ID: 945772208

View in Genome Browser
Species Human (GRCh38)
Location 2:214058198-214058220
Sequence ATGATTAAGCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 0, 2: 9, 3: 114, 4: 804}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945772208 Original CRISPR ATGATTAAGCTGGAGGAGGA AGG (reversed) Intronic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
902702277 1:18180608-18180630 ATGCTGAACCTGGAGTAGGAAGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
904602961 1:31683815-31683837 AGGAAGAAGCTGGAGGAGAAGGG - Intronic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905188923 1:36217969-36217991 ATGATTAAGCTTAATGAGGAAGG + Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
905708034 1:40077016-40077038 ATCATAAAGCTGTAGGAAGAAGG + Intronic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906741581 1:48190137-48190159 AGGAGGAAGCTGGAGGAAGAAGG + Intergenic
907685089 1:56602825-56602847 ATGATTAAGCTTAGCGAGGAAGG + Intronic
909039801 1:70635641-70635663 TTGAGTAAGCTGGAGAAGAATGG + Intergenic
909327506 1:74369450-74369472 ATGATTGAGCTGGCAGAGAATGG - Exonic
909692555 1:78425053-78425075 TGGATTCAGCTGTAGGAGGAGGG + Intronic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910255729 1:85245549-85245571 TACATTAAGCTGGAGGAGGGAGG - Intergenic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912731456 1:112110216-112110238 ATGATTAAGCTTGGGGAGGAAGG - Intergenic
913014990 1:114723882-114723904 ATGATTGAGATTGTGGAGGAGGG - Exonic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
913350942 1:117858402-117858424 ATGATTAAGCTTAGGGAGAAAGG + Intergenic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
915006543 1:152643338-152643360 ATAATTAAGCTGAATGAGAAAGG - Intergenic
915671800 1:157495457-157495479 ATGACAAAGCTGGTGGAGGCAGG + Intergenic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
916191563 1:162184007-162184029 ATGATTAAGCCGGGTAAGGAAGG - Intronic
916551855 1:165857532-165857554 ATGACTGAGCTGGAGCTGGAGGG + Intronic
916819924 1:168388281-168388303 TGCATTAGGCTGGAGGAGGAAGG - Intergenic
916890482 1:169107871-169107893 ATGATGATGTTGGAGGAGGAGGG - Intronic
917115375 1:171597910-171597932 ATGATTAAGCTTAATGAGGAAGG + Intergenic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917833569 1:178920465-178920487 AAGATTAAGCTGGTGGAGAGAGG - Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918606147 1:186428652-186428674 ATGATTAAGCTAAATGAGGAAGG - Intergenic
918980505 1:191552035-191552057 ATAATAAAGGTGGAGGAGAAAGG + Intergenic
919415229 1:197300235-197300257 CTGATTAAGCTTATGGAGGAAGG + Intronic
919436067 1:197562722-197562744 ATGATGAAGCTTGTTGAGGAAGG + Intronic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
920649539 1:207826418-207826440 ATGAGGAGGCTGGAGGAGGCAGG + Intergenic
920679920 1:208064539-208064561 ATTTTTAAGCTGGAGGTGAATGG - Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921156818 1:212445504-212445526 AGGATTAATCGGGGGGAGGAAGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921402611 1:214742897-214742919 ATGACTAAGCTTAATGAGGAAGG - Intergenic
921408258 1:214805838-214805860 ATGCTTAAGCTTGGTGAGGAAGG + Intergenic
921492583 1:215796732-215796754 ATGATTAAGCTTATTGAGGAAGG + Intronic
921577027 1:216847421-216847443 ATGATTTAACTGGAGTAGAAAGG + Intronic
922176592 1:223202351-223202373 AGCAGAAAGCTGGAGGAGGAGGG - Intergenic
922389533 1:225125828-225125850 ATGATTAAGCTTAATAAGGAAGG - Intronic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
922624164 1:227020833-227020855 ATGATTAAACTTAATGAGGAAGG - Intronic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1063034748 10:2275627-2275649 AAGATGAAGCTGGAGTAGGCAGG - Intergenic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1064454409 10:15473396-15473418 ATGATTAAGGTGGACAAAGATGG + Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1066479194 10:35779118-35779140 ATGATTAAGCTTGGTGGGGAAGG - Intergenic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1067769280 10:49111687-49111709 AGGCTTAAGCTGGAGGAAGCAGG - Intronic
1068013865 10:51489259-51489281 ATGATTAATCTGTAGGCAGACGG + Intronic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069304008 10:66945691-66945713 ATGATAAAGCTTAATGAGGAAGG - Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1072094779 10:92167350-92167372 ATGATTAAGCTTAATGAAGAAGG - Intronic
1072166681 10:92820301-92820323 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1072344468 10:94489620-94489642 ATGAGTAAGCTTAATGAGGAAGG - Intronic
1072829775 10:98645472-98645494 ATCATCAGGCTAGAGGAGGAAGG - Intronic
