ID: 945770414

View in Genome Browser
Species Human (GRCh38)
Location 2:214035338-214035360
Sequence GGGACCTGCCCCTTATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 179}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945770398_945770414 27 Left 945770398 2:214035288-214035310 CCGGCCCCCAGGCTTCAGGCCCT 0: 13
1: 89
2: 170
3: 256
4: 816
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770408_945770414 4 Left 945770408 2:214035311-214035333 CCCCAGCTCACAGGTGGGACTTC 0: 1
1: 0
2: 2
3: 24
4: 229
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770399_945770414 23 Left 945770399 2:214035292-214035314 CCCCCAGGCTTCAGGCCCTCCCC 0: 7
1: 35
2: 158
3: 353
4: 832
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770410_945770414 2 Left 945770410 2:214035313-214035335 CCAGCTCACAGGTGGGACTTCAC 0: 1
1: 0
2: 2
3: 15
4: 150
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770406_945770414 8 Left 945770406 2:214035307-214035329 CCCTCCCCAGCTCACAGGTGGGA 0: 1
1: 1
2: 2
3: 55
4: 423
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770409_945770414 3 Left 945770409 2:214035312-214035334 CCCAGCTCACAGGTGGGACTTCA 0: 1
1: 0
2: 2
3: 23
4: 219
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770401_945770414 21 Left 945770401 2:214035294-214035316 CCCAGGCTTCAGGCCCTCCCCAG 0: 11
1: 22
2: 80
3: 292
4: 861
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770402_945770414 20 Left 945770402 2:214035295-214035317 CCAGGCTTCAGGCCCTCCCCAGC 0: 12
1: 27
2: 73
3: 282
4: 1002
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770397_945770414 28 Left 945770397 2:214035287-214035309 CCCGGCCCCCAGGCTTCAGGCCC 0: 5
1: 88
2: 257
3: 373
4: 962
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770400_945770414 22 Left 945770400 2:214035293-214035315 CCCCAGGCTTCAGGCCCTCCCCA 0: 11
1: 27
2: 69
3: 288
4: 854
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179
945770407_945770414 7 Left 945770407 2:214035308-214035330 CCTCCCCAGCTCACAGGTGGGAC 0: 1
1: 0
2: 2
3: 32
4: 276
Right 945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG 0: 1
1: 1
2: 3
3: 24
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945770414 Original CRISPR GGGACCTGCCCCTTATGCCC AGG Intronic
900196214 1:1376901-1376923 GGGACCTTTCCCTTTTGGCCTGG - Intergenic
900549158 1:3245396-3245418 GGGACCTGACCCTTCTCTCCAGG + Intronic
901658174 1:10782535-10782557 GGGACCTGCCGCTCAGTCCCAGG - Intronic
903071110 1:20727346-20727368 GGGCCCCATCCCTTATGCCCTGG - Intronic
905215204 1:36401732-36401754 GGCATCTGCCCCTTCTGCCTAGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906140147 1:43529576-43529598 GGGACCTACCCCCACTGCCCTGG - Intronic
908685292 1:66711659-66711681 GGCAAATGACCCTTATGCCCAGG - Intronic
