ID: 945765794

View in Genome Browser
Species Human (GRCh38)
Location 2:213976397-213976419
Sequence AAAACCAGTCCTTAACTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945765794 Original CRISPR AAAACCAGTCCTTAACTAAC AGG Intronic
901613291 1:10516759-10516781 AAAACCAGTACTTTAAAAACTGG + Intronic
902445753 1:16462973-16462995 AAAACAAGTCCTTACCTCATGGG - Intergenic
907728935 1:57047304-57047326 ACATCCAGTCCTTAACAGACAGG - Intronic
908619785 1:65965137-65965159 AAAACCTGTCCCTAAATAAAAGG - Intronic
911028623 1:93461921-93461943 CACACGAGTCCTTCACTAACAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
917981183 1:180270538-180270560 CAAACCAGACTTTAACTAACAGG + Intronic
922454308 1:225762558-225762580 AAAACCAGACATTACCTCACTGG - Intergenic
1065291608 10:24235946-24235968 AACACCTGTACTTAACTACCAGG - Intronic
1067357380 10:45542396-45542418 AAAACCTGACCTGAACTAACAGG + Intronic
1069282836 10:66677124-66677146 CAAACCAGTCATTTACAAACAGG - Intronic
1069579716 10:69557480-69557502 AAAAACATTCATTAACTAAGCGG - Intergenic
1070637372 10:78140070-78140092 AAACCCAGTCCTGAAAGAACCGG - Intergenic
1073964790 10:108977089-108977111 AAAGCCAGTCCTTAAAGCACTGG - Intergenic
1074251142 10:111749145-111749167 AAAACCATCCCTAAAATAACAGG + Intergenic
1074390930 10:113057564-113057586 AAAACCAGTAAATAAGTAACAGG + Intronic
1077727993 11:4695788-4695810 AAAACCATTGTTTAACAAACAGG - Intronic
1078188109 11:9069401-9069423 AAAACCAGGCCTGCACTCACAGG + Exonic
1079360332 11:19765518-19765540 GAAAGCTGTCCTTAACTGACGGG + Intronic
1081297985 11:41415265-41415287 AACACCCGTCCATAACTACCTGG - Intronic
1081760865 11:45575691-45575713 AAAGCCAAGCCTTAACTAGCTGG + Intergenic
1082771237 11:57209358-57209380 AAGACCAGTCCATCACTTACTGG + Intergenic
1089871242 11:121674196-121674218 AGAACCAGTCCTTAAGTGCCAGG - Intergenic
1091161486 11:133425487-133425509 AATAACAGTGCTCAACTAACAGG - Intronic
1092265141 12:6975163-6975185 AGAACCAGCCTTCAACTAACAGG - Intronic
1093607036 12:21104686-21104708 AAGATCAGTCCTAAACAAACTGG - Intronic
1097634374 12:62104677-62104699 ATAACTAGTCCTCAACTAAGAGG + Intronic
1098416355 12:70239593-70239615 AAAAACAGTACTAAACTAATAGG - Intergenic
1098575452 12:72036844-72036866 AAAACTAGTCCTTAGTTTACAGG + Intronic
1100089229 12:90950315-90950337 AAAAAAAGTCCTTAAATTACAGG - Intronic
1101470382 12:104991307-104991329 ATAACCACTACTTAATTAACTGG + Intronic
1102512462 12:113425065-113425087 AAAAACAGTCCCCAACTCACAGG - Intronic
1102824968 12:115941323-115941345 AAAACCAGTCATTACCAAAAGGG - Intergenic
1103267607 12:119644135-119644157 GATACCAGTCATTAACAAACAGG + Intergenic
1107700546 13:43042864-43042886 AAAATCAGTGTTTGACTAACTGG + Intronic
1107799083 13:44087357-44087379 AAAACCAGTTCTTTACTCAAAGG + Intergenic
1109236143 13:59823225-59823247 AAAAACAGACCTTTACTAATTGG - Intronic
1111264467 13:85790205-85790227 AAAACCATTTCTTAACTACCAGG + Intergenic