1072836305 10:98717441-98717463 ACGATTAAGCTTAATGAGGAAGG - Intronic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1073017949 10:100417029-100417051 TTGATTAAGGTGGCGGAGGACGG + Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073781088 10:106839162-106839184 ATGATTAAACTTGGTGAGGAAGG + Intronic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074905253 10:117856686-117856708 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076219155 10:128719206-128719228 ATGGTGGAGCTGGAGGAAGATGG - Intergenic
1076468484 10:130702281-130702303 CTGATTAAACTCGATGAGGAAGG - Intergenic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1077343168 11:2035040-2035062 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1077350292 11:2090111-2090133 ATAATTCAGCTAGGGGAGGAAGG + Intergenic
1077439543 11:2561660-2561682 ATCGCTAAGCAGGAGGAGGATGG - Intronic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078257386 11:9670245-9670267 ATGATTGGGTGGGAGGAGGACGG + Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1079158424 11:17970548-17970570 ATGATTAATCTTAGGGAGGAAGG + Intronic
1079738608 11:24029546-24029568 ACGATTATGGTGGAGTAGGAAGG + Intergenic
1082230026 11:49752372-49752394 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083637312 11:64127561-64127583 ATGATTCCGCTGCAGGAAGAAGG + Intronic
1083874603 11:65514883-65514905 ATTTTTATGCTGGAGGAGGGCGG + Intergenic
1084157613 11:67322943-67322965 AGGGTGAAGCTGGAGCAGGATGG - Intronic
1085504957 11:77053164-77053186 ATGAGTAAGCTGGGGGAGAGGGG + Intergenic
1085633266 11:78137502-78137524 ATGATTGAGCTTGATGAGGAAGG - Intronic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086320264 11:85639050-85639072 ATGATGAAGCTAGGGGAGTATGG - Intergenic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086620032 11:88876577-88876599 ATGATTAAGCTTAATGAGGAAGG - Intronic
1086901611 11:92373905-92373927 ATCTGTAAGCTGGAGAAGGAGGG + Intronic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1087613941 11:100467114-100467136 AAGATTTAGATGAAGGAGGAGGG - Intergenic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1087727939 11:101743718-101743740 ATGTTTAAGCTGGCTCAGGATGG - Intronic
1087952580 11:104241370-104241392 ATCATTAAGCTAGTGAAGGATGG + Intergenic
1088462845 11:110100890-110100912 ATGATTTAGCTTGGGGAGAAAGG + Intronic
1088662072 11:112057358-112057380 ATGATTAAGCTCAATGAGTAAGG + Intronic
1089435029 11:118457725-118457747 ATGATAAAGCTGGTGGGGGGTGG - Intronic
1089723130 11:120448220-120448242 ATGGTGGAGCTGGAGGAGAAAGG - Exonic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1090249572 11:125241989-125242011 ATGGTGAAGGTGGAGGGGGATGG + Intronic
1090718997 11:129455670-129455692 AGGATGAAGTTGGAGGAGCAGGG - Intergenic
1091081961 11:132679630-132679652 GGGATTAACCTGGAGGATGATGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1202826154 11_KI270721v1_random:90229-90251 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1092292002 12:7165601-7165623 CTGATTAAGATGGGGGAAGAGGG + Intergenic
1092505455 12:9093941-9093963 AGGAGTGAGCTGGGGGAGGAGGG + Intronic
1093823239 12:23648015-23648037 ATGATTGAGCTTGATGAAGAAGG - Intronic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094465067 12:30744409-30744431 GTGATGAAGCTGGAGGGGGTAGG - Intronic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095550362 12:43430931-43430953 ATGATCAGGCTGGATGAGGATGG - Intronic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095754577 12:45750090-45750112 ATGATTACGCTTAATGAGGAAGG - Intronic
1096407280 12:51353014-51353036 ATGATTAGAATGGAGGAAGAGGG + Exonic
1097936419 12:65257144-65257166 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1097946411 12:65373801-65373823 ATAATTATGCTGAAGGAGGGAGG + Intronic
1098075184 12:66722204-66722226 ATGATTAAGCTTATTGAGGAAGG - Intronic
1098506174 12:71253254-71253276 ATGATCAAGCCTGAGGAGGGGGG - Intronic
1098626262 12:72673681-72673703 ATGTTTCAGATGGAAGAGGAGGG + Intergenic
1098712792 12:73786910-73786932 ATTATTAAGCCTAAGGAGGAAGG - Intergenic
1098823585 12:75265032-75265054 ATGAGAAATCTGTAGGAGGATGG - Intergenic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1099218370 12:79881226-79881248 ATGATTAAGCTTGGTGAGAAAGG + Intronic
1099343881 12:81473491-81473513 CTGATGAAGCTGTAGGAAGATGG - Intronic
1099389300 12:82059405-82059427 AGGAAGAGGCTGGAGGAGGAGGG + Intergenic
1099609114 12:84843723-84843745 ATGATTAAGCTTATTGAGGAAGG + Intergenic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100257005 12:92894386-92894408 ATGATTAAGCTTAATGAGGAAGG + Intronic
1100274266 12:93057755-93057777 ATGAGTGAGCTTGAGGAGCATGG - Intergenic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1102138256 12:110593211-110593233 CTGACTAAACTGGAGGAGGGTGG + Intergenic
1102243218 12:111338453-111338475 ATGAAGAAGCTGGAGAAGAAAGG + Exonic
1102394484 12:112574942-112574964 GTGATGAAGATGGAGGAGGGAGG + Intronic
