATGG - Intronic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1138814207 16:60185675-60185697 AAATAAATGAATAAAATGGAGGG + Intergenic
1138891740 16:61151037-61151059 CAGTAGAGGAAAAAAATGGATGG - Intergenic
1139127244 16:64093380-64093402 TAGTATATGGAAAAAATGAACGG + Intergenic
1139299824 16:65935498-65935520 CCCTATATGAAGAAAATGGGTGG - Intergenic
1139678682 16:68542942-68542964 CAGTAAATAAATAAATTGTATGG + Intronic
1144315305 17:14055125-14055147 AAATATTTGAATAAAATGAAAGG - Intergenic
1144378500 17:14669436-14669458 CAGGATATGAATCAAATGTCTGG - Intergenic
1145878489 17:28337251-28337273 TAGTATATGAATCAATTGGAGGG - Intronic
1148630446 17:49104145-49104167 GAGTATTGGAAGAAAATGGAAGG - Intergenic
1149180359 17:53929204-53929226 CATTATATCAACAGAATGGAGGG - Intergenic
1151005193 17:70427561-70427583 TAATAAATAAATAAAATGGAAGG + Intergenic
1151326623 17:73383713-73383735 CAGTAAATGAATGAATGGGATGG + Intronic
1203179650 17_KI270729v1_random:46689-46711 CTCTAGATGAATAGAATGGAAGG + Intergenic
1156107631 18:33684874-33684896 TAGAATTTGAATAAAATGAATGG + Intronic
1156135831 18:34036344-34036366 CATCATATCAATAAAATGAAGGG + Intronic
1156234609 18:35190057-35190079 CCGTATTTACATAAAATGGATGG + Intergenic
1156240421 18:35248348-35248370 GAGAATATGGAAAAAATGGATGG + Exonic
1156644474 18:39144149-39144171 CTGTGTAAGAATAAAATGGTTGG - Intergenic
1156985275 18:43343546-43343568 CATTACACGAATAAAATGCATGG + Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157409305 18:47450337-47450359 AAATAGATGAATGAAATGGAGGG - Intergenic
1158243528 18:55404801-55404823 CATTACATATATAAAATGGATGG + Intronic
1158653491 18:59308204-59308226 CAGTATTAGAATAAAAAGCATGG + Intronic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1159145342 18:64447001-64447023 AAGTATTTGAAGAAAAAGGAAGG + Intergenic
1159502134 18:69286906-69286928 CAGTATATAAGTAAAACGAAAGG + Intergenic
1162580984 19:11530154-11530176 CAGTAAATAAATAAATAGGAAGG + Intergenic
1164439994 19:28269589-28269611 TACTATATTAATAAAATGAAAGG - Intergenic
1165876021 19:39007423-39007445 AAGTATAGGGATCAAATGGAGGG + Intronic
1166622043 19:44309913-44309935 AAGTAGATAAATAAAATGAATGG - Intergenic
1167304922 19:48702667-48702689 CTGTATATGTATACAATGTATGG + Intronic
1167932508 19:52877666-52877688 TTGTTTAGGAATAAAATGGAAGG + Exonic
1167996993 19:53413893-53413915 TTGTTTAAGAATAAAATGGAAGG - Intronic
1168072050 19:53958839-53958861 TAGTAAATGAAAGAAATGGAGGG - Intergenic
926460843 2:13127729-13127751 CAGTGAATGAATAAAATTGCTGG - Intergenic
928787139 2:34902350-34902372 CAGGATATTAAAAATATGGATGG + Intergenic
929306125 2:40364230-40364252 CAGTATATGAATTAACTGATGGG + Intronic
930212937 2:48661774-48661796 CAGGATATGAATAGGTTGGAAGG - Intronic
930241079 2:48936293-48936315 CAGTATATCTGTAAAATGAATGG + Intergenic
933428241 2:82140981-82141003 AAGTCTATGAAAAAAATTGAAGG + Intergenic
934480849 2:94641876-94641898 AAGTTTATTAATAAAATTGAAGG + Intergenic
935304010 2:101719354-101719376 CAGTGAATGAATAAAAGGGCTGG + Intronic