1112851447 13:103711333-103711355 AACACCAGTGCTTACCAAACCGG - Intergenic
1114332179 14:21648495-21648517 AAGACTAGTCCTTTACTAGCTGG + Intergenic
1114356569 14:21916069-21916091 AAATCCAGTCCATGACTCACTGG + Intergenic
1114906678 14:27137075-27137097 AAAAAAACTCCTTAACTAACAGG - Intergenic
1115298893 14:31861758-31861780 AATATCACTCCTTAACAAACAGG - Intergenic
1117107852 14:52417144-52417166 AACACCAGTCTTCAACCAACAGG + Intergenic
1118365135 14:65088276-65088298 AATACCAGTCCTTACCTAAATGG + Intronic
1121267854 14:92615914-92615936 AAAACCAGTTCTGAATAAACAGG - Intronic
1123992539 15:25694244-25694266 AAACACAGTCCTTAAATAACTGG + Intronic
1124924455 15:34057557-34057579 AAAAACAGTCCTTACCTCATAGG - Intronic
1127895517 15:63295380-63295402 AAAAACAGGCCTAAACTCACTGG - Intronic
1130035168 15:80353352-80353374 AAATCCAGTACTCAACAAACTGG + Intronic
1132512135 16:348639-348661 AAAAACAGTTCTTAATTAGCCGG + Intronic
1133523114 16:6577969-6577991 AAAACCTGTGCTTTCCTAACTGG - Intronic
1137415510 16:48274564-48274586 AAAAACAGTCTTTAAGAAACTGG - Intronic
1137969292 16:52968004-52968026 AAAACCAGACCTGAGCTAAGGGG + Intergenic
1141754978 16:85984848-85984870 CAGACCAGTCCTTAATAAACAGG + Intergenic
1150311514 17:64132539-64132561 AAAACCAGTGCTTATCTGTCTGG - Intergenic
1150828776 17:68499935-68499957 AAGACCATACATTAACTAACAGG + Intergenic
1153038855 18:791440-791462 AAAAATAGTCCTTAACTGAAAGG - Intronic
1156877507 18:42032758-42032780 AAATCTACTCCTTAACTAAATGG - Intronic
1159158750 18:64617376-64617398 ATAAACAGTGCTTAACTAATTGG + Intergenic
1159879535 18:73845361-73845383 ATAACCAGTCCTCAAGTAAGAGG + Intergenic
927469335 2:23360732-23360754 AAAACCAGTCTTAACCTCACTGG - Intergenic
932883190 2:75523449-75523471 AAAAACAGTCCTTATATCACCGG + Intronic
936999007 2:118445876-118445898 AAAAACAGTACTTAATAAACTGG - Intergenic
939706128 2:145456236-145456258 AAAACCATTCCTGAACCAACAGG + Intergenic
943521475 2:188956223-188956245 AAAACCTGTACTTAGCTAATAGG + Intergenic
945411854 2:209519281-209519303 ACAACCAGTCCTCAAGTAAAAGG + Intronic
945765794 2:213976397-213976419 AAAACCAGTCCTTAACTAACAGG + Intronic
946653468 2:221919334-221919356 TGAACCAGTCCTTAAATAATGGG + Intergenic
946751664 2:222898084-222898106 AAAACCAGTGTTTAACTCTCAGG + Intronic
1170481323 20:16767848-16767870 AAAACCACTCCTAAACTTAGTGG - Intronic
1173085803 20:39915745-39915767 AAAAAAAGTCCTTAACTAGTTGG - Intergenic
1177008537 21:15703680-15703702 TAAACCAGTTCTTAAATAAATGG - Intergenic
1177688582 21:24472843-24472865 AAAAACAGTTGTTAACTGACGGG - Intergenic
1177720381 21:24898949-24898971 AAAACCATTTCTTAAGTAGCAGG + Intergenic
949589117 3:5474886-5474908 AAAAGAAGTCCTTTACCAACTGG - Intergenic
959191948 3:103125004-103125026 AAAACAAGTCATTTACAAACAGG + Intergenic
959444568 3:106422695-106422717 ATCACCACTCCTCAACTAACCGG + Intergenic
966395502 3:179498731-179498753 AAAACCAAACCTCAACCAACTGG - Intergenic
970288540 4:14546229-14546251 AAAACTATTCCTTAACAAAATGG - Intergenic
