ID: 945768089

View in Genome Browser
Species Human (GRCh38)
Location 2:214004709-214004731
Sequence CTGGGTCATCCTAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945768084_945768089 -1 Left 945768084 2:214004687-214004709 CCAGGCAGGATCTTAAATGGGGC 0: 1
1: 0
2: 2
3: 7
4: 63
Right 945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 215
945768080_945768089 1 Left 945768080 2:214004685-214004707 CCCCAGGCAGGATCTTAAATGGG 0: 1
1: 1
2: 0
3: 10
4: 116
Right 945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 215
945768078_945768089 11 Left 945768078 2:214004675-214004697 CCATGAGCTTCCCCAGGCAGGAT 0: 1
1: 1
2: 5
3: 32
4: 322
Right 945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 215
945768082_945768089 0 Left 945768082 2:214004686-214004708 CCCAGGCAGGATCTTAAATGGGG 0: 1
1: 1
2: 0
3: 4
4: 102
Right 945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945768089 Original CRISPR CTGGGTCATCCTAGGGATGC AGG Intronic
900542074 1:3208041-3208063 CTGGAACAGCCTAGGGAGGCCGG - Intronic
900617458 1:3571795-3571817 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617486 1:3571890-3571912 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617497 1:3571928-3571950 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617503 1:3571947-3571969 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617557 1:3572161-3572183 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617563 1:3572180-3572202 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617580 1:3572258-3572280 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617586 1:3572277-3572299 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617598 1:3572316-3572338 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617607 1:3572354-3572376 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617616 1:3572392-3572414 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617625 1:3572430-3572452 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617666 1:3572605-3572627 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617682 1:3572663-3572685 CTGGGTCCTCCCAGGTGTGCTGG + Intronic
900617808 1:3573166-3573188 CTGGGTCCTCCCTGGTATGCTGG + Intronic
900617827 1:3573243-3573265 CTGGGTCCTCCCAGGTGTGCTGG + Intronic
900627364 1:3614957-3614979 CTGTCTCATCCTGGGAATGCAGG - Intergenic
903536188 1:24067909-24067931 CTGGTTCGTGCTAGAGATGCTGG - Intronic
904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG + Intergenic
904456427 1:30650937-30650959 CTGGGTAATCCTAGGCTTGCAGG - Intergenic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
907999940 1:59669893-59669915 CTGAGTCAGCCCAGGGATGTAGG - Intronic
911264319 1:95725477-95725499 CTGGGACATCCTAGGGACCATGG - Intergenic
911417690 1:97596579-97596601 ATGGGTCATTCTAGAGAGGCAGG + Intronic
912363042 1:109110849-109110871 ATGGGGCATCCTGGGGAAGCAGG - Intronic
915267422 1:154728969-154728991 CTGGGTCCCCTTTGGGATGCTGG + Intronic
920050045 1:203158808-203158830 CTGGCTCATCCTATGGCTGAAGG + Intronic
920098004 1:203499096-203499118 CTGGGACATCCTGAAGATGCTGG - Intronic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
922757831 1:228106284-228106306 CTGGGGCAGCCTGGGAATGCAGG + Intergenic
1063049625 10:2432988-2433010 CTGGGTCTCCCTAGGGACTCAGG + Intergenic
1063179831 10:3588141-3588163 CTGGGTCACCCCAGGGTTGTGGG + Intergenic