912488401 1:110047225-110047247 GGAACCTGCCTCTGATGCCTGGG + Intronic
913967163 1:143385847-143385869 GGGAGCTGACCCTGATGCACGGG - Intergenic
914061540 1:144211454-144211476 GGGAGCTGACCCTGATGCACGGG - Intergenic
914117610 1:144754915-144754937 GGGAGCTGACCCTGATGCACGGG + Intergenic
918072248 1:181141611-181141633 GGGAGCAGCCCCTTCTCCCCTGG + Intergenic
920627187 1:207613556-207613578 GGGATCTGCCCCATCTGCCTAGG + Intronic
920868129 1:209769983-209770005 TAGACTTGCCCCTTTTGCCCAGG - Intronic
922041702 1:221903886-221903908 GGACCCTCCCCCTTCTGCCCAGG + Intergenic
923088513 1:230720495-230720517 GGGACCCGCCCCATCTGCCTAGG - Intergenic
923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG + Intronic
923391341 1:233516106-233516128 GAGACCAGCCCATTCTGCCCAGG - Intergenic
923466189 1:234249417-234249439 GGAACCTCCCCCTTATCCCATGG + Intronic
923506340 1:234609417-234609439 GTGACCTGCCCCGCATGCCCTGG - Exonic
923958243 1:239046927-239046949 GGGGCCTGCTCCATATACCCAGG - Intergenic
924817333 1:247454249-247454271 CAGCCCTGCCCCTCATGCCCTGG + Intergenic
1063576117 10:7263383-7263405 GGCACGTGCCACTAATGCCCAGG + Intronic
1069156603 10:65037623-65037645 GGGACCTGCCCTATCTGCCTAGG - Intergenic
1070254714 10:74804210-74804232 AGGACCTGGCCCTGTTGCCCAGG - Intergenic
1076978498 11:192995-193017 CGGACCTGCCCATTAGGACCCGG - Intronic
1080851997 11:36078269-36078291 GGGACCTACCCCTTCTGCCTAGG + Intronic
1081284021 11:41246080-41246102 GGGACCTGTCCCTTACCCCCTGG + Intronic
1083466472 11:62850066-62850088 GGGACATGCCTACTATGCCCAGG - Intergenic
1084149362 11:67281007-67281029 GGGGCCAGCCCCTGCTGCCCAGG + Intronic
1085054778 11:73397248-73397270 GTCACCTGGGCCTTATGCCCAGG + Exonic
1085507787 11:77069988-77070010 GGGACCTGGCCCCTTTGCCTTGG - Intronic
1086343871 11:85875358-85875380 GGGACCGGCCCCATCTGCCTAGG + Intronic
1089591868 11:119546856-119546878 GGAACCACCCCCTTCTGCCCAGG - Intergenic
1095040222 12:37432942-37432964 GGCATCTGCCCCTTCTGACCTGG - Intergenic
1095952594 12:47789971-47789993 GGGACCACCCCCTTGGGCCCTGG - Intronic
1099574533 12:84362701-84362723 GGGACCGGCCCCTTCTGCCCAGG - Intergenic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1109056760 13:57560245-57560267 GGGATCTGCCCATTATATCCTGG - Intergenic
1115729247 14:36250273-36250295 GGGACCTGCCTTTAATGCTCAGG - Intergenic
1119743288 14:77027721-77027743 GCGACCTGCCCCGCATGCCCTGG - Exonic
1119806524 14:77485701-77485723 GGGAGGTGCTCCTTTTGCCCTGG - Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1122248938 14:100424659-100424681 GGGACCAGCCCTTCCTGCCCTGG + Intronic
1122662007 14:103302191-103302213 TGGACCTGCCCCATATTTCCTGG - Intergenic
1123063745 14:105606069-105606091 GGGACCTGCCCCTGGGACCCTGG + Intergenic
1124203474 15:27698104-27698126 GGGAGCTGCCCATTTTGCCTGGG - Intergenic
1126376361 15:48000840-48000862 CTGACCTGCCCCTCATGGCCAGG + Intergenic
