ID: 945764027

View in Genome Browser
Species Human (GRCh38)
Location 2:213950867-213950889
Sequence AAGGTCCCCCAAAATTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945764027_945764032 16 Left 945764027 2:213950867-213950889 CCCTGCTAATTTTGGGGGACCTT 0: 1
1: 0
2: 3
3: 19
4: 192
Right 945764032 2:213950906-213950928 TCTCTCTATGTTGCCCAGGCTGG 0: 526
1: 15443
2: 81671
3: 197145
4: 384010
945764027_945764031 12 Left 945764027 2:213950867-213950889 CCCTGCTAATTTTGGGGGACCTT 0: 1
1: 0
2: 3
3: 19
4: 192
Right 945764031 2:213950902-213950924 AGTGTCTCTCTATGTTGCCCAGG 0: 12
1: 489
2: 7629
3: 48083
4: 136036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945764027 Original CRISPR AAGGTCCCCCAAAATTAGCA GGG (reversed) Intronic
900662723 1:3793427-3793449 AATGTCTCCCAAAGTTAGCTTGG - Intronic
900952601 1:5866257-5866279 AAGCTCCCCCAATTTTAGGAAGG + Intronic
901044769 1:6389363-6389385 AAGGTCCCCCTCCATCAGCATGG + Intronic
901253649 1:7801682-7801704 AACATCCCCCAAAAGTAGGAAGG - Intronic
901596416 1:10389014-10389036 AAACCCCCCCAAAATTAGCTGGG - Intergenic
903157714 1:21459569-21459591 AATGTCCCCCAAAATTAAAATGG + Intronic
903627002 1:24738031-24738053 AAAAACCCCCAAAATTAGCCAGG - Intergenic
907081944 1:51631752-51631774 AATGTCTCCCAAAGTTAGCTTGG + Intronic
913284813 1:117216562-117216584 AATGTCTCCCAAAATTAGCTTGG + Intergenic
914865002 1:151419506-151419528 AAAACCCCCCAAAATTAGCTGGG + Intronic
920154486 1:203937456-203937478 AAAATACCCCAAAATTAGCTGGG + Intergenic
920223853 1:204424069-204424091 AAAGTCCCCCCAAAAGAGCATGG + Exonic
920293357 1:204939821-204939843 AAGGTACCCCTACATCAGCAAGG - Intronic
921302546 1:213764813-213764835 AAGGTTCCAAAAAATTAGAAGGG + Intergenic
922302174 1:224311216-224311238 AAAACCCCCCAAAATTAGCCAGG - Intronic
922481945 1:225945244-225945266 GAGGTCCCCCAACATCAGGAAGG - Intergenic
923382380 1:233434488-233434510 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
924432112 1:244005995-244006017 AAGCTCCCCCAAAATTAGCTGGG + Intergenic
1063723984 10:8616285-8616307 ATGGTGACCCAAAATTAGCCTGG + Intergenic
1065221065 10:23496400-23496422 AAATTCCCCCAAAATTAGCCCGG + Intergenic
1065409956 10:25414268-25414290 AAGGTCCAGGGAAATTAGCAAGG - Intronic
1066249017 10:33615014-33615036 AATGTCCCCCAAAGTTAGCCTGG - Intergenic
1066570705 10:36768518-36768540 AAAAACCCACAAAATTAGCAGGG + Intergenic
1066695346 10:38072453-38072475 AAAGTTCCCCAAAACTAGCACGG - Intergenic
1068187219 10:53600526-53600548 AATTTTCCCCAAAATTAGCTTGG + Intergenic
1068302499 10:55162563-55162585 AATGTCTCCCAAAGTTAGCTTGG - Intronic
1068505451 10:57894356-57894378 AATGTCTCCCAAAGTTAGCATGG - Intergenic
1070547121 10:77461332-77461354 AAGTTGCCCCACAAATAGCAGGG - Intronic
1071858571 10:89649872-89649894 AACGTCTCCCAAAGTTAGCTTGG + Intergenic
1077589374 11:3479773-3479795 GGGGTCCCCCAAAATAGGCAAGG - Intergenic
1078855701 11:15204980-15205002 AAAGTCCCCCAAACCCAGCAAGG - Intronic
1079296199 11:19236752-19236774 AAGGTACCCCAAATTCACCACGG + Intronic
1079532325 11:21469261-21469283 AAAGTCCCTCAAAACTAGAATGG - Intronic
1083287900 11:61672326-61672348 AAACACCCCCAAAATTAGCCAGG + Intergenic
1083539112 11:63499548-63499570 AATGTCTCCCAAAGTTAGCTTGG - Intergenic