1064194758 10:13235643-13235665 GTGTGTCTTCCTAGAGATGCAGG - Intergenic
1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG + Intronic
1064426316 10:15232813-15232835 ATGGGACATCCTAGGGAAGGGGG - Intronic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1069549088 10:69350041-69350063 AGGGGTCAGCCTAGGGCTGCAGG - Intronic
1070103279 10:73408837-73408859 AGGTGTCATCCCAGGGATGCTGG + Intronic
1074580639 10:114715986-114716008 CTAGGCCATCGTAGGGATCCAGG + Intergenic
1077273489 11:1692696-1692718 CTGTGGCTTCCTGGGGATGCAGG - Intergenic
1078948608 11:16101690-16101712 CAGTTTCATACTAGGGATGCAGG + Intronic
1079036648 11:17025968-17025990 CTGGGTCTTCCCAGGGACCCAGG - Intergenic
1080549292 11:33357330-33357352 CAGGGTCATCTTATGGTTGCAGG - Intergenic
1082724436 11:56718470-56718492 CTGGCTCACCCTAGGGCTCCAGG - Intergenic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1085007202 11:73103461-73103483 TTGGTTCACCCTAGGGATTCAGG - Intronic
1085240873 11:75054012-75054034 CAGGGTCATCCCAGGAATGTAGG + Intergenic
1087974762 11:104531207-104531229 CTGTGTCAGCCTACTGATGCTGG + Intergenic
1089461965 11:118658862-118658884 CTGGGACAGCCTGGGGGTGCAGG + Intronic
1090199906 11:124846475-124846497 CTGGGTCACCCCGGGGAGGCTGG - Intergenic
1091395716 12:153252-153274 CTGTGTCATCCTGGGGAAGGTGG - Intronic
1092605103 12:10110097-10110119 GTGTTTCATCCCAGGGATGCAGG + Intronic
1094158620 12:27365307-27365329 AAGTTTCATCCTAGGGATGCAGG - Intronic
1096644978 12:53027876-53027898 CTCGGTCATCATAGCGATCCCGG - Exonic
1098179252 12:67828602-67828624 CTGGGTAGGCCTAGGGAAGCAGG - Intergenic
1098472698 12:70864193-70864215 ATGGGTCATGCTAGGGATTAGGG - Intronic
1100669975 12:96801651-96801673 CTGGATCCTCCTAGGAATGCTGG - Intronic
1102502137 12:113359884-113359906 CTGGGGGATCCTAGGGAACCCGG + Intronic
1102618169 12:114172905-114172927 CTGGGCCATCCTACGGACACAGG + Intergenic
1106979758 13:35264559-35264581 GAGATTCATCCTAGGGATGCAGG + Intronic
1109208759 13:59510537-59510559 CTGGATCACCCAAGGTATGCTGG + Intergenic
1110350566 13:74502443-74502465 CTGGGTCATTCTAAAGCTGCTGG + Intergenic
1116712040 14:48380914-48380936 CTGGGTCCTCCTACACATGCAGG - Intergenic
1117304820 14:54463068-54463090 CTGTCTCTTCCTAGGGATGGTGG - Intergenic
1118333846 14:64835133-64835155 CTGAGTCAGGCTAGGCATGCCGG - Intronic
1121336787 14:93082549-93082571 CTGGCTCATGCCAGGGATGGGGG + Intronic
1123706780 15:22956528-22956550 CTGTGTTCTCCCAGGGATGCTGG - Intronic
1124479020 15:30061517-30061539 GGGGGTCAACCTAAGGATGCAGG + Intergenic
1125227545 15:37411954-37411976 CTGCTTCATCCCAGGGACGCAGG + Intergenic
1128356631 15:66932154-66932176 CGAGGTCATCCTAGGGAAGGAGG + Intergenic
1130635727 15:85618047-85618069 CTGGTTCATCCGAGGAATGAAGG - Intronic
1132835804 16:1952834-1952856 CTGGGCCGTCCAAGGGCTGCTGG - Intronic
1132975472 16:2709187-2709209 CTGGGCCATCCACGGGGTGCCGG + Intergenic
1133100437 16:3476024-3476046 CTGGGTCTTCCCAGCGATGGGGG + Intronic
1133223379 16:4328633-4328655 CTGGGTCCTGCCAGGGAGGCAGG - Intronic
1137056190 16:35747719-35747741 CTGGGTCATAGTAGGGGTGCAGG - Intergenic
1137763274 16:50957822-50957844 CTGGCTCATCCCAGGGATCATGG + Intergenic
1140165597 16:72547341-72547363 CGGCTTCATCCTTGGGATGCAGG + Intergenic
1142516751 17:435967-435989 GTGGTTCATCCCAGGAATGCAGG - Intergenic
1142962061 17:3557345-3557367 CTGGGTCAGCCTCGGGAGGCAGG + Intronic
1143374337 17:6458438-6458460 GTGGGTCATCCCAGTGATGGTGG - Intronic