1128704804 15:69831173-69831195 GGGACCTCCTCCTTATTCACAGG - Intergenic
1128761147 15:70216785-70216807 GGAACCTGCCCTTCATGCCATGG + Intergenic
1129455155 15:75672908-75672930 GAGACAAGCCCCTTAAGCCCTGG + Intergenic
1130738201 15:86571862-86571884 GGGACCTGCCTCCTTCGCCCAGG + Intronic
1130853071 15:87816914-87816936 GGAACATGCCCATTATACCCAGG - Intergenic
1130856155 15:87841599-87841621 GGGACCTGCCCCCTCCACCCAGG + Intergenic
1132393108 15:101453277-101453299 TGGCCCTGCCCCATGTGCCCAGG + Intronic
1132514119 16:358371-358393 GGGCCCTACCTCATATGCCCTGG + Intergenic
1134044331 16:11090166-11090188 GGGACCTGCCTCATACGACCAGG + Intronic
1136136799 16:28261077-28261099 GGGACCTGACCCATAGGCACTGG + Intergenic
1137256362 16:46778371-46778393 GGGACCTGCCTCTTCTGCCCAGG - Intronic
1138978759 16:62241098-62241120 GGAATTTGCACCTTATGCCCTGG + Intergenic
1140995813 16:80258652-80258674 AGGACATGACCCTAATGCCCTGG + Intergenic
1141215655 16:82020821-82020843 GGAACCTCGCCCTTTTGCCCAGG - Intergenic
1142143564 16:88483267-88483289 GGCACCTGCCCCTCCTGTCCAGG + Intronic
1142151086 16:88512835-88512857 GGGCCCGGCCCCTCATGTCCTGG - Intronic
1142465928 17:137486-137508 CGGACCTGCCCATTAGGACCCGG - Intergenic
1143487076 17:7261132-7261154 GGGACCTGCCCGCTTGGCCCAGG - Intronic
1143889082 17:10088525-10088547 TGGAACTGCCCCTCCTGCCCGGG - Intronic
1144126102 17:12204400-12204422 GGGACCTGTTCCCTATGCTCTGG + Intergenic
1144853308 17:18254854-18254876 GGGTCTTGCCCCTTCTACCCAGG - Exonic
1147453325 17:40519580-40519602 TGGGGCTGCCCCTGATGCCCTGG - Intergenic
1148134664 17:45284526-45284548 GGGACTTGCCCCTCAGGCCCTGG + Intronic
1148755162 17:49969435-49969457 GGGCCATGGCCCTTCTGCCCGGG + Exonic
1149218598 17:54388816-54388838 GGGACCTGCCCCATCTGTCTAGG - Intergenic
1149218855 17:54390751-54390773 GGGACCCGCCCCATCTGCCTAGG + Intergenic
1151010084 17:70484002-70484024 GGGACCACCCACTTTTGCCCAGG + Intergenic
1151501840 17:74495028-74495050 GGGACCTACTCCTGAAGCCCAGG + Intergenic
1151995074 17:77603301-77603323 GGGGCCTGCCCCTTGGGGCCCGG + Intergenic
1153723959 18:7936644-7936666 GGGAACTCCCCCATCTGCCCTGG - Intronic
1153821702 18:8837632-8837654 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1157418106 18:47522855-47522877 GCAGCCTGCCCCTTATGCACTGG - Intergenic
1157506649 18:48231155-48231177 GGGACCTGCACTTTTTACCCAGG - Intronic
1158523081 18:58188147-58188169 AGGACCTGTGCCTGATGCCCAGG + Intronic
1159507367 18:69354632-69354654 TGGACCTGCCCCAGATGCCCTGG + Intergenic
1161320176 19:3637491-3637513 GGGCACTGCCCCTTCTCCCCAGG + Intronic
1162263697 19:9552720-9552742 GGGACCTACCCCTTTCCCCCTGG + Intergenic
1162977607 19:14217580-14217602 GGGCCCCGCCCCTTCTCCCCAGG + Intergenic