1085487925 11:76884189-76884211 AAGAGCTCCCAAAATTTGCAAGG - Intronic
1086971896 11:93090381-93090403 AAATTCCCCCCAAATTAGCTGGG - Intergenic
1087016335 11:93557879-93557901 AAGCTCCCACAAGTTTAGCAAGG + Intergenic
1087566598 11:99867657-99867679 AAGGGCCCTCAAAAGTAGAAGGG - Intronic
1090858101 11:130629003-130629025 TAGCTCCCCCTAAATTACCAAGG - Intergenic
1091757713 12:3065936-3065958 AAAAAACCCCAAAATTAGCAGGG + Intergenic
1093065536 12:14654339-14654361 AAGGTCACCCGAAGTCAGCAAGG - Intronic
1093298960 12:17429173-17429195 AAAGCCCCCCAAAATTAGCCAGG - Intergenic
1096977884 12:55709895-55709917 GAGGCCACCCAAAATTAGCCTGG + Intronic
1097255387 12:57669862-57669884 AAAATCCCCAAAAATTAGCCGGG + Intergenic
1099058699 12:77878384-77878406 AAATACCCCCAAAATTAGCCAGG - Intronic
1100379621 12:94049477-94049499 AAGGTACACAAAAATTAGCCAGG - Intergenic
1101565131 12:105897682-105897704 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1103728548 12:123011273-123011295 CAGCTCCACCAAAATCAGCAGGG + Intronic
1103908298 12:124338693-124338715 CCGGTCCCCCACATTTAGCAAGG - Intronic
1104237508 12:126953331-126953353 AATTTCTCCCAAAATTAGCTTGG + Intergenic
1106207562 13:27614095-27614117 AATTTCTCCCAAAATTAGCTTGG - Intronic
1106750120 13:32754815-32754837 AAGGTGCACCAAAATAAGAATGG - Intronic
1108620667 13:52180393-52180415 AACGTCCCCCCAAATTGGGAAGG - Intergenic
1111849998 13:93560808-93560830 ATGTTCCCACAAAATTAACAGGG - Intronic
1112185924 13:97127700-97127722 AATTTCCCCCACAATTTGCATGG + Intergenic
1115732622 14:36287740-36287762 CAAATCCCCCAAATTTAGCATGG - Intergenic
1120209062 14:81616493-81616515 AAGTTCTCCCAAAGTTAGCTTGG - Intergenic
1120804257 14:88728824-88728846 AATCTCCCCCAAAAATAGCAAGG + Intronic
1122225339 14:100273447-100273469 AAAATCCCCCAAAATCAGCCAGG - Intronic
1125802742 15:42464685-42464707 AAAAACCCCCAAAATTAGCTGGG - Intronic
1127940217 15:63687629-63687651 CAGGTCCTCCATATTTAGCAGGG + Intronic
1129067667 15:72920606-72920628 AAAGTCCCCCAAGATCTGCAGGG - Intergenic
1131852498 15:96557740-96557762 AATGTCACCCAAAATTTCCATGG - Intergenic
1133341499 16:5039453-5039475 AAAAACCCCCAAAATTAGCCGGG + Intronic
1133502516 16:6379316-6379338 AAGGTGGCCCAAAATTAGGATGG + Intronic
1134175638 16:12003930-12003952 AATTTTCCCCAAAATTAGCCTGG - Intronic
1134283095 16:12835417-12835439 ATGTTCCCACAAAAATAGCATGG - Intergenic
1134508982 16:14831224-14831246 CAGGACCCCGAGAATTAGCAAGG - Intronic
1134605753 16:15569968-15569990 AATGTCTCCCAAAGCTAGCATGG + Intronic
1134696683 16:16230058-16230080 CAGGACCCCAAGAATTAGCAAGG - Intergenic
1134975150 16:18564647-18564669 CAGGACCCCGAGAATTAGCAAGG + Intergenic
1138705205 16:58908575-58908597 AATGTCTCCCAAAGTTAGCTTGG - Intergenic
1139020890 16:62747775-62747797 AAAGACGCCCACAATTAGCAAGG - Intergenic
1139198282 16:64947224-64947246 AAGCTTCCACAAAATTAGAAAGG - Exonic
1139578037 16:67854785-67854807 AAGATTCCAAAAAATTAGCAGGG + Intronic
1139647516 16:68342314-68342336 AATGTCTCCCAAAGTTAGCTTGG + Intronic
1139830592 16:69794554-69794576 AATTTCTCCCAAAATTAGCTTGG + Intronic
1140144033 16:72287946-72287968 AGGGTCCATGAAAATTAGCAAGG + Intergenic
1145030260 17:19499791-19499813 AAGGTCAGCCAAAATTGTCATGG + Intronic