935867023 2:107399748-107399770 AAGAAAATAAATAAAATGGAAGG + Intergenic
936759475 2:115758650-115758672 CTGTAAAAGAATAAAATTGAAGG + Intronic
937282245 2:120727077-120727099 CAGTGAGGGAATAAAATGGAAGG - Intergenic
937638905 2:124189425-124189447 CAAAAGATGAATAAAATGCATGG - Intronic
937705254 2:124912908-124912930 AAGTCTATGAATAAACTGGGTGG - Intronic
937719001 2:125070350-125070372 CAGATTATGAATAAAATGCCAGG - Intergenic
938668485 2:133564387-133564409 CAATAAATGAAAAAAATGTATGG - Intronic
938835650 2:135101184-135101206 AATTATATGAATAAAACAGAAGG - Intronic
938873150 2:135503662-135503684 AAGAATAAGAATACAATGGATGG + Intronic
939091005 2:137780211-137780233 CAGTATCTGGGTAAGATGGAAGG - Intergenic
939673054 2:145037540-145037562 CAGTATATGAATGAATTATAAGG - Intergenic
939857713 2:147380466-147380488 CTGAAGATGATTAAAATGGAAGG + Intergenic
941662703 2:168211604-168211626 AAATATAAGAATAAATTGGAAGG - Intronic
941798402 2:169627093-169627115 AAGTAAATAAATGAAATGGAAGG - Intronic
942149597 2:173061988-173062010 CAGGATATGAAGAGAAAGGAAGG - Intergenic
942414460 2:175744380-175744402 CAGTTTGTGACTATAATGGAAGG - Intergenic
943508783 2:188798156-188798178 CTGAATATGAATAAAATTGGTGG - Intergenic
943695214 2:190921151-190921173 CAGTTTTTGAATAAGATGGCTGG + Exonic
945763258 2:213941742-213941764 CAGTATATGAATAAAATGGAAGG - Intronic
946779901 2:223183577-223183599 CAGTTTAGGAATATAATGGGAGG + Intronic
947635165 2:231676731-231676753 AAATAAATAAATAAAATGGAAGG - Intergenic
1170317365 20:15057258-15057280 CAGTCCTGGAATAAAATGGAGGG - Intronic
1174422172 20:50406344-50406366 GAGTAAATGAATAGAATGGGCGG + Intergenic
1178175303 21:30090240-30090262 AAGAATATGAATAAAATTAATGG - Intergenic
1178591204 21:33912027-33912049 AAATATAAGATTAAAATGGATGG - Intronic
1178732675 21:35119026-35119048 CAGCATATGAATAAAATAAAGGG + Intronic
1179151972 21:38816639-38816661 CAGGAAATTAATAAAATGGATGG - Intronic
1179408800 21:41146249-41146271 CAGGACATGAGAAAAATGGATGG + Intergenic
1181527751 22:23499863-23499885 CAGAATAGAAATAAAATGAATGG - Intergenic
1182388879 22:29973052-29973074 CAGTATATAATTAAAATCAATGG - Intronic
1183876601 22:40787903-40787925 AAGTAAATGCATTAAATGGAAGG - Intronic
1184051682 22:42010902-42010924 CACCATATGAACAAAATGAAGGG - Intronic
949263020 3:2124315-2124337 CAGTATGTTATTAAAATGGGCGG + Intronic
949312048 3:2710974-2710996 CATTAAATCAATAAAATGGCAGG + Intronic
949428991 3:3952612-3952634 CAGTATATGTATAATTTGTATGG + Intronic
950435251 3:12975474-12975496 CAGTGTATCTGTAAAATGGAAGG - Intronic
950919094 3:16675948-16675970 CAGTATAGGAATTAACTGCATGG + Intergenic
951142813 3:19186465-19186487 CAATATATGAATAAAAGACAAGG - Intronic
951201862 3:19884271-19884293 TAGAATATGAATTAAATGCAAGG + Intronic
951716527 3:25653826-25653848 CACTATATTAACAAAATGAAGGG + Intronic
951733640 3:25837879-25837901 CAGTACATGAACAAAATGAGAGG + Intergenic
951853202 3:27166504-27166526 CAGATTATGAAAAAGATGGAGGG + Intronic
952051133 3:29385719-29385741 CAAAATATGAATAAAATCAATGG - Intronic
