ID: 945769261

View in Genome Browser
Species Human (GRCh38)
Location 2:214019983-214020005
Sequence CTGTCTCAAGAGCTGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945769261 Original CRISPR CTGTCTCAAGAGCTGATTGA TGG Intronic
901334452 1:8437195-8437217 CTGTATCAGGAGCTGACGGAAGG - Intronic
908014605 1:59817714-59817736 CTGACCCAAGACCTGAATGACGG - Intronic
909651496 1:77980792-77980814 CTGCCTTAAAAGCTGATTAAAGG - Intronic
912703890 1:111897791-111897813 CTGTCTTAAGAGCTGATTGTGGG - Intronic
912810621 1:112791440-112791462 CTGGCTCCAAAGCTGATGGATGG + Intergenic
916197126 1:162234898-162234920 CTGCCTCAACAGCCGATTGCAGG - Intronic
1062913357 10:1228888-1228910 CAGTCTGAAGAGATGATTTAAGG + Intronic
1064974062 10:21095155-21095177 CAGTCTAGAGAGCTGATTCATGG - Intronic
1065144201 10:22751461-22751483 CTGTCTGAAGAGCTTATAAAAGG + Intergenic
1067186210 10:44030122-44030144 CTGTCTAAAGGACTGCTTGAAGG - Intergenic
1068147449 10:53089192-53089214 CTGTCACAGGAGCTGTTTGCTGG + Intergenic
1068918593 10:62460092-62460114 CCCTCTCAAGAGCTGTTTGGAGG - Intronic
1075480925 10:122781040-122781062 CTGTCTCAAGGGGCTATTGAGGG - Intergenic
1078129453 11:8601387-8601409 CTGTGAGAAGAGCTGAGTGAGGG + Intergenic
1079903850 11:26221499-26221521 CTGTAGAAAGAGCAGATTGATGG + Intergenic
1084325705 11:68398738-68398760 CTGTCTCAAGAAATTATTTATGG - Intronic
1085350397 11:75794592-75794614 CTGACTCAAACCCTGATTGATGG - Intronic
1087064128 11:94011523-94011545 CTGTCTCAAGAATTTATTAAAGG - Intergenic
1091371074 11:135058349-135058371 CTGTCTCAACTCCTGACTGAAGG + Intergenic
1094025536 12:25957559-25957581 CTGACTCAGGACCTGATTTAAGG - Intergenic
1094659079 12:32448853-32448875 CTGTCTCAGGAGCTGTCTCATGG - Intronic
1096554313 12:52394068-52394090 CTGGCTCAGGAGCTCATAGATGG - Exonic
1098485400 12:71015556-71015578 TTGTCTCCTGTGCTGATTGAGGG + Intergenic
1101573194 12:105974078-105974100 CTATCTGAAGAGCTTCTTGAAGG - Intergenic
1102852815 12:116266255-116266277 TTGTCTCCAGGGCTGAGTGAAGG + Intronic
1103318002 12:120072674-120072696 CAGTCTCTTGAGCTCATTGAGGG - Exonic
1103639101 12:122334302-122334324 CTGTCTGAAGTACTGATTCAGGG - Intronic
1103890901 12:124238441-124238463 CAGACTCAAGAGCGGATGGAAGG - Intronic
1105869664 13:24493361-24493383 CAGCCTCAAGAGCTGATCGAAGG - Intronic
1108837977 13:54574995-54575017 CAGTCTCAGTAGCTGATTCATGG + Intergenic
1115066441 14:29267260-29267282 CTGACACAGGAGCTGACTGAAGG + Intergenic
1115721948 14:36171825-36171847 CTATGTCAAGAGCTTATTGAGGG - Intergenic
1116761359 14:49019163-49019185 CAGTTTCAAGAGCTGATCTAGGG + Intergenic
1117311236 14:54525305-54525327 CTGCCTGAAAAGCAGATTGATGG - Intronic
1117641767 14:57807635-57807657 CTGTCTTATGTGATGATTGATGG - Intronic
1121222657 14:92298469-92298491 CTGTTTCAAGACCTGATTATGGG + Intergenic