1163764151 19:19153100-19153122 CGGAAATGCCCCTGATGCCCAGG + Intronic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1164061364 19:21678203-21678225 GGGAACTGCCCCGCATGCCGAGG - Intergenic
1164065291 19:21709509-21709531 GGGAACTGCCCCGCATGCCAAGG + Intergenic
1166277290 19:41762777-41762799 GGCACCTTCTCCATATGCCCTGG - Intronic
1166864483 19:45827709-45827731 GGGACCGGGCCCTTTTGTCCAGG - Intronic
1167747062 19:51358106-51358128 GGGAGCTGCCCCATTTGGCCTGG + Intronic
1168025041 19:53637770-53637792 TGGACCTGACCTATATGCCCAGG - Intergenic
1168452028 19:56474194-56474216 GGGGCCTTCCCCTCCTGCCCTGG + Intronic
1168710130 19:58494937-58494959 GGGTCCTGCCTCTGTTGCCCAGG + Intronic
1202700947 1_KI270712v1_random:163342-163364 GGGAGCTGACCCTGATGCACGGG - Intergenic
925048169 2:790117-790139 GGGACCTGTCCCCTCTGCTCAGG - Intergenic
928030702 2:27776341-27776363 GGGGCCTGCCCCCATTGCCCAGG + Intronic
928454068 2:31403491-31403513 GAGAACTGCCCCGTATGCTCAGG - Intronic
929652207 2:43691601-43691623 GGGACCTGCCCCATCTGCCTAGG + Intronic
930037139 2:47093568-47093590 GCGACCTGCCCCTTTTCCCCAGG + Intronic
930611992 2:53554165-53554187 GGACCCTCCCCCTTCTGCCCAGG - Intronic
931102309 2:59015756-59015778 GGGACCTGCCCTATCTGCCTAGG + Intergenic
934171875 2:89546831-89546853 GGGAGCTGACCCTGATGCACGGG - Intergenic
934282183 2:91621149-91621171 GGGAGCTGACCCTGATGCACGGG - Intergenic
935353918 2:102180402-102180424 GCCACCTGCCCCTTCTCCCCAGG - Intergenic
937082987 2:119153660-119153682 TGGACCTGCCCCTTCTGTGCAGG + Intergenic
938104477 2:128520651-128520673 GGGGCCTGGCCTTTAAGCCCAGG + Intergenic
938732580 2:134158220-134158242 GGGACCTGCCCCTTTTTGCCTGG + Intronic
939262601 2:139829602-139829624 GGGACTTGCCCCATCTGCCTAGG + Intergenic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
944383754 2:199141526-199141548 GGGACCGCTCCCTTCTGCCCAGG - Intergenic
944536243 2:200713324-200713346 GGGACGTGCCCGTTCTGGCCTGG - Intergenic
945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG + Intronic
947204082 2:227644432-227644454 GGGGCCTGCCCTTTGTACCCTGG + Intergenic
947601641 2:231454572-231454594 GGGACCTGCTCCTGCAGCCCTGG - Exonic
948122584 2:235542283-235542305 TGGCCCTGGCCCTTATGCTCAGG - Intronic
948575418 2:238946757-238946779 GGACCCTCCCCCTTCTGCCCAGG + Intergenic
949070248 2:242019905-242019927 GGGAGCTGCCATTTATGCTCGGG + Intergenic
1169118283 20:3081277-3081299 GGGCCCTGACCCCAATGCCCAGG - Intergenic
1170494998 20:16915507-16915529 GGAACCACCCCCTTCTGCCCAGG - Intergenic
1170546094 20:17436889-17436911 GGGGCCGGCCCCCTAGGCCCCGG + Intronic
1171328804 20:24319068-24319090 TGGACCTGCCTCATCTGCCCAGG - Intergenic
1172363559 20:34331990-34332012 GGGACCTGCCCCGTCTGCCTAGG - Intergenic
1173184907 20:40833208-40833230 GGGCCCTGCTCCAGATGCCCTGG - Intergenic
1173960993 20:47072354-47072376 GGAACCTGCCTCTTAGTCCCTGG + Intronic