1146975027 17:37103879-37103901 CATGCCCCCCAAAATTAGCCAGG + Intronic
1148057373 17:44808604-44808626 ACACACCCCCAAAATTAGCATGG + Intronic
1148089637 17:45015533-45015555 AAAATCCCCCAAAACTAGCCAGG + Intergenic
1148627218 17:49078829-49078851 AATTTCTCCCAAAGTTAGCATGG - Intergenic
1151741301 17:75984103-75984125 AATGTCTCCCAAAGTTAGCTTGG + Intronic
1153745474 18:8174293-8174315 AATGTCTCCCAAAGTTAGCTTGG + Intronic
1153997909 18:10457213-10457235 AAGGTTTGCCATAATTAGCAAGG + Intronic
1154309265 18:13254801-13254823 AAAAGCCCCCAAAATTAGCTGGG + Intronic
1155255579 18:23995307-23995329 AAAATACCCCAAAATTAGCCAGG + Intronic
1156243353 18:35274174-35274196 AAAGCCCCCAAAAATTAGCTGGG - Intronic
1156291552 18:35752439-35752461 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1156294220 18:35775061-35775083 AATGTCTCCCAAATTTAGCTTGG - Intergenic
1156869313 18:41927257-41927279 TATGTCCCCCAAAACTACCAAGG + Intergenic
1157188952 18:45564601-45564623 AATGCCCCCCAAAATGAGGAAGG + Intronic
1157368142 18:47085354-47085376 AATGTCTCCCAAAGTTAGCTTGG - Intronic
1161807223 19:6451566-6451588 CAGGTCTCCCCCAATTAGCATGG - Intronic
1162745851 19:12797816-12797838 AAAGTACCAAAAAATTAGCAGGG - Intronic
1162839907 19:13348845-13348867 AAAACCCCCCAAAATTAGCTGGG + Intronic
1164179502 19:22806974-22806996 AAGGTCCCCCGAGATGAGGAGGG - Intergenic
1164291586 19:23874158-23874180 AAGGTACACCAAAATAAACAAGG + Intergenic
1167296986 19:48656553-48656575 AAATCCCCCCAAAATTAGCCAGG - Intergenic
1168019053 19:53595523-53595545 AATGTCTTCCAAAATTAGCTTGG + Intergenic
930076910 2:47413466-47413488 AATGTCCATCAAAATTAGAATGG - Intronic
930834141 2:55774771-55774793 AATGTCACCCAAAATAAGAAAGG - Intergenic
932157937 2:69435214-69435236 AATGTCTCCCAAAGTTAGCTTGG + Intronic
933625903 2:84598660-84598682 AAGGTCCCTCAAAATAACAAGGG - Intronic
934090733 2:88548388-88548410 AAAAACCCCCAAAATTAGCTGGG + Intergenic
935095905 2:99944090-99944112 AGGGTCTCCCTAAATTACCAAGG + Intronic
938773548 2:134521525-134521547 AGGGTTTCCCAAAATTAGCATGG - Intronic
938821024 2:134960328-134960350 AAAACCCCCCAAAATTAGCCGGG - Intergenic
939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG + Intronic
942634717 2:177990831-177990853 AAGGTCAACAAAAATTAGCTGGG + Intronic
945764027 2:213950867-213950889 AAGGTCCCCCAAAATTAGCAGGG - Intronic
946199519 2:218063748-218063770 TCGGTTCCCCAAAACTAGCAGGG + Intronic
946611901 2:221467685-221467707 CATGTCCACCAGAATTAGCAGGG + Intronic
1172799028 20:37563607-37563629 AATGTCTCCCAAAGTTAGCTTGG - Intergenic
1173190275 20:40870668-40870690 AAAAACCCCCAAAATTAGCTAGG - Intergenic
1173357586 20:42308430-42308452 AAAGTCCTCCAAAGTTAGGAAGG + Intronic
1175071264 20:56335927-56335949 AATTTCTCCCAAAATTAGCTTGG + Intergenic
1177199373 21:17936693-17936715 AAGGTCCACAGAAATTAGGAAGG + Intronic
1180758952 22:18184192-18184214 AAAGTCCCCCAAAACTGGCACGG + Intergenic
1180769239 22:18367983-18368005 AAAGTCCCCCAAAACTGGCACGG + Intergenic
1180777073 22:18494412-18494434 AAAGTCCCCCAAAACTGGCACGG - Intergenic
1180809795 22:18751750-18751772 GAAGTCCCCCAAAACTGGCACGG - Intergenic
1180827111 22:18871212-18871234 GAAGTCCCCCAAAACTGGCACGG + Intergenic