970754689 4:19411293-19411315 ATAACCAGTCCTAACTTAACAGG - Intergenic
971504529 4:27351816-27351838 AGAACCAGTCCTTCACTTATGGG + Intergenic
973257663 4:48129421-48129443 AAAACAAGTACCTAGCTAACAGG + Intronic
979346259 4:119591136-119591158 AAAGCCAGTACTCAGCTAACTGG - Intronic
982328732 4:154157801-154157823 AAAATCAGCACTTAACTAAATGG + Intergenic
982362493 4:154535295-154535317 TAAACCAGTCCCTTACTGACAGG + Exonic
983342923 4:166488600-166488622 CCAACCAGTCCTGAACCAACAGG - Intergenic
986504715 5:8437270-8437292 AAAAACAGTCATTAACTTTCTGG - Intergenic
986856191 5:11871380-11871402 AAAAACAGTCCCTGTCTAACAGG + Intronic
987280516 5:16409336-16409358 AAAACAAATCCATAACTAATTGG - Intergenic
987906618 5:24086403-24086425 GAAAATAGTGCTTAACTAACAGG - Intronic
1000575627 5:162971777-162971799 AAAAACAGTCCTTAGCAAACTGG - Intergenic
1002632019 5:180588566-180588588 CTAACAATTCCTTAACTAACTGG - Intergenic
1004362198 6:14981129-14981151 TAAACCAGTCCTTGACCACCAGG - Intergenic
1008279620 6:49580674-49580696 AAAACTAGTCCTTAAATAAGAGG - Intergenic
1008731490 6:54488117-54488139 AAAACCTTTCCTTAAATATCTGG - Intergenic
1010275255 6:73961675-73961697 ATAACTAGTCCTTAAGTAAGAGG - Intergenic
1010370068 6:75097013-75097035 AAAAGAAATCCCTAACTAACTGG - Intronic
1011828587 6:91340937-91340959 AAAATCAGTGCTTCACTCACAGG - Intergenic
1012340124 6:98110871-98110893 AAAACAAGTCTATAACAAACAGG - Intergenic
1015371928 6:132463818-132463840 AAAAACAGTTCTAAACTGACTGG + Intronic
1015724764 6:136289121-136289143 AAAACGAGGCATTAACTGACGGG + Intronic
1015818756 6:137237702-137237724 GAATCCAGTCCTGAAATAACAGG + Intergenic
1021206839 7:17791078-17791100 AAAACAAGTCCTTAAATAAAAGG + Exonic
1030292441 7:107886223-107886245 AAAACCTATCCTTAACTTTCTGG - Intergenic
1033522869 7:142179974-142179996 AAAAAAAGTCCTTAACCAAATGG - Intronic
1036108594 8:5873210-5873232 AAAAAAAGTCCTTATCCAACAGG - Intergenic
1046575685 8:116026117-116026139 AAAACCAGTTCCTAACTCAGAGG + Intergenic
1048222486 8:132554574-132554596 AAAACCAGTCCTTAGTTCACAGG + Intergenic
1050173598 9:2847487-2847509 AACCCCATTCCTTAAATAACTGG - Intergenic
1050183492 9:2945842-2945864 AAAACCTGACCTGAACTGACAGG + Intergenic
1050854413 9:10333647-10333669 AATAGCAGACCTTAATTAACTGG - Intronic
1051153606 9:14114659-14114681 AAAACAATTCATTAACAAACAGG + Intronic
1057928037 9:99170341-99170363 AAAAGCAGCCATTAATTAACAGG + Intergenic
1058189877 9:101900363-101900385 AAAACCAGGCTGTATCTAACAGG - Intergenic
1059382100 9:113934688-113934710 AAGACCAATGCTTAACCAACAGG - Intronic
1186335783 X:8585905-8585927 AGAACCAGTCCTGATCTAAAAGG + Intronic
1186574732 X:10752709-10752731 AAAACCTGTCCTCACCTAATAGG - Intronic
1192064543 X:67867313-67867335 AAAACCAGTCCTAAACCAGATGG - Intergenic
1196901018 X:120383327-120383349 AAAAACAATATTTAACTAACAGG - Intergenic
1198686748 X:139235658-139235680 ACAACCAGTCCTGAACCATCAGG + Intergenic