952347934 3:32505641-32505663 CAATTTATGAAGAAAATGTAAGG - Intergenic
952563536 3:34626250-34626272 CAGTATTAAAATAAAATGGAAGG - Intergenic
954533141 3:51338042-51338064 GGGTATATGAATTAAGTGGAAGG - Intronic
955623040 3:60886553-60886575 TAGTATATGGAAAAAATAGAGGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956665216 3:71636081-71636103 TCGTTTATGAATAAGATGGACGG + Intergenic
956962342 3:74417511-74417533 CAATGAATGAATACAATGGATGG + Intronic
957902567 3:86514174-86514196 CAGAGCATGAATAAAAGGGAGGG + Intergenic
958176645 3:90003697-90003719 CAGCATAAAAATAAAATGAAAGG - Intergenic
958482659 3:94663211-94663233 CCGTATATAAATAAAGTGCAAGG - Intergenic
959260040 3:104066718-104066740 CAGACTATGAATAATATAGATGG + Intergenic
959289379 3:104453290-104453312 CTGAACATGAAAAAAATGGAGGG + Intergenic
959328520 3:104971267-104971289 CAGAAAATCAATAAAATGGCAGG - Intergenic
960032835 3:113072222-113072244 CAGTCTATGACTAAAATGACAGG + Intergenic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
960964859 3:123097698-123097720 AAGGACATGAAGAAAATGGAGGG - Intronic
962067522 3:131997515-131997537 CTTTATGTGAATAAAATGAAAGG + Intronic
962755485 3:138462661-138462683 CAATCAATCAATAAAATGGAAGG - Intronic
963156614 3:142105081-142105103 CAGAATATGTATAAACTGGAGGG - Intronic
966197627 3:177329115-177329137 AAGTATATGAATTAAATAAATGG + Intergenic
967778102 3:193405502-193405524 CAGTGCAGGAAGAAAATGGAAGG - Intronic
968149581 3:196326499-196326521 CAGTTTATCTGTAAAATGGAGGG + Intronic
970324302 4:14907122-14907144 CAGGAAAGGAATTAAATGGAAGG - Intergenic
970986961 4:22170336-22170358 AAGTAAATCAATAAAAAGGAGGG - Intergenic
971596150 4:28531464-28531486 ATGTATATGAATTAAATAGATGG + Intergenic
971692486 4:29855085-29855107 CAGAATAGGAATAAAATCCAAGG + Intergenic
973033453 4:45373568-45373590 CAGTATATGACCAGAAGGGATGG + Intergenic
974559129 4:63494537-63494559 TAGTATATAAAAAAAATGTAAGG - Intergenic
974571319 4:63652910-63652932 CAGTATGAGAATCAAATGCACGG + Intergenic
974648831 4:64728081-64728103 GAGAATTTGAATAGAATGGAAGG - Intergenic
974900620 4:67992717-67992739 AAGTATGTCAAGAAAATGGAAGG - Intergenic
975191147 4:71464082-71464104 CAGTGTATGCATAAGATGAAAGG - Intronic
976424764 4:84889924-84889946 CAGTATATGATAAATATGGTGGG + Intronic
977004532 4:91548315-91548337 CCGTGTATAAATAAAATGAATGG - Intronic
978261902 4:106769677-106769699 CAGAAAACAAATAAAATGGAAGG + Intergenic
978265690 4:106821877-106821899 CATTAAATGATTAAAATGAAGGG - Intergenic
978725071 4:111959945-111959967 AAGTAAATGAATGAAAAGGAAGG + Intergenic
978952308 4:114575611-114575633 CAGTGTCTGAATAAAAAGGCTGG - Intergenic
979317762 4:119285167-119285189 CAGAATTTGAATGAAAAGGATGG + Intronic
981611261 4:146596367-146596389 CATTATATCAATATAAAGGAGGG - Intergenic
984127526 4:175830687-175830709 GAGTGTATAAATAAAATAGAAGG + Intronic
984935056 4:184882647-184882669 CAGTTTATGAAAGAAAGGGAGGG + Intergenic
985025360 4:185734561-185734583 CAGCATTTTAATAGAATGGAAGG + Intronic