1102654059 12:114465393-114465415 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1103296939 12:119895720-119895742 TTAATAAAGGTGGAGGAGGAAGG + Intergenic
1104395742 12:128431012-128431034 ATGATGAAGCTTCATGAGGAAGG + Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104520641 12:129471637-129471659 ATGATTAACCTTCATGAGGAAGG + Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1105325033 13:19363110-19363132 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1105341057 13:19526418-19526440 ATTTTTAAGCTGGAGCTGGATGG - Intronic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1105868253 13:24480440-24480462 ATGATTAGGCTTGGTGAGGAAGG + Intronic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1107299319 13:38948517-38948539 ATGAATGGGCTAGAGGAGGAGGG - Intergenic
1107368299 13:39711096-39711118 ATGTTACAGGTGGAGGAGGAAGG - Intronic
1107430510 13:40336196-40336218 ATGGCTCAGCTGGAGCAGGATGG - Intergenic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108546703 13:51502385-51502407 ATGAGTCAGCTGGAGGCAGAAGG - Intergenic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1108770635 13:53696384-53696406 ATGATTAAGCTTAATGAAGATGG + Intergenic
1109118333 13:58419709-58419731 TTGATTTAGTTGGAGGAAGAAGG - Intergenic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1110379003 13:74828051-74828073 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1110411646 13:75210308-75210330 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111220173 13:85194593-85194615 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1111575792 13:90152975-90152997 ATGATTGAGCTTAATGAGGAAGG - Intergenic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112156719 13:96825155-96825177 AGGGTTAAGCTGGTGGTGGAAGG + Intronic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112623064 13:101071820-101071842 ATGATTAAGCTTATGGAGGAAGG - Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112903990 13:104394620-104394642 AGGATAGTGCTGGAGGAGGAGGG - Intergenic
1113487013 13:110661654-110661676 ATGCTTAAGCTTAATGAGGAGGG - Intronic
1113626178 13:111848892-111848914 ATTATCAAGCTGGAAGTGGAAGG + Intergenic
1113654186 13:112057843-112057865 GTGATTTCGCTGGAGGAGGGAGG - Intergenic
1113722664 13:112572174-112572196 ATGGTTAAGCTTGGTGAGGAAGG - Intronic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114454405 14:22845866-22845888 ATCATTGAGGTGGACGAGGAGGG + Exonic
1114852551 14:26398826-26398848 AGGCTGAAGCTGGAGGAGGATGG - Intergenic
1115648304 14:35385205-35385227 ATGATGAAGGTGGAGAAGGCGGG - Intergenic
1115747177 14:36449688-36449710 ATAATGAGGCTGAAGGAGGACGG + Intergenic
1116016528 14:39414548-39414570 ATGATTAAGCTTCATAAGGAAGG - Intronic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1116859271 14:49980671-49980693 ATCAATAAGCTGGGGAAGGAGGG + Intergenic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1118959927 14:70519778-70519800 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1120169452 14:81234282-81234304 TTGCTTCAGCTGGAGGGGGAGGG + Intergenic
1120311445 14:82832962-82832984 ACAATGAAGTTGGAGGAGGAGGG + Intergenic
1120482057 14:85062552-85062574 ATAATTAAGCTCCATGAGGAAGG + Intergenic
1120544139 14:85789491-85789513 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122118102 14:99537592-99537614 GTGACTGGGCTGGAGGAGGAGGG - Intronic
1122423035 14:101589333-101589355 ATCTTTAAGCTGGAGGGGCATGG - Intergenic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1123707530 15:22960719-22960741 ATGCCTAAGCAGGAGGAGGGCGG - Intronic
1124101259 15:26696152-26696174 GGAAATAAGCTGGAGGAGGAAGG - Intronic
1125482013 15:40087640-40087662 ATCATTCAGCTGGAGGAGGAGGG + Intergenic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125875370 15:43139459-43139481 ATGATGAAGCTTGGTGAGGAAGG + Intronic
1125898376 15:43322089-43322111 ATGATGACTCTGGAGAAGGAAGG + Intergenic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1126469213 15:48989287-48989309 CTAAATAAGCTGGGGGAGGAGGG - Exonic
1126828277 15:52572621-52572643 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1128189932 15:65682698-65682720 ATGATTAAGCTTAATGAGGAAGG - Intronic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1128998548 15:72314956-72314978 ATGATTTAACTGGAGGAGATAGG - Intronic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129200005 15:73993037-73993059 GTGATCAAGGTGGAGTAGGAAGG + Intronic
1129236263 15:74225532-74225554 ATCATTGAGATGGAGGTGGAGGG - Intergenic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130447862 15:84020967-84020989 ATGATTTAGCAGGAGGAACAGGG - Intronic
1130865929 15:87933350-87933372 ATGAAAATGCTGGAGAAGGAAGG - Intronic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1132180860 15:99751991-99752013 AAGATAAAGCTGGTGGAGGGAGG + Intergenic
1132420970 15:101668193-101668215 ATGATTAAGCTTGGTGAGGAAGG - Intronic