1124828753 15:33127078-33127100 CTGTATCAGGAGCTGGTTGGGGG + Intronic
1129409366 15:75340368-75340390 TTTTCTCAATTGCTGATTGAGGG + Intronic
1129999039 15:80031554-80031576 GTGTTTCAAGAGCTTGTTGAAGG + Intergenic
1130060601 15:80567177-80567199 CTGTCTCAAGAGCTCCTGAAAGG - Intronic
1130180521 15:81622638-81622660 CTGTGTCCAGAGCTGACAGATGG - Intergenic
1135955278 16:26951771-26951793 CTGTCTCAGGAGCTGTTTTGGGG - Intergenic
1136037477 16:27550838-27550860 CTGTCTCTGGAGCTGAATTATGG + Intronic
1139669564 16:68483469-68483491 CTCTCTCCAGAGAGGATTGATGG + Intergenic
1142384204 16:89752291-89752313 CTGCCTCCGGAGCTGAGTGATGG + Intronic
1143642168 17:8205337-8205359 CTGCCCCCAGAGATGATTGAGGG - Exonic
1143729538 17:8873179-8873201 CTGGCTCCAGAGCAGACTGAAGG - Intergenic
1147552628 17:41455166-41455188 CTGGCTCCAGAGCGGACTGAAGG - Intergenic
1150505106 17:65690914-65690936 TTGTCTGAAGAGCAGACTGAGGG + Intronic
1153334751 18:3911672-3911694 TTTTCTAATGAGCTGATTGATGG + Intronic
1153399299 18:4666249-4666271 CTCTCTCAAGATCTGCTAGAAGG - Intergenic
1155555161 18:27010872-27010894 CTGTCTCAAGGGCAGATGGGTGG + Intronic
1156109632 18:33709952-33709974 CTGACTTAAAAGCTGACTGATGG + Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1161519347 19:4714888-4714910 CTGTTTGAGGAGCTGAGTGAAGG - Intronic
1162359067 19:10206718-10206740 CTGACTCAAGGGCTCTTTGAAGG - Intronic
1163326973 19:16610879-16610901 CTGTCACAAGAACTGGATGAGGG + Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
925560993 2:5195296-5195318 CTGTCACAATAGCTGAGTGTTGG - Intergenic
925574051 2:5341762-5341784 CTGTCACCAGAGCTGAGAGAGGG - Intergenic
926693193 2:15751531-15751553 CTGCCACAAGAGCTGACTGAGGG + Intergenic
926770659 2:16371555-16371577 CTGTTGCAGGATCTGATTGAAGG + Intergenic
927308525 2:21601549-21601571 TTGTCTCAAGACCTCATTCAGGG + Intergenic
927824836 2:26301122-26301144 CTGTCTCAAGAACTGAGAAATGG + Intergenic
929025836 2:37600770-37600792 CTGTGTCAAGACCTACTTGAGGG + Intergenic
930045744 2:47170733-47170755 CTGACTGAAGAGCAGATTGCAGG - Exonic
932488482 2:72103377-72103399 CTGTCTCAAGATGTGACTGGAGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933286532 2:80390337-80390359 CTGTATCAGGAGCTCTTTGATGG + Intronic
935109711 2:100081362-100081384 CTGTCTCCAGATCTGAGTGAAGG - Intronic
936125263 2:109783847-109783869 CTGTCTCCAGATCTGAGTGAAGG + Intergenic
936219430 2:110587621-110587643 CTGTCTCCAGATCTGAGTGAAGG - Intergenic
936891357 2:117373625-117373647 CTGTCTCTCGGGCTGAGTGAAGG - Intergenic
937352443 2:121174866-121174888 CTGTCTCACGTGCTGAAGGAAGG - Intergenic
937486743 2:122323266-122323288 TTATCTCAAGAGCTGCTTCAGGG + Intergenic
942501400 2:176594445-176594467 CTTTCTACAGAGCTGATTGAAGG + Intergenic