1181195933 22:21185973-21185995 GAAGTCCCCCAAAACTGGCACGG - Intergenic
1181213595 22:21307151-21307173 GAAGTCCCCCAAAACTGGCACGG + Intergenic
1181524284 22:23470457-23470479 GAAGTCCCCCAAAACTAGCACGG + Intergenic
1183252963 22:36743373-36743395 AGGTTGCCCCAAAAGTAGCATGG - Intergenic
1183444965 22:37847495-37847517 AATGTCTCCCAAAGTTAGCTCGG + Intronic
1203230868 22_KI270731v1_random:108868-108890 GAAGTCCCCCAAAACTGGCACGG + Intergenic
1203277256 22_KI270734v1_random:97117-97139 AAAGTCCCCCAAAACTGGCACGG + Intergenic
950310266 3:11951800-11951822 AATGTCCACCAAAAGTAGAATGG + Intergenic
950986940 3:17382719-17382741 AAAGTACCACAAAATTAGCTGGG - Intronic
951131793 3:19055524-19055546 GAGAACCCCCAAGATTAGCACGG + Intergenic
951766249 3:26203006-26203028 AATGTACCCAGAAATTAGCAAGG + Intergenic
954178826 3:48865614-48865636 AAAGTCCCCCAAAATTAGCTGGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
958677884 3:97290743-97290765 AAGGACCCCAAAAACTAGAATGG - Intronic
960564150 3:119116567-119116589 AATGTCTTCCAAAGTTAGCATGG - Intronic
965307075 3:167079467-167079489 AATGTCCCCCAAATTTCACATGG - Intergenic
966162516 3:176983334-176983356 AATGTCTCCCAAAGTTAGCGTGG + Intergenic
966412036 3:179654051-179654073 AAAGAACCCCAAAATTAGCCGGG + Intronic
967096854 3:186184382-186184404 AAGGTCATTCAAGATTAGCATGG - Intronic
968118660 3:196108994-196109016 AAATACCCCCAAAATTAGCTGGG - Intergenic
968155722 3:196379239-196379261 AAGATCCCCCAAAACCAACATGG - Intronic
970857216 4:20662732-20662754 AAAGTCCCCCAAAATATGCCTGG + Intergenic
974183003 4:58407319-58407341 AAGGCCCACCCAAATTATCAAGG - Intergenic
979516031 4:121611335-121611357 ATGTTCCCCCAAAAGTAGCAAGG - Intergenic
979711754 4:123788101-123788123 ATTTTCCCCCCAAATTAGCAGGG + Intergenic
979807197 4:124988789-124988811 AATGTCTTCCAAAATTAGCTTGG + Intergenic
981647739 4:147019254-147019276 AGTGTCCCCCAACATTAGCGAGG + Intergenic
983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG + Intergenic
986212343 5:5685926-5685948 AATGTCTTCCAAAATTAGCTTGG - Intergenic
987757154 5:22110874-22110896 AATGTCTCCCAAAGTTAGCTTGG + Intronic
988153312 5:27415685-27415707 TAGGTCCCCCCAAATTTCCATGG - Intergenic
989412899 5:41140723-41140745 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
989645988 5:43633084-43633106 ATGGTTCCCCTAAATTAGTAAGG - Intronic
990467769 5:56086163-56086185 AAAACCCCCCAAAATTAGCCAGG + Intergenic
991675972 5:69090320-69090342 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
992569147 5:78036186-78036208 ACTGTCCCCCAGAATTAGTATGG - Intronic
993650615 5:90517184-90517206 AAGGTCCTCTAATATTTGCAAGG + Exonic
995294578 5:110504752-110504774 AAGGGCCACCCAAATTAGGAAGG + Intronic
995927616 5:117394328-117394350 AAGGACTCCCAAAGTTATCAGGG - Intergenic
996902792 5:128562693-128562715 CAGGTCCACCCAGATTAGCAAGG - Intronic
997867596 5:137478612-137478634 AAGTTCCACCAAAATAAGCTAGG + Intronic
998796803 5:145828997-145829019 AAAAACCCCCAAAATTAGCCGGG - Intronic
1000080770 5:157844521-157844543 AAGGTCAGCCAAGATTAGTAAGG + Intronic
1000627055 5:163550711-163550733 AAGGTCTCCCTATATTAGCCAGG - Intergenic
1000702766 5:164473729-164473751 AGGGCCCCCCAAAAATGGCAAGG - Intergenic