986093228 5:4531857-4531879 AAGTATAAGAACAAAATAGAGGG - Intergenic
986373727 5:7108364-7108386 TAGAATATTAATAAAATGGAGGG + Intergenic
986753182 5:10809108-10809130 CTGTATATTAATCAACTGGAGGG - Intergenic
987273858 5:16341490-16341512 GAGTTTATGAATAAAATTCAGGG - Intergenic
988261911 5:28897763-28897785 AAGTACAAGAATAAAATTGATGG + Intergenic
988451203 5:31344771-31344793 TAGTGTGTGAATAAAATGAAGGG - Intergenic
989362394 5:40617694-40617716 AAGTAAATGAAAAAAATTGATGG - Intergenic
990152868 5:52840166-52840188 AAGTAAATGAATAAAATTCATGG + Intronic
990259028 5:54001214-54001236 AAGGAAATGAATAAAAGGGAGGG - Intronic
990345921 5:54871334-54871356 CAGTAGATGAAAAAAAGGTAAGG - Intergenic
990851271 5:60207434-60207456 CAGAGGATGAATAACATGGAGGG + Intronic
993210443 5:84943243-84943265 GAGAATATCAAAAAAATGGAAGG - Intergenic
993418891 5:87674901-87674923 CAGAATATGAATATAATGCCTGG + Intergenic
993429651 5:87815810-87815832 CAGTAAATGAATAAGATGACTGG - Intergenic
993813545 5:92512590-92512612 CACTATTAGAAGAAAATGGAGGG + Intergenic
993908855 5:93655774-93655796 CAAAGTATGAAAAAAATGGAAGG + Intronic
994830686 5:104778936-104778958 TAGTGTATGAAGAAAATGGCAGG + Intergenic
995202011 5:109435775-109435797 CAGAAAATAAAAAAAATGGAAGG + Intergenic
995397011 5:111697789-111697811 CAGTATAAGAATAAAAGCCACGG - Intronic
995875864 5:116788849-116788871 CACCATATGATTGAAATGGAAGG - Intergenic
996738052 5:126775682-126775704 CAGTGAATCTATAAAATGGATGG + Intergenic
996914444 5:128695383-128695405 CAGTATCTGAATAAAATTGTGGG - Intronic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
996995271 5:129688092-129688114 CAGTTCATAAATAAAGTGGATGG + Intronic
997917416 5:137941943-137941965 CATTTTATCAACAAAATGGAAGG - Exonic
998487007 5:142511688-142511710 CAGAGGATGAATTAAATGGAAGG + Intergenic
1000254314 5:159523433-159523455 CAGGATGTAAATAAAGTGGAAGG - Intergenic
1000655829 5:163876766-163876788 CAGTATATGAATATCAGAGAGGG + Intergenic
1000972150 5:167726441-167726463 AAGTAAATAAATAAAAAGGAAGG - Intronic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004691819 6:17998720-17998742 CAGCACCTGAATGAAATGGAAGG + Intergenic
1004821273 6:19370707-19370729 AAGAATAGGAACAAAATGGAGGG + Intergenic
1004864844 6:19842989-19843011 CAGAATATGAATAAATATGAAGG - Intergenic
1005219031 6:23564879-23564901 TTGTATATAAATAAAATGTAAGG + Intergenic
1005847788 6:29794729-29794751 GAGTTTATGAAAAAAATGGAGGG - Intergenic
1006795113 6:36727192-36727214 CTGTATTTGTATAAAATAGAGGG + Intronic
1007068807 6:39019670-39019692 AAGTAAATGAAGAAAAGGGATGG + Intronic
1008342622 6:50385992-50386014 TAATAAATGAATAAAATGAATGG + Intergenic
1008421829 6:51309862-51309884 GAATGGATGAATAAAATGGATGG + Intergenic
1009460106 6:63902844-63902866 CAGTATATGAATAAAGATGTAGG + Intronic
1009688131 6:66990255-66990277 CAATATATGAACAAAATGAGAGG - Intergenic
1010588217 6:77680611-77680633 CAGAAGATGTATAGAATGGAAGG + Intergenic
1010739831 6:79487731-79487753 CAGAATATGGATAAATTGCAAGG - Exonic