942987407 2:182160023-182160045 CTGTCTCAAGAGCTGTTAGGAGG - Intronic
945769261 2:214019983-214020005 CTGTCTCAAGAGCTGATTGATGG + Intronic
946860023 2:223991961-223991983 CTGTCCCCAGATCTTATTGATGG - Exonic
947972878 2:234338630-234338652 CTGTCTCAAGAGTCGCATGAGGG + Intergenic
1169965009 20:11207590-11207612 CTTTGTCAAGAGCTGATTTAAGG + Intergenic
1173382247 20:42556335-42556357 CTGTCTCACAAGCTAATTGCAGG - Intronic
1174982821 20:55416597-55416619 TTGTCAAAAGAACTGATTGATGG + Intergenic
1175289821 20:57868227-57868249 CTTTCTCAAGGGCTGTTTGGTGG + Intergenic
1181760013 22:25051782-25051804 GTGTCTCATGAGGTGTTTGAAGG + Intronic
1182947621 22:34339458-34339480 CTGCCTCAGGAGCTGATACAAGG + Intergenic
1183402713 22:37614022-37614044 CAGCCTCAAGACCTGATTGTGGG - Intronic
952578882 3:34807278-34807300 CTGTAACAATAGCTGAGTGATGG + Intergenic
953550200 3:43896142-43896164 CTGTCTCTAGAGCTGTTTTAGGG - Intergenic
954921739 3:54197222-54197244 CTGCTTGAAGAGCTGATGGAAGG - Intronic
956055762 3:65297046-65297068 CTGTTTGAAGAGCTGATTTCTGG + Intergenic
956722263 3:72128523-72128545 CTGTCCCAAGATCTGCTTTAGGG + Intergenic
957630704 3:82712672-82712694 CTGTAACAATAGCTGATTGTTGG + Intergenic
964663149 3:159143089-159143111 CTTTCTTAAGAGCTGATGTACGG - Intronic
970609327 4:17710696-17710718 CTGTGTGAAGAACTGAATGAAGG + Intronic
971074321 4:23130145-23130167 CTGTCTTAAGAGCTTAGTGTGGG + Intergenic
975493011 4:75009296-75009318 CTGACTCAGGAGCTGATGGAAGG - Intronic
976559311 4:86482941-86482963 CTTTCCAAAGAGCTGATTGTAGG + Intronic
977096695 4:92754591-92754613 CTGTGTCAGGCGCTGATTTAAGG - Intronic
980904694 4:138936954-138936976 CTGTCTCAAGAACTAATAGAGGG + Intergenic
986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG + Intergenic
986845465 5:11747173-11747195 ATATTTCAACAGCTGATTGATGG + Intronic
987182553 5:15383589-15383611 CTGTCTCCAGGCCTCATTGATGG + Intergenic
989078003 5:37585645-37585667 CTGGATCAAGAGCAGAATGATGG - Intronic
992443438 5:76814323-76814345 ATGAGTCAAGAGCTGCTTGATGG + Intergenic
993698439 5:91090486-91090508 CTTTGTCAAGAGCTGACTTAGGG - Intronic
994800591 5:104369234-104369256 TTATCTCTAGTGCTGATTGATGG + Intergenic
996128005 5:119748443-119748465 CTCTCTCTAGGGCTGCTTGATGG + Intergenic
996859981 5:128054461-128054483 CTTTCTCAAGAACTCATTCATGG + Intergenic
999501018 5:152146800-152146822 CTGTCTCAAGAACAGCATGAGGG - Intergenic
1001063027 5:168510543-168510565 CTGTTTCAAAATCTGATTGGGGG + Intronic
1002431211 5:179205154-179205176 CTGTCACAACAGCTGGTTGGAGG - Intronic
1002805714 6:572276-572298 CTGTCTCAAAAGGTGGTTGTAGG - Intronic
1004030655 6:11865817-11865839 GTGACTCAAGAGCTGATTTTGGG - Intergenic
1008537291 6:52516432-52516454 CTGTCCCATGTGCTGATTAAAGG + Intronic
1010125955 6:72432018-72432040 GTGTCAGAAGAGCTGAGTGAGGG + Intergenic