1001470807 5:172011306-172011328 AACAACCCCCAAAATTAGCTGGG - Intergenic
1004448367 6:15723563-15723585 GAAGACCCCCAAATTTAGCATGG + Intergenic
1004474558 6:15959314-15959336 AATGTCCCCCAAAGTTAGTTTGG + Intergenic
1008225824 6:48915113-48915135 AATGTCCACCAAACTTAGAATGG + Intergenic
1009447542 6:63761141-63761163 AAGGCTTCCCTAAATTAGCAAGG + Intronic
1009884415 6:69607729-69607751 AAAGACCCCCAAAGTTAGAAAGG + Intergenic
1009930897 6:70176536-70176558 CAGGTCCCCCAGGAATAGCAGGG + Exonic
1011022850 6:82833591-82833613 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1011256899 6:85431819-85431841 AAGGTCTCCCAAAATTAGCTTGG - Intergenic
1016831881 6:148442244-148442266 CAGCCCCCCCAAAATTAGCCAGG + Intronic
1017581779 6:155872713-155872735 AACATCTCCCAAAATTAGCCAGG - Intergenic
1018208121 6:161454601-161454623 AAGTTCCCCCAAAATAAACTTGG - Intronic
1018437973 6:163780603-163780625 AAGGTCACCCTTAATTATCAGGG + Intergenic
1019817258 7:3210464-3210486 AATTTCCCCCAAAGTTAGCTTGG + Intergenic
1020323436 7:6956791-6956813 AGGGTCCCCCAAAAGAGGCAAGG - Intergenic
1022165984 7:27762789-27762811 AAATACCCCCAAAATTAGCCAGG + Intronic
1022577039 7:31507618-31507640 GAGTGCACCCAAAATTAGCAAGG + Intergenic
1023189862 7:37568739-37568761 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1024675696 7:51636321-51636343 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1026274975 7:68868768-68868790 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1029591791 7:101511830-101511852 AAAACCCCCCAAAATTAGCTGGG + Intronic
1033585041 7:142768370-142768392 CATGTCCCCCAAATTGAGCATGG + Intergenic
1034541473 7:151761146-151761168 AATTTCTCCCAAAATTAGCTTGG - Intronic
1036382204 8:8243840-8243862 AATGTCTCCCAAAGTTAGCTTGG - Intergenic
1036948688 8:13120485-13120507 GAGGCCCCCCAAAACAAGCATGG - Intronic
1037952727 8:23029340-23029362 ATGGGCCCCTAAAATTATCATGG + Intronic
1038339145 8:26669615-26669637 AATGTCTCCCAAAGTTAGCTTGG + Intergenic
1043787068 8:84416648-84416670 AAGGTCATCAAAAATTAGAATGG + Intronic
1044506947 8:93032483-93032505 AACGTCTCCCAAATATAGCATGG + Intergenic
1046537904 8:115539695-115539717 ATAATCCCCCAAAATTAGCCAGG + Intronic
1049559976 8:143305198-143305220 AAAAACCCCCAAAATTAGCTGGG - Intronic
1049637721 8:143697991-143698013 AAAGTCCACCAAGATTAGCAGGG + Intronic
1051912525 9:22170721-22170743 AAGTTCCCCCAAAGTGATCAGGG + Intergenic
1055352929 9:75407872-75407894 AATGTCTCCCAAAGTTAGCTTGG - Intergenic
1055484614 9:76745200-76745222 AATGTCCCCCAAAGTTAGCTTGG - Intronic
1057117184 9:92536692-92536714 AAGGTCCCTCATAAACAGCAGGG - Intronic
1058449215 9:105080523-105080545 AATGTCTCCCAAAGTTAGCTTGG - Intergenic
1062222299 9:135423409-135423431 AATGTCTCCCAAAGTTAGCATGG - Intergenic
1062660369 9:137628003-137628025 AAGGTCCACCAAAAATGGCCGGG - Intronic
1187967464 X:24626593-24626615 CAGGTCTCCCAAATGTAGCAGGG + Intronic
1188686336 X:33074904-33074926 AATGTCTCCCAAAGTTAGCTTGG - Intronic
1193827541 X:86244451-86244473 AATTTCCTCCAAAATTAGCTGGG + Intronic
1196737720 X:118994357-118994379 ATGGACACCCAAAATGAGCAGGG + Intronic
1197893223 X:131286115-131286137 AATGTCCCTTAAAATTAGCCCGG + Intronic
1201547780 Y:15184823-15184845 AAAGTCTCCCCAAATTATCAGGG - Intergenic