1143520980 17:7444246-7444268 CTGGCTCATAGTAGGGAAGCTGG + Exonic
1145296778 17:21598924-21598946 CTGGGTCAGCCTGGGTCTGCAGG + Intergenic
1145800072 17:27677038-27677060 CTGGGGCAGCCTAGGGGTGGAGG + Intergenic
1148155873 17:45425129-45425151 CTGGGACAGCCTGGGGCTGCAGG + Intronic
1150790642 17:68198361-68198383 CTGGGTCAGGGTTGGGATGCGGG - Intergenic
1151724237 17:75875345-75875367 CTGGGCCCTCCCAGGGCTGCTGG - Intronic
1151853601 17:76706547-76706569 CTGGGTCATTCTGGGAAGGCTGG + Intronic
1152763310 17:82121258-82121280 CTGTCTCAGCCTAGGGAGGCAGG + Intronic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1155310809 18:24521176-24521198 CTGGGCCTCCCTGGGGATGCAGG - Intergenic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1160932275 19:1576439-1576461 CTGGCTCAGCCTAGGGATCGTGG - Intronic
1161039266 19:2101382-2101404 CTGGGCCTTCCTAAGGGTGCTGG + Exonic
1162561209 19:11419069-11419091 CTGGTTCCTCTTAGGGATGGGGG - Intronic
1163237791 19:16039412-16039434 CAGGGTGGTCCTGGGGATGCAGG + Intergenic
1163484080 19:17576289-17576311 CTGGCTCAGCCTAGGGAGGTGGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167449854 19:49560683-49560705 CCGCGTCATCCTAGGGAGGAAGG + Exonic
1167669063 19:50839179-50839201 CTGGGGCATCTTAGGGAGGTGGG + Intergenic
1168580819 19:57554347-57554369 CTGGCTCCTCATAGGGATGCTGG - Intronic
927013102 2:18927114-18927136 CTGTGGCATCCTAGGGAACCTGG + Intergenic
927487805 2:23501097-23501119 CTGGGTCATCTCAGGGATCTGGG + Intronic
933901810 2:86855607-86855629 CTGGGTCATCATAGTGCTGAGGG + Intronic
935576644 2:104717901-104717923 CTGGGGCAGCTAAGGGATGCTGG - Intergenic
935778738 2:106493655-106493677 CTGGGTCATCATAGTGCTGAGGG - Intergenic
937129436 2:119496600-119496622 CTGGGTCATTCTTGGGCTCCAGG - Intronic
938237362 2:129717216-129717238 CTGGGCCTTCCTTGGGATCCTGG - Intergenic
940637116 2:156310947-156310969 CTGTGGCATCCAAGGGAAGCAGG + Intergenic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943447060 2:187999847-187999869 CGGTGTCATCCCAGGGATGTGGG + Intergenic
945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG + Intronic
1169489816 20:6061801-6061823 TCGGGTCTTCCTAGGGATCCAGG - Intergenic
1169683070 20:8238820-8238842 ATGGGTAATCTTAGGGATGGTGG + Intronic
1169912735 20:10660550-10660572 CAGGGCAATCCTAGGGGTGCAGG + Intronic
1170972781 20:21131728-21131750 CTGGGTCATCATAGGCACTCAGG + Intronic
1171392517 20:24810882-24810904 CTTGGTCATCCTATGGGAGCTGG + Intergenic
1172033471 20:31996740-31996762 CTGGGTCATCCAAGGGGAGACGG + Exonic
1173903729 20:46610590-46610612 CAGGCTCATCCTGGGGATGATGG - Exonic
1175596822 20:60241277-60241299 CTGGGACAACGTAGAGATGCTGG - Intergenic
1175844758 20:62052556-62052578 CGGGGACATTCTAGTGATGCAGG - Intronic
1178264968 21:31134283-31134305 ATGGGTCATTCATGGGATGCAGG - Intronic
1180201495 21:46227491-46227513 CTGGATCACCCTTGGGATCCTGG - Intronic
1180737323 22:18027072-18027094 CTGGGTTAAGCCAGGGATGCCGG + Intergenic
1180825433 22:18857919-18857941 CAGGGCCCTCCCAGGGATGCTGG + Intronic
1181106681 22:20579766-20579788 CAAGGTCATCCTAGTGATGAAGG - Intronic
1181187298 22:21116628-21116650 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181211900 22:21293865-21293887 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181397598 22:22633021-22633043 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181500346 22:23312391-23312413 CAGGGCCCTCCCAGGGATGCTGG - Intronic