1012191570 6:96286828-96286850 CAGTCTCCAGTGCAGATTGAGGG + Intergenic
1012591738 6:100990136-100990158 TTTTCTGAAGAGCAGATTGAAGG + Intergenic
1013662153 6:112308754-112308776 CAGTGTCAAGAGCTGCTTCATGG + Intergenic
1015245168 6:131066503-131066525 CTGTATAAAGAGTTGCTTGAGGG - Intergenic
1019765314 7:2845253-2845275 CTCTATCAAGAGCTGATTTTGGG - Intergenic
1020906586 7:14070979-14071001 TTTTCTCAAGTGCTGACTGAAGG + Intergenic
1021767442 7:23963953-23963975 GTGTCTCAAGAGGTCACTGAGGG + Intergenic
1021972251 7:25976901-25976923 CTGTCTCATGAGTGCATTGAAGG + Intergenic
1023130447 7:36997706-36997728 CTGCCTCAGGTGCTGGTTGAAGG + Intronic
1023571907 7:41581293-41581315 CTTTATCATGAGCTGAATGATGG - Intergenic
1025790394 7:64682480-64682502 CTGTCTCAAGAGCTTTTTTCAGG - Intronic
1026004756 7:66591996-66592018 CTGTCTCAGGCGCTGGTTGCCGG - Intergenic
1030320174 7:108158487-108158509 CTGTCTCTAGAGCTCATTTTTGG - Intronic
1031101657 7:117487848-117487870 CTGTATTAAGAGGTGATTCAAGG + Intronic
1033884620 7:145930172-145930194 GTTTCTCAACAGCTTATTGAAGG - Intergenic
1035874504 8:3172985-3173007 CTGTCCCAAGAAGTGATTGTAGG + Intronic
1039093695 8:33859808-33859830 TTTTCTCACGTGCTGATTGAAGG + Intergenic
1040974394 8:53174163-53174185 CTTTCTCAACAGCTCATTGGTGG - Intergenic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1045805929 8:106161721-106161743 ATGTCTCAAAAGCAGATAGAGGG + Intergenic
1047309658 8:123681460-123681482 CTATCTCAAGGGCTGTTTTAAGG - Intronic
1047409303 8:124611183-124611205 TTGTCTCAAAAGATAATTGATGG - Intronic
1048067955 8:130990685-130990707 TTGCCTCAAGATCTGAATGAAGG - Intronic
1051099332 9:13502968-13502990 CTGTCTCAGAAGCTGATTCCTGG + Intergenic
1051815314 9:21097748-21097770 CTATCTCATGAGCACATTGATGG + Intergenic
1055884668 9:81047039-81047061 CTGTCTCAAGAAATTATTAATGG - Intergenic
1057006450 9:91564982-91565004 CTGTGTCAATGGCTCATTGATGG - Intronic
1057821145 9:98332035-98332057 CTGTCAAATGAGCTGATGGATGG - Intronic
1058581866 9:106467280-106467302 TTGGCTCATGAGCTTATTGAAGG - Intergenic
1058758927 9:108110563-108110585 CTGTCTCACGAGCTGCAAGATGG + Intergenic
1058763266 9:108157458-108157480 TTGTCAGAAGAGCTGAATGATGG - Intergenic
1059330498 9:113532514-113532536 CTGTCTCAACAGCAGAGTGTAGG - Intronic
1059833799 9:118128178-118128200 CAGTCTCCAGTGCTGATGGAGGG + Intergenic
1062141752 9:134962970-134962992 CTGCCTCATGGGCTGACTGAGGG + Intergenic
1185961674 X:4551617-4551639 CTGTCTCAGGATCCCATTGAGGG - Intergenic
1188920520 X:35971125-35971147 CTGTCTCAAGATCTGCTTCTGGG - Intronic
1189662621 X:43318139-43318161 TTGTCTCAAGATCTGCTTAAAGG + Intergenic
1198895271 X:141447407-141447429 CTGTATCAATAGCTGAGTGTTGG + Intergenic
1199343456 X:146709495-146709517 CTGTCACAAGGGCTGTTTGCTGG + Intergenic