1010826131 6:80478160-80478182 CAGGCTTTGAGTAAAATGGAAGG - Intergenic
1013880402 6:114892474-114892496 CTGCTTATGTATAAAATGGATGG - Intergenic
1015265205 6:131284730-131284752 AGGTTTATGAAGAAAATGGAAGG + Intergenic
1015514174 6:134068486-134068508 CAATCTATGAAAAACATGGAGGG + Intergenic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1016230447 6:141797665-141797687 TATTATATGAATCAAATGTATGG + Intergenic
1016615421 6:146042253-146042275 CAGTTTATAAATCAATTGGAAGG + Intronic
1020052007 7:5087895-5087917 CCTTATATTAATAAAAGGGATGG - Intergenic
1020425370 7:8060351-8060373 CACTAAATGAGTAAACTGGATGG - Intronic
1020492647 7:8807827-8807849 CAGTATATGATTACCATGGGTGG - Intergenic
1022321838 7:29295212-29295234 AAATATTTGAAAAAAATGGATGG - Intronic
1023652126 7:42382474-42382496 CAGAATTTGAATAAAATGGTTGG - Intergenic
1027387094 7:77669570-77669592 CCTTATATCAATAACATGGAGGG - Intergenic
1028515537 7:91674078-91674100 CAGTAAATGCATCAAATAGATGG + Intergenic
1028538321 7:91914347-91914369 CAGTCTATGATTAATATAGATGG - Intergenic
1031441317 7:121798113-121798135 CACAAGATGAATAAAATGAAAGG + Intergenic
1031449612 7:121898528-121898550 CAGTATATTAAAAAAAATGAAGG - Intronic
1031531500 7:122882334-122882356 AGGTATATGAATTATATGGAAGG + Intronic
1031565715 7:123294870-123294892 TACTATGTGAATAAAATAGAGGG - Intergenic
1031725944 7:125239027-125239049 CAGTAGATGATTAAAATTTAAGG - Intergenic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1033022221 7:137737642-137737664 CAGTATCTAAATAATATGTAGGG - Intronic
1033186808 7:139233941-139233963 AGGTATATGAAAAAAATAGAAGG - Intronic
1033999667 7:147397658-147397680 TGGTAAATTAATAAAATGGAAGG + Intronic
1035786403 8:2264585-2264607 GATTATATGAATAAAATGATAGG + Intergenic
1035806404 8:2457131-2457153 GATTATATGAATAAAATGATAGG - Intergenic
1036728084 8:11238148-11238170 CAGTATTGGAGTAAAATGGCAGG + Intergenic
1038319892 8:26516146-26516168 CCTTATATGAATAAATTAGAGGG - Intronic
1039237535 8:35518322-35518344 AGATATATAAATAAAATGGAAGG - Intronic
1040275052 8:46007811-46007833 AAGTAGATGAATCAAATGAAAGG - Intergenic
1041620823 8:59966641-59966663 CAGTGTATGAAGAAAATTCACGG + Intergenic
1043638762 8:82421978-82422000 CAAAATATTAATAAAATGAAAGG - Intergenic
1044120306 8:88386593-88386615 CAGTTTATAAGTAAAATGGCTGG + Intergenic
1045557350 8:103227336-103227358 CTGTTTAGGAACAAAATGGAAGG - Intronic
1046817754 8:118603838-118603860 TAATATATGAATATATTGGAAGG + Intronic
1046868289 8:119175236-119175258 CAGAATATAAGTGAAATGGATGG + Intronic
1048052762 8:130834855-130834877 CATTATATATATAACATGGATGG + Intronic
1048554969 8:135466818-135466840 GAATAAATGAATAAAATGAAAGG - Intronic
1051110885 9:13634397-13634419 CAGTAAATGATAAAAATGGAGGG + Intergenic
1051434297 9:17014364-17014386 AAGAAAATGAATAAAAAGGAGGG - Intergenic
1051468011 9:17403048-17403070 CAGTATATCAAAAACTTGGAAGG + Intronic
1051962465 9:22784497-22784519 AGATATGTGAATAAAATGGAAGG - Intergenic
1052008164 9:23375282-23375304 CAGTATATGAGTCAAATGTGGGG + Intergenic