1133089516 16:3392931-3392953 AAGATTAAGTTGGATGGGGAAGG + Intronic
1133599331 16:7323788-7323810 AAGATGAAGATGTAGGAGGAAGG + Intronic
1133721494 16:8498626-8498648 ATCATTGAACTGGAAGAGGAAGG - Intergenic
1134564251 16:15237293-15237315 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1134738243 16:16519406-16519428 TTTATTAAGCTTGAGGAGGTGGG + Intergenic
1134929256 16:18192757-18192779 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1135766385 16:25180939-25180961 ATGATTAAGCTTGGTGAGGAAGG + Intergenic
1135952864 16:26931543-26931565 AAGATTAAGCTGGAGATGGGTGG - Intergenic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1137007834 16:35294961-35294983 ATTATTAAGCTTGACGAAGAGGG - Intergenic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138220115 16:55243047-55243069 TTGATCAAGCTGGGGAAGGAAGG + Intergenic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1138895927 16:61204560-61204582 ATAATTAATCTGGATGGGGAGGG - Intergenic
1139002899 16:62535818-62535840 ATGATTTAGCTTGGTGAGGAAGG - Intergenic
1139940959 16:70605012-70605034 AGGATTAGGCTGGTGGGGGAAGG + Intronic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140162612 16:72513647-72513669 ATGATTAACCTTAATGAGGAAGG - Intergenic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141304487 16:82848835-82848857 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144168458 17:12635128-12635150 TTGATTTAACTGTAGGAGGATGG - Intergenic
1144324489 17:14165677-14165699 ATGATTAAGCTTAATGAGGAAGG + Intronic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1144943916 17:18960193-18960215 ATGATGAGGCTGGATGAGGGAGG - Intronic
1144992233 17:19241197-19241219 ATGATTAAGGTGGTTGAGGATGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145315541 17:21730259-21730281 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145726879 17:27137398-27137420 ATGATTGAGCTTAATGAGGAAGG + Intergenic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1147429284 17:40361818-40361840 AGGATGAAGATGGAGGAGGGAGG + Intronic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1150961166 17:69913960-69913982 ATGATGATGATGCAGGAGGATGG + Intergenic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152402232 17:80074014-80074036 ATGATTAAGCTTCATGAGGAAGG + Intronic
1152434437 17:80266838-80266860 ATGATTAAGCTTCTTGAGGAAGG + Intronic
1152884864 17:82843623-82843645 ACGATTAAGCTGGATGGGGAGGG - Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153126533 18:1798656-1798678 ACGATTAAGCTGGGTGAGGAAGG + Intergenic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1154227664 18:12522073-12522095 ATGATTAAGTTTGGTGAGGAAGG + Intronic
1154249490 18:12731662-12731684 ATGATTAAGCTTATTGAGGAAGG - Intergenic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155266145 18:24095799-24095821 ATGATTAAGCTTAATGAGGAAGG - Intronic
1155281527 18:24245557-24245579 ATTGTTAAGGTAGAGGAGGATGG + Intronic
1155473428 18:26214148-26214170 ATAATAAAGCTGTAGGAGGCAGG + Intergenic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1155786294 18:29905353-29905375 ATGATGCAGCTGGAGTTGGAAGG - Intergenic
1155853716 18:30805408-30805430 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1157487717 18:48100441-48100463 ATTAGCAAGCTGGAGGAGGAAGG - Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158212049 18:55062543-55062565 ATGATTAAGCTTCATGAGGAAGG - Intergenic
1158445019 18:57511962-57511984 ATGAGTGAGGTGGAGGAGCAAGG + Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159700517 18:71620935-71620957 ATGTTTAAGCTTAATGAGGAAGG - Intergenic
1160218093 18:76951773-76951795 ATGATTAAGCTTAATGAGGAAGG - Intronic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1160546470 18:79660081-79660103 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1161701477 19:5798243-5798265 TTGACTAACCTGGAGGAGGCAGG + Intergenic
1162746294 19:12800574-12800596 ATGACACAGCTAGAGGAGGATGG - Intronic
1165796335 19:38522055-38522077 ATGATTTTTCAGGAGGAGGAAGG + Intronic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167708025 19:51093400-51093422 ATTCTTTTGCTGGAGGAGGAAGG - Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
925880326 2:8346748-8346770 CTGCTTCAGATGGAGGAGGAAGG - Intergenic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926449997 2:12991360-12991382 ATGATTAAGCTTGGTGAGGTAGG + Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
926532991 2:14074707-14074729 ATTATTATGCTGCAGGTGGAAGG - Intergenic
926611541 2:14952961-14952983 ATGTTTAAGGTAGAGGATGAAGG + Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
928227189 2:29460851-29460873 ATGATTAAGCTTGGTAAGGAAGG + Intronic
928633086 2:33214326-33214348 GTGATTAAGCTCAAGGAGTATGG + Intronic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930707281 2:54517113-54517135 ATGTTAATGCTGGAGGGGGATGG + Intronic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931013685 2:57949724-57949746 ATGATTAAGCTTAATGAGGAAGG + Intronic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933906272 2:86896689-86896711 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
934909792 2:98241286-98241308 GTGATAAAGCTGGTGAAGGAAGG + Intronic
935228347 2:101074072-101074094 ATGATTAAGCTTAATGAGAAAGG - Intronic
935277316 2:101486143-101486165 ATGATTAAGCTGAAGTGGGCTGG - Intergenic
935509074 2:103948870-103948892 ATGATAAAGCCAGAGGAAGAGGG - Intergenic
935600186 2:104914691-104914713 TTGCTTTAGCTGAAGGAGGAGGG + Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935776270 2:106475068-106475090 ATGATTAAGCTTCGTGAGGAAGG - Intergenic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
936838584 2:116740582-116740604 AAAATTATGCTGGAGGTGGAAGG + Intergenic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
937678331 2:124616671-124616693 ATGATTAACCTTAATGAGGAAGG - Intronic
937979264 2:127604604-127604626 ATGATTAAGCTTCGTGAGGAAGG - Intronic
938239605 2:129733203-129733225 TTGGTGAGGCTGGAGGAGGAGGG - Intergenic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
938987215 2:136589015-136589037 ATGATTAAGCTTAATGAGGGAGG - Intergenic
939086626 2:137726942-137726964 ATGTTGAAGGTGGAGGAGCATGG - Intergenic
939285444 2:140123227-140123249 ATGATAAAGCTTAATGAGGAAGG - Intergenic
939640215 2:144631612-144631634 ATGATTAAGCTCAATGAAGAAGG + Intergenic
939663682 2:144922637-144922659 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940066413 2:149634737-149634759 AGGATTAAGCGGGAGGAGGAGGG - Intergenic
940106917 2:150111477-150111499 ATGATGGAGTGGGAGGAGGAAGG - Intergenic
940126864 2:150335861-150335883 ATGATTAAACTTGGTGAGGAAGG + Intergenic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
941735095 2:168965333-168965355 AAGATTAACCTAGAGGAGAATGG - Intronic
942110306 2:172675300-172675322 CTGATTAAGCTTGCTGAGGAGGG + Intergenic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942985402 2:182134740-182134762 ATGATGAAGGAGGAGGAGAAAGG + Intergenic
942999302 2:182304527-182304549 ATGATTAAGTTTAACGAGGAAGG - Intronic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
944217075 2:197267332-197267354 ATTAGAAAGGTGGAGGAGGATGG - Intronic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
945140725 2:206683666-206683688 ATGATTGAGTGGGATGAGGAAGG - Intronic
945424784 2:209687560-209687582 AAGATCAAGCTGATGGAGGATGG - Intronic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
946861197 2:224001689-224001711 ATGCTTCAGCTGGGGGCGGACGG - Exonic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947771079 2:232670519-232670541 ATTTTGAATCTGGAGGAGGAGGG + Intronic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
948290718 2:236822333-236822355 ATGATGGAGGTGGAAGAGGAAGG + Intergenic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169228382 20:3870334-3870356 ATGATTCAGCGGGAGAAAGAAGG - Exonic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169702114 20:8458393-8458415 ATGATTAAGATGGATGAGGAGGG - Intronic
1170397148 20:15938734-15938756 ATGTTTAAGCTTAATGAGGAAGG + Intronic
1172342121 20:34166709-34166731 CAGATTAAGCTGGATGAGGCTGG - Intergenic
1172416728 20:34775166-34775188 AAGATAAGGCTGGATGAGGAAGG + Intronic
1173139948 20:40473104-40473126 ATGAATAAGATGGATGAGTAAGG - Intergenic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174961148 20:55158851-55158873 ATAACTAAGCTGGACCAGGATGG + Intergenic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1175088363 20:56480608-56480630 ATGATTAAGCTTAGGGAGGAAGG - Intronic
1175250399 20:57606035-57606057 ATGATTAAGCTTGGTGAGGGAGG + Intronic
1176677035 21:9788498-9788520 ATGATTCAGCAGCAGGAGCAGGG - Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1177512376 21:22105547-22105569 ATGATTAAGCTTGGCGAGGAAGG - Intergenic
1177869236 21:26550444-26550466 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1178158755 21:29886490-29886512 ATTATAAAGATGGAGGAGAAGGG + Intronic
1178967542 21:37136279-37136301 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1180022833 21:45139746-45139768 ATGAATAAGCTGGAAAAGGCTGG - Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180651982 22:17385313-17385335 ATGATTAAGCTTCATGAAGAAGG - Intronic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1180900099 22:19364813-19364835 ATGATTAAGCTTAAAGAGGAAGG + Intronic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1181026415 22:20130296-20130318 AGGGTTCAGCTGGTGGAGGAAGG + Intronic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1182008606 22:26981866-26981888 AAGATTAAGCTGCCGGAGGGTGG + Intergenic
1182490939 22:30671318-30671340 ATCATTAAGCTGGAGCGGGGAGG - Intergenic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1183612534 22:38919871-38919893 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681468 22:39332737-39332759 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951306643 3:21071265-21071287 ATGATTCAGCTTAATGAGGAAGG + Intergenic
951373324 3:21880693-21880715 ATGATTAAGCTTAATGAAGAAGG + Intronic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952635673 3:35527343-35527365 ATGATTAAACTTAATGAGGAAGG - Intergenic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953890398 3:46748083-46748105 AAGATTAAGCGGGTGGAGAAGGG + Intronic
954095914 3:48327632-48327654 ATGATTAAATTGGAGAGGGAAGG + Intronic
954462179 3:50633636-50633658 ATGGCAAGGCTGGAGGAGGAAGG - Intronic
954588019 3:51753739-51753761 TTGCTTCAGCTGGAGGGGGAGGG + Intergenic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
955604101 3:60681504-60681526 ATGATTAAGCTTGGCGAGGAAGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956135886 3:66098542-66098564 ATTATTAAGCTAGATGATGAGGG + Intergenic
956893104 3:73631940-73631962 GTGATTTAGCTGAAGGAAGAGGG - Intergenic
957400897 3:79712178-79712200 ATGATTAAGCTTGGTGAGGAAGG + Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958601843 3:96304569-96304591 AAGGTTAAGGTGGAGAAGGATGG + Intergenic
958661631 3:97076137-97076159 ATGATTAGGCTTAATGAGGAAGG + Intronic
958748297 3:98164157-98164179 ATGGTTAAGCTGGATGACCAGGG - Intergenic
958752081 3:98203499-98203521 ATGATTAAGCTGGATGATCAGGG - Intergenic
958824813 3:99017527-99017549 ATCATCAAGCAGGATGAGGAGGG - Intergenic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959526360 3:107381772-107381794 GTGATTAAGATGGAGGGGAAAGG - Intergenic
959546360 3:107601335-107601357 ATGATTAAGCTTATTGAGGAAGG + Intronic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960208491 3:114931474-114931496 ATGATTAAACTGGATGATGGTGG - Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960648068 3:119912049-119912071 ATGATTAAGCTGAGCAAGGAAGG - Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961761227 3:129169580-129169602 CCAATAAAGCTGGAGGAGGAAGG - Intronic
962115954 3:132507889-132507911 ATGATTAACCTTGATGAGGAAGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963081367 3:141397555-141397577 ATGATTAAGCTTCATGAGGAAGG - Intronic
963283952 3:143414830-143414852 ATGATTAAGCTTAGCGAGGAAGG + Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963507379 3:146203968-146203990 ATGATTTAGCTTAATGAGGAAGG - Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
963608786 3:147439144-147439166 ATGATTAAGCTTAGCGAGGAAGG - Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
963946495 3:151151442-151151464 ATGATTAAGCTCAGCGAGGAAGG - Intronic
963962838 3:151328817-151328839 ATGATGAAGGTGGAGGAGCTGGG + Exonic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965424504 3:168505136-168505158 ATGATTAAGTTTAATGAGGAAGG - Intergenic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966709960 3:182961846-182961868 ATGATTCAGTTGGAGGTGGTAGG - Intronic
966750855 3:183320833-183320855 ACGATTAAGCTTAATGAGGAAGG - Intronic
966974797 3:185074302-185074324 ATGGGCATGCTGGAGGAGGATGG - Intergenic
967295199 3:187957536-187957558 ATGGTTAAACTGGTGGAGGGAGG + Intergenic
967300764 3:188009761-188009783 ATGATTATGGTGGGGGAGTAAGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968686728 4:1964671-1964693 ATACTTCAGCTGGAGGGGGAGGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970578815 4:17454338-17454360 ATGATTAAGCTTAGGGAAGAAGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970939620 4:21616133-21616155 ATGATGAAGATGCAAGAGGAAGG - Intronic
971609719 4:28707632-28707654 ATGATTAGGCTTAATGAGGAAGG + Intergenic
971921308 4:32943201-32943223 ATGTTTAAGCTTAATGAGGAAGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
973692760 4:53455349-53455371 ATGAGGAAGCTTGAAGAGGAAGG - Intronic
974336900 4:60559690-60559712 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
976582002 4:86748163-86748185 ATGATTAAGCTGGAGATATAAGG + Intronic
976878233 4:89884274-89884296 ATAAGTAAACTTGAGGAGGATGG + Intronic
976945110 4:90755823-90755845 ATAATTTAGCTGAAGGAGCAAGG - Intronic
977356039 4:95948089-95948111 ATGATTAAGCTTAATGAGGAAGG - Intergenic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
978571491 4:110142649-110142671 ATGATCTACCTGAAGGAGGAAGG - Intronic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979314018 4:119238211-119238233 ATGACTAAGCTTGGTGAGGAAGG - Intronic
979667610 4:123329485-123329507 ATGATTAAGCTTCACGAGGAAGG + Intergenic
979729430 4:124006246-124006268 ATGGTTAAGCTTGGTGAGGAAGG - Intergenic
980187855 4:129484696-129484718 ATGATTAACCTTGGTGAGGAAGG - Intergenic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981247501 4:142557149-142557171 ATGACAATGCTGGAGAAGGAAGG + Intronic
981439338 4:144765306-144765328 AGGATTAAGCTTAATGAGGAAGG - Intergenic
981493028 4:145361326-145361348 ATGATTAAGCTTGGGGAAGAAGG + Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
982575713 4:157107310-157107332 ATGATTAAGCTTAATGAGGAAGG + Intronic
982876044 4:160651244-160651266 ATTATTAAGCTAAATGAGGAAGG + Intergenic
983139340 4:164129212-164129234 ATGATTAAGAAGGAGGAAGAAGG + Intronic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983963260 4:173779541-173779563 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
984047988 4:174826421-174826443 AGGATTATGGTGGAGGAAGAGGG + Intronic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984899122 4:184569044-184569066 ATGATTAGGCTTAATGAGGAAGG - Intergenic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985188324 4:187342913-187342935 ATGATTAAGCTTAATGAGGAGGG - Intergenic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985398509 4:189570286-189570308 ATGATTCAGCAGCAGGAGCAGGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
985900453 5:2785106-2785128 ATGATTAAGCTGAGCAAGGAAGG + Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
986583804 5:9293790-9293812 ATGTTTAGGCTAGAGGTGGAGGG + Intronic
986776456 5:11018440-11018462 ATGATTAAGCTTAGCGAGGAAGG + Intronic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
987454719 5:18129394-18129416 ATGATTAAGCTTGGTGAGGACGG - Intergenic
987529393 5:19097773-19097795 ATGATTAAGCTTCATGAGGAAGG + Intergenic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
987935522 5:24458932-24458954 ATAATTAAGCTTAAAGAGGAAGG - Intergenic
988628018 5:32898709-32898731 ATGATTGAGCTGGTGGTGGGAGG - Intergenic
988655539 5:33207453-33207475 ATGATTAAGCTTTATGAGGAAGG + Intergenic
989303470 5:39922888-39922910 GTGATTAAGCTTAATGAGGAAGG - Intergenic
989324660 5:40178059-40178081 ATGATTAAGCTTATTGAGGAAGG - Intergenic
989403456 5:41034084-41034106 ATGAGTAAGCTGCAGAAGGCAGG + Intronic
989654091 5:43725760-43725782 ATGATTAAGCTAAGTGAGGAAGG - Intergenic
990143570 5:52732946-52732968 AACATTTAGCTGGAGGAGGCTGG - Intergenic
990222660 5:53610117-53610139 ATGATTAAGCTAGGTGAAGAAGG - Intronic
990358503 5:54995145-54995167 AAGATTAAGCAGGTGGATGAAGG - Intronic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
990523161 5:56599372-56599394 ATGATTAAGCTTAGCGAGGAAGG - Intronic
991336222 5:65550274-65550296 ATGATTAAGTTTCATGAGGAAGG - Intronic
991366858 5:65877591-65877613 GTGATTAAGCTTCATGAGGAAGG + Intergenic
991648558 5:68827822-68827844 AGGATGAAGGTGGAGTAGGATGG - Intergenic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992837537 5:80655055-80655077 ATGATAGGGCTGGAGGAGGAAGG + Intronic
992868530 5:80982429-80982451 ATGTTTAACCTGTAGGAAGAAGG + Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
994517453 5:100788597-100788619 ATGATTAAACTGCATGAGGAAGG - Intergenic
994800688 5:104370500-104370522 ATGACTAAGCTGAAGCATGAAGG - Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995474572 5:112534686-112534708 ATTATCAGGCTGGGGGAGGAAGG + Intergenic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
995658653 5:114455601-114455623 ATGATTAAGCTTAATGAGGAAGG + Intronic
995670073 5:114593210-114593232 ATGATTAAGCTTAAAGAGGAAGG - Intergenic
995678298 5:114688235-114688257 ATGATGATGATGGGGGAGGACGG - Intergenic
995932679 5:117468238-117468260 TTGTTTAGCCTGGAGGAGGATGG - Intergenic
996045788 5:118872380-118872402 ATGATTAAGCTTATTGAGGAAGG - Intronic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997703453 5:135923973-135923995 ATGATTAAGCTTGGTGATGAAGG - Intronic
998216386 5:140241165-140241187 CTGATTAAACTGGAGGAAAAAGG + Intronic
998814531 5:145999481-145999503 ATGATTAATCTTAATGAGGAAGG - Intronic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
998852443 5:146364103-146364125 ACATTTAAGCTGGAGGATGAAGG + Intergenic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
999835133 5:155362036-155362058 ATAATTAAGCTTAATGAGGAAGG - Intergenic
1000063354 5:157675078-157675100 TTCATTAAGCTGGAGCAGGGAGG - Exonic
1000353810 5:160373922-160373944 ATGATTAATCTGAAGGTTGATGG - Intergenic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000657490 5:163898434-163898456 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1002487130 5:179546833-179546855 ATGATTAAGCTTAATGAGGTAGG - Intergenic
1002574757 5:180168059-180168081 ATCCTTAAGCTGCAGGAGCATGG - Intronic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003478125 6:6504107-6504129 ATGTTTTAGCTGGAGGAATAAGG + Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1003996162 6:11541728-11541750 ATGATAAAGCTTAATGAGGAAGG - Intronic
1004545773 6:16597039-16597061 ATGATGCAGATGGAGCAGGAGGG - Intronic
1004550352 6:16640807-16640829 ATGATTAAGCTTAGCGAGGAAGG + Intronic
1004569299 6:16829971-16829993 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1004922801 6:20392727-20392749 ATGATTAAGCCTAATGAGGAAGG - Intergenic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1005938368 6:30542301-30542323 GTGATGAAGCTAGGGGAGGAAGG - Exonic
1006079944 6:31559263-31559285 ATGAGGAGGCTGGGGGAGGATGG + Intergenic
1006287181 6:33105542-33105564 GTCATTAAGCAGGGGGAGGATGG + Intergenic
1007218875 6:40262763-40262785 ATGACTGAGATGGTGGAGGAAGG + Intergenic
1007604103 6:43104097-43104119 ATGACTATTCTGGAGGAGGGAGG + Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1008761230 6:54853136-54853158 ATGAGAAAGCTGGAGGAGAAAGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009960790 6:70518026-70518048 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1009994048 6:70879730-70879752 ATGATTAAGCTGGACTCTGAAGG + Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011218048 6:85026236-85026258 ATGATTAAGCTTAGAGAGGAAGG + Intergenic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012358551 6:98347668-98347690 ATCCTAAAGCTGGAGCAGGAAGG + Intergenic
1012564906 6:100636575-100636597 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1012628715 6:101435811-101435833 ATGATTAAACTTGAGAAGTAAGG - Intronic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013021347 6:106223339-106223361 CCAATAAAGCTGGAGGAGGAAGG + Intronic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015304196 6:131688402-131688424 ATGATTAAGCTTAATGAGGAAGG + Intronic
1015337035 6:132051178-132051200 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016081618 6:139864153-139864175 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1018169072 6:161129828-161129850 ATGGTAAAGCTGGAAGAGGCGGG + Intergenic
1018224173 6:161611787-161611809 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1018289463 6:162276207-162276229 AAGATTAAGATGGAAGACGAAGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1019469464 7:1211054-1211076 ATGCTCAGGCTGGAGAAGGAGGG - Intergenic
1020414937 7:7934765-7934787 TTGATTTAGCTGGAGGAATAGGG + Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020859778 7:13477072-13477094 ATGATTAAGCTTAATGAGAAAGG - Intergenic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1020951313 7:14681919-14681941 ATGATTTAACTGAAAGAGGAAGG + Intronic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1021275134 7:18640881-18640903 CTCATTAAGCTGTAGGATGATGG - Intronic
1021472216 7:21016937-21016959 ATTATTAAGCTTCACGAGGAAGG - Intergenic
1021807387 7:24370869-24370891 ATTAATGAGCTGGAGGAGGTGGG + Intergenic
1021956564 7:25830846-25830868 ATTATTAAACTTGAGGAGCACGG + Intergenic
1021994533 7:26166914-26166936 TTTATTCATCTGGAGGAGGAGGG - Intronic
1022063269 7:26822981-26823003 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022279901 7:28897216-28897238 ATTATTAAGCTTGATGAGGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022905930 7:34856825-34856847 ATGATTGAGAGGCAGGAGGAGGG + Intronic
1023026095 7:36051107-36051129 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1025195928 7:56933396-56933418 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
1025676020 7:63643540-63643562 ATGATTAAGCTCAGCGAGGAAGG - Intergenic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1027751056 7:82147691-82147713 ATGATTAATCTGGAGAGGAAGGG - Intronic
1027811599 7:82908436-82908458 ACGCTTAACCTGGAGGAGAAAGG - Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030139393 7:106289451-106289473 AGGATGAAGCTGAAGGAGGTGGG + Intergenic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030387330 7:108880223-108880245 ATAATTAAGCTGAGTGAGGAAGG + Intergenic
1031057336 7:117007119-117007141 ATGATTAAGCTTAATGACGAAGG + Intronic
1031281740 7:119811572-119811594 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1031735868 7:125360749-125360771 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1032415702 7:131733751-131733773 AGGATAAAGCTGGAGGCAGAAGG + Intergenic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1033430403 7:141283993-141284015 ATGATTCGGCTGAAGGAGGTCGG - Intronic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1034421725 7:150994349-150994371 ATTATTTAGCTGGAGAAGAAAGG + Intronic
1034790056 7:153959900-153959922 ATGATTATGCTGAGTGAGGAAGG - Intronic
1034873254 7:154702346-154702368 ATGAGTAAGCTTAATGAGGAAGG + Intronic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1036469129 8:9034761-9034783 ATGATTAATCTTAAAGAGGAAGG + Intronic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1037126106 8:15351998-15352020 ATGGTTACCTTGGAGGAGGAAGG + Intergenic
1037263390 8:17033175-17033197 ATGATTAAGCTTAATGAGGAAGG + Intronic
1037451826 8:19023163-19023185 ATGATTGAGCTAGATGTGGATGG - Intronic
1038099859 8:24361269-24361