1181651808 22:24263037-24263059 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181682310 22:24503918-24503940 CTGGGTTTTCCTTGGGATACCGG + Intronic
1181705568 22:24647702-24647724 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181733388 22:24863660-24863682 CTTGGTCCCCCAAGGGATGCTGG - Intronic
1182079393 22:27518466-27518488 CTGGTTCATCCAGGGGATGTTGG - Intergenic
1182207743 22:28645665-28645687 GGGTTTCATCCTAGGGATGCTGG + Intronic
1182817440 22:33178168-33178190 CCTGGTGATCCTAGTGATGCAGG - Intronic
1183102213 22:35591048-35591070 CTGAGTCATCGTAGGAAGGCTGG - Intergenic
1183928661 22:41223834-41223856 CTGTGTCCTCCTAGGGAGTCAGG + Intronic
1183955862 22:41380581-41380603 CTGGGCCACTGTAGGGATGCTGG + Intronic
1184530832 22:45054414-45054436 CTGGGTCATCCTAGGAGTGCTGG + Intergenic
1203275580 22_KI270734v1_random:83822-83844 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
950207742 3:11093419-11093441 CTGGCTCACCCTTGAGATGCAGG + Intergenic
950708547 3:14798837-14798859 CTGGATCATCCTGGGGCTTCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952027040 3:29095716-29095738 GGGGTTCATCCCAGGGATGCAGG - Intergenic
952096715 3:29962586-29962608 AAGGATCATGCTAGGGATGCAGG - Intronic
952430061 3:33214505-33214527 GGGGGTCATCCTAGGGCTGAGGG - Intronic
953650655 3:44800029-44800051 CTGGGTCACCCTTAGGATCCGGG - Intronic
954707589 3:52489342-52489364 CTGGGACCTCCTGGGGACGCTGG - Exonic
955484208 3:59419281-59419303 CTGGGTCACCCCAGGGTTGGGGG + Intergenic
955873233 3:63461993-63462015 ATGGGTCTTCCTAAGGATTCTGG - Intronic
960912264 3:122661369-122661391 CTGGGTCATCATAGCAATCCTGG - Intergenic
961393268 3:126569226-126569248 CTGGGCCGTCCTTGGTATGCTGG + Intergenic
961906140 3:130264603-130264625 CTGGCTTTTCCCAGGGATGCTGG - Intergenic
962042880 3:131725484-131725506 CTGGGTCTTCCTGGGGAAGCTGG - Intronic
962922778 3:139965799-139965821 CTGGGCCATCCTGGGGCTTCAGG - Intronic
967741267 3:193005061-193005083 GTGTTTCATACTAGGGATGCAGG - Intergenic
968545496 4:1195681-1195703 CAGGGGCATCCCAGGGCTGCTGG - Intronic
968943563 4:3651966-3651988 CTGGGGAATCCTGGGGATTCAGG + Intergenic
969289776 4:6231111-6231133 CTGTGACGTCCTAGGGACGCGGG - Intergenic
969515406 4:7645222-7645244 CTGGGTCATCCGAGTGACTCAGG - Intronic
969588805 4:8109635-8109657 CTGGGTCATGCTGGGGCCGCAGG + Intronic
971753493 4:30679632-30679654 CTGGGGGCTCCTAGGGATGATGG + Intergenic
972454260 4:39237781-39237803 CTCAGTCATCCTCAGGATGCAGG - Intronic
977119528 4:93080894-93080916 CTGTGTCATCCTATGGAGGAAGG + Intronic
977754858 4:100656670-100656692 CTGGGCCATTGTAGGGATTCTGG + Intronic
983175392 4:164582308-164582330 GGGTTTCATCCTAGGGATGCAGG - Intergenic
984440873 4:179768400-179768422 CTGGCTCTTCCTTGGGGTGCCGG + Intergenic
984822427 4:183893471-183893493 CTGGGTGATGCAAGTGATGCTGG + Intronic
986183981 5:5419430-5419452 CTGGGGCATCCTAGGGTGGAAGG - Intergenic
988148295 5:27340243-27340265 TGGGTTCATCCTAGAGATGCAGG + Intergenic
990281558 5:54256753-54256775 GGGGTTCATCCCAGGGATGCAGG + Intronic
992091829 5:73324440-73324462 AGGGGGCATCCTAGGAATGCAGG - Intergenic
994121049 5:96113268-96113290 CTAGGTAATCCTTGGCATGCAGG + Intergenic
1004188768 6:13446314-13446336 CTGGGGCAGCCTGGGCATGCTGG - Intronic
1006466072 6:34195763-34195785 CTGGGGCATCCTGGGGAATCTGG + Intergenic
1006855642 6:37131306-37131328 CTGCGTAATCCTCGGGATTCCGG - Intergenic
1008572883 6:52832014-52832036 CTGGGTCATCTTAATGATGGTGG - Intronic