1174075148 20:47930033-47930055 GGCTCCTGCCCCTTCTGGCCTGG - Intergenic
1175268886 20:57720034-57720056 GGGTCCTGCCCCCTATGGCATGG + Intergenic
1176165787 20:63672829-63672851 GGGACCTGCCCGTCAGGCGCAGG + Intronic
1177900876 21:26913755-26913777 GGGACCTGCCCCATCAGCCTAGG - Intergenic
1180228769 21:46413886-46413908 GGGACCTGCCCCTGGTGCACTGG - Intronic
1180574158 22:16757178-16757200 GGCATCTGCCCCTTCTGACCTGG - Intergenic
1181053304 22:20247693-20247715 AGTACCAGCCCCTGATGCCCTGG + Intronic
1182147683 22:28006781-28006803 GGGACCTTCTGCATATGCCCTGG + Intronic
1183604739 22:38861684-38861706 GGGACCTGCCCCCCATGCTGGGG + Exonic
1183669895 22:39266329-39266351 GGTTCCTGCCCCTTAGGGCCTGG + Intergenic
1185128865 22:49026096-49026118 GGCACCTGCCGCTAATGCCAGGG - Intergenic
1185390283 22:50557009-50557031 GGGCACTGCCTCTAATGCCCAGG - Intronic
949925621 3:9038742-9038764 CAGACCTTCTCCTTATGCCCTGG + Intronic
951136255 3:19107396-19107418 GGGACTGCCCCCTTCTGCCCAGG + Intergenic
952016105 3:28959071-28959093 GGGAACCGCCCCTTCTGCCCAGG - Intergenic
953392203 3:42540281-42540303 GGGGCCTGGCCCTTAGACCCAGG + Intergenic
953662167 3:44899249-44899271 GCGAACTGCCCCTTCTCCCCCGG - Intronic
954692283 3:52401996-52402018 AGGACCTGGCCCTTCTGCCTGGG - Exonic
954737892 3:52721893-52721915 GGAACCTGCCCCATCTGCCTAGG - Intronic
958636215 3:96750430-96750452 GGACCCTCCCCCTTCTGCCCAGG - Intergenic
961049836 3:123736935-123736957 AAGACCTGCCCCTTGTGGCCGGG + Intronic
962763855 3:138543163-138543185 AGGACCTGCCCCTTCTGCCTAGG + Intronic
963251950 3:143111818-143111840 GGGGCCTGCCCCTGATGACTGGG - Intergenic
965087190 3:164113940-164113962 GGGACCTGCCCCTTCACCCAGGG - Intergenic
975448670 4:74499677-74499699 AGCACTTTCCCCTTATGCCCTGG - Intergenic
978216250 4:106208183-106208205 GGGACTTGCCCCATCTGCCTAGG - Intronic
979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG + Intergenic
984752247 4:183289260-183289282 TGCTCCTGCCCCTTAGGCCCTGG + Intronic
985101268 4:186460719-186460741 GGGACCTGCCCCTATTGGCTAGG + Intronic
986844077 5:11732890-11732912 GGGTCCTGCCCCCTACGTCCTGG + Intronic
988565938 5:32320220-32320242 GGGTCCACCCCCTTCTGCCCAGG + Intergenic
991686849 5:69189517-69189539 GGGCCCCGCCCCTTCCGCCCAGG - Intergenic
992399964 5:76403163-76403185 TGGACCCGCCCCTTCTCCCCCGG - Intergenic
998848347 5:146332232-146332254 TTGACCTCCCCCTTAAGCCCTGG - Intronic
1000636067 5:163645096-163645118 GGGACCTGCCCCATCTGCCTAGG - Intergenic
1006347814 6:33497726-33497748 GTGCCCTGCCCCTTCTGACCTGG + Intergenic
1008010048 6:46456918-46456940 GGGACGTGTCCCTGCTGCCCTGG + Exonic
1008716283 6:54294009-54294031 GTGACCTGCCCCTTCTACCTGGG + Intergenic
1008771928 6:54989571-54989593 GGGACGTCCCCCTTATCTCCAGG + Intergenic
1011866393 6:91834104-91834126 GGGATCTGCCTCTATTGCCCAGG + Intergenic
1014378635 6:120711053-120711075 GTCACCTGTCCCTCATGCCCTGG + Intergenic