1052712371 9:32072123-32072145 TAAAATATAAATAAAATGGAAGG - Intergenic
1053676990 9:40442090-40442112 AAGTTTATTAATAAAATTGAAGG - Intergenic
1053926754 9:43068190-43068212 AAGTTTATTAATAAAATTGAAGG - Intergenic
1054286728 9:63182815-63182837 AAGTTTATTAATAAAATTGAAGG + Intergenic
1054290060 9:63277619-63277641 AAGTTTATTAATAAAATTGAAGG - Intergenic
1054388089 9:64582159-64582181 AAGTTTATTAATAAAATTGAAGG - Intergenic
1054507633 9:65934209-65934231 AAGTTTATTAATAAAATTGAAGG + Intergenic
1054987692 9:71281408-71281430 AAATATGTGAATAAAATAGATGG - Intronic
1055078466 9:72242233-72242255 AAGTATATGAACCAAATGCATGG - Intronic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1056569242 9:87801544-87801566 TAGTAGATGAAAAAAATGGAAGG - Intergenic
1056711769 9:88997460-88997482 CAGGACATGTATAAAATGGTAGG + Exonic
1059190946 9:112325560-112325582 CACTATGTGAATATAATGCAGGG - Intronic
1060289570 9:122288670-122288692 TGGGATATGAAGAAAATGGAAGG + Intronic
1060359157 9:122938409-122938431 CAGTATATGAATGGAATGTGGGG - Intergenic
1061256491 9:129456617-129456639 CAGAATAAAAATAAAATGAATGG + Intergenic
1061699211 9:132402814-132402836 CCATATAGGAATAAAATGGAAGG - Exonic
1062669203 9:137696708-137696730 CAAGACATGAAGAAAATGGAAGG - Intronic
1185970764 X:4660179-4660201 AAGTATATTAATAAAATAAAAGG + Intergenic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1186081706 X:5940813-5940835 CAGTAAAAGAATAAAATGTTAGG + Intronic
1186794443 X:13030744-13030766 CAGTAGATGAATAGATTGAATGG + Intergenic
1186990220 X:15059238-15059260 CAGTTTAAGTACAAAATGGAAGG - Intergenic
1187255460 X:17637816-17637838 AAGCATAGGAATAAAATGCAGGG + Intronic
1187427220 X:19189055-19189077 CAATAAATAAATTAAATGGAAGG - Intergenic
1188331267 X:28874325-28874347 TAGTATGTGAATAAAAATGATGG - Intronic
1189059824 X:37741005-37741027 CAGTATATCAACGGAATGGAAGG + Intronic
1191666948 X:63713274-63713296 CAGTTTATAAAGGAAATGGAAGG + Intronic
1193178726 X:78427944-78427966 GAGTATATAAATAAATTTGAGGG - Intergenic
1193263884 X:79444428-79444450 CATTATATCAACAAAATGAAGGG - Intergenic
1193472485 X:81924293-81924315 CAGTATCTGAATGAAATCTAAGG - Intergenic
1193621784 X:83761911-83761933 AAGTATATAATTTAAATGGATGG + Intergenic
1194101409 X:89710130-89710152 CAGAATAAGAATTAAATGCATGG + Intergenic
1194305575 X:92243541-92243563 CTGAAAAAGAATAAAATGGAAGG - Intronic
1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG + Intronic
1195743876 X:108094592-108094614 CAGTCTAAGCATAAAATTGAGGG - Intronic
1196062238 X:111422285-111422307 AAGAATAAGAATAAAATGGGAGG - Intergenic
1196309337 X:114143821-114143843 AAGTATAAAAATAAAATGGGTGG - Intergenic
1198716905 X:139567386-139567408 CAATGTATGAATGAAAAGGAAGG + Intergenic
1199231505 X:145441758-145441780 CAATATCAGAATAAAATGGTAGG + Intergenic
1200454361 Y:3371214-3371236 CAGAATAAGAATTAAATGCATGG + Intergenic
1201218736 Y:11746381-11746403 CATTAAAGGAATAAAATGGAAGG + Intergenic
1201375360 Y:13312912-13312934 GAGGATGTGAAGAAAATGGAAGG + Intronic