1010015244 6:71097857-71097879 GAGTTTCATCCTAGGGATGCAGG - Intergenic
1010836734 6:80597643-80597665 CTGTTTCATCCCTGGGATGCAGG - Intergenic
1014591935 6:123284326-123284348 GTGTTTCATACTAGGGATGCAGG + Intronic
1019316210 7:388131-388153 CATGTTCATCCTAGGTATGCGGG + Intergenic
1019989789 7:4683045-4683067 CGGGGTGATCCTAGGGAGCCAGG - Intronic
1021911530 7:25390079-25390101 CTCTGTCATCCCAGAGATGCTGG + Intergenic
1022112169 7:27238670-27238692 CTGGCCCATCCTAGGGCTGGAGG - Intergenic
1023060672 7:36322922-36322944 CTGGGTCATCATAGGCCTGTGGG - Intergenic
1026477494 7:70749397-70749419 CTGGATGATGCTAGGGTTGCTGG + Intronic
1027535404 7:79393835-79393857 CTGGGTCATTTTAGGGAAGCGGG - Intronic
1028446942 7:90935076-90935098 CTGTGTCATCCAAGGGCAGCAGG + Intronic
1029958840 7:104668498-104668520 CTCGGTCATCATAGCGATCCCGG - Intronic
1031081229 7:117258938-117258960 CTGGATCAGCCTGGGGTTGCGGG - Intergenic
1036170089 8:6475475-6475497 CTGGGTTTTCCCCGGGATGCTGG - Intronic
1036206212 8:6807296-6807318 CTGGGTGAGTCTAGGGAAGCCGG - Intergenic
1037448787 8:18995944-18995966 CTAGGTGATGCTACGGATGCTGG - Intronic
1038340180 8:26679587-26679609 CTGGCTCATCCATGGGGTGCAGG + Intergenic
1041245244 8:55882658-55882680 CTGGCTCTTCCTAGTGATGATGG + Intronic
1041352796 8:56965724-56965746 CTTGCTCATCCCAGGTATGCAGG + Intronic
1044296772 8:90536895-90536917 CTGAGTCATCCTAGAAATGCAGG - Intergenic
1045683223 8:104684777-104684799 CTGTGTCATCCTATGGCTGAAGG + Intronic
1045684639 8:104699960-104699982 CTGGGTCATCCGAGGCATCTTGG + Intronic
1047603340 8:126449658-126449680 CTGAGTCATCTTAGGGTTGAGGG + Intergenic
1048027352 8:130598905-130598927 CTGGGTGCTCCTAGAGCTGCAGG + Intergenic
1049272359 8:141702711-141702733 CTAGATCTTCTTAGGGATGCTGG - Intergenic
1051053758 9:12959189-12959211 CTGGGACATTATAGGCATGCAGG - Intergenic
1055410723 9:76026668-76026690 TTGGGTCATTCTAGGTATGAGGG + Intronic
1055646924 9:78369873-78369895 CTGGGAACTCCTAGAGATGCCGG + Intergenic
1057199117 9:93131050-93131072 GTGGGTCAGACAAGGGATGCCGG - Intronic
1057563410 9:96146768-96146790 CTCGGTCATCATAGCGATCCCGG - Intergenic
1062009193 9:134258194-134258216 CTGGGTCATCCCTTGGAGGCAGG + Intergenic
1062098923 9:134717892-134717914 CTGGCTCAACCCAGGGATGGGGG + Intronic
1062657001 9:137608951-137608973 TTGGGTCATCCTAAGGGTCCAGG - Intronic
1185518074 X:715657-715679 CTGGGTCCTCCCAGGGAGGAGGG - Intergenic
1185620834 X:1451523-1451545 CTGGGACCCCCTAGGGATGGGGG - Intronic
1185621205 X:1452483-1452505 CTGGGTCCCCATAGGGATGGGGG - Intronic
1187241227 X:17515026-17515048 TTAGGTCATCCTAGAGATGAGGG + Intronic
1190571616 X:51788381-51788403 TTGTGTCATCCTAAGTATGCAGG + Intergenic
1191904630 X:66075583-66075605 CTTGGTCATCATAGCGATCCCGG + Intergenic
1192885337 X:75331140-75331162 GGGTTTCATCCTAGGGATGCAGG - Intergenic
1193015679 X:76730927-76730949 GTGTGTCATACCAGGGATGCAGG + Intergenic
1196079993 X:111620727-111620749 CTTGGTCATCATAGCGATCCCGG + Intergenic
1198025224 X:132699059-132699081 CTGGGTCATTCTGGGGCTGAGGG - Intronic
1198275796 X:135096261-135096283 CTGTGTGATCCTGGGGATGGCGG + Intergenic
1198310719 X:135424472-135424494 CTGTGTGATCCTGGGGATGGGGG - Intergenic
1198536801 X:137594607-137594629 GTGGGTCCTCATAGGGGTGCAGG + Intergenic
1198719822 X:139604400-139604422 CTGGGTAATCCTAGTAATCCAGG - Intronic
1202132452 Y:21625714-21625736 CTGGTTCATGATAGGGATTCAGG + Intergenic