1014391668 6:120872420-120872442 GCGACCCGCCCTTTCTGCCCAGG - Intergenic
1014440663 6:121470209-121470231 GGGACCTGGCTGTTTTGCCCAGG - Intergenic
1016199978 6:141395009-141395031 GGGACCTGCCCCTTCTGCCCAGG - Intergenic
1019296127 7:276375-276397 GGGACCCGCCCCTTCCACCCAGG + Intergenic
1020649228 7:10854943-10854965 GGGACCTGTCCCTTCCACCCAGG - Intergenic
1021980978 7:26055405-26055427 GGGACTTGCCCTTTCTTCCCTGG - Intergenic
1023839547 7:44088633-44088655 GGGGCCTGCCCCTGCTGCCCTGG + Intergenic
1023863494 7:44228395-44228417 GGGCCCTGCCCATGGTGCCCAGG - Intronic
1023912405 7:44565345-44565367 GTGTACTGTCCCTTATGCCCTGG - Intergenic
1023926828 7:44675501-44675523 GGGACGTTCTCCTTATGCCCTGG + Intronic
1023976237 7:45032319-45032341 GGAACCTGCCCCTTCTACCTGGG - Intronic
1025299881 7:57810383-57810405 GGCATCTGCCCCTTCTGACCTGG + Intergenic
1026835715 7:73637845-73637867 GGGGCCTGCCCTTTATGCTAAGG + Intergenic
1028024559 7:85821189-85821211 GGGCCCTCCCTCTTCTGCCCAGG - Intergenic
1029474976 7:100777781-100777803 GGGTCTTGCCACTTTTGCCCAGG + Intronic
1031173994 7:118325611-118325633 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1031667626 7:124504149-124504171 GGGACCCGCCCCATCTGCCTAGG + Intergenic
1034101821 7:148457297-148457319 GGGACCTCCCCATTTTACCCAGG + Intergenic
1034717317 7:153255666-153255688 GGCACCTGCCCCATCTGCCTAGG - Intergenic
1035434583 7:158849973-158849995 GGGGCCTGGCCCTTTTGCCCAGG + Intergenic
1038520302 8:28226655-28226677 GGGACCCGCCCCATCTGCCTAGG - Intergenic
1043798668 8:84579005-84579027 GGGACCACCCCTTTCTGCCCAGG + Intronic
1044149210 8:88752628-88752650 GGGACCCGCCCCTTCTGCCTAGG + Intergenic
1049574838 8:143385225-143385247 GGGTCCTGTCCCATCTGCCCAGG + Intergenic
1049592615 8:143469436-143469458 GGCACCTGTCCCTGAAGCCCTGG + Intronic
1049838224 8:144754081-144754103 GGGTCCTGCCCCTTGTCCCCGGG - Intronic
1051265744 9:15307040-15307062 GGGCCCGGCCCCTGAAGCCCTGG - Intronic
1054151463 9:61609210-61609232 GGCATCTGCCCCTTCTGACCTGG + Intergenic
1056084112 9:83128250-83128272 GGGATCTGCCCCATCTGCCTAGG - Intergenic
1060940595 9:127540987-127541009 TGGACCTGCTCCCTATGCCCTGG - Intronic
1061029083 9:128068714-128068736 GGGACACCCCACTTATGCCCTGG + Intronic
1061792300 9:133065046-133065068 GGGACCTGCCCGTTATGATCTGG + Exonic
1061907392 9:133705624-133705646 AGCACCTGCCCCATCTGCCCTGG + Intronic
1062115277 9:134805260-134805282 GGGGACTGCCCCTTCTGACCTGG - Intronic
1062709836 9:137969087-137969109 GGGACCTGTGCCTCATCCCCGGG + Intronic
1190705544 X:53023880-53023902 GGGACCCGCCCCATCTGCCTAGG - Intergenic
1195671372 X:107472982-107473004 GAGACCTGCCCCTTTTGGGCTGG - Intergenic
1199742251 X:150746321-150746343 GGGACCAGCCCCTCTTACCCAGG - Intronic
1200424880 Y:3009579-3009601 GGAACCAACCCTTTATGCCCAGG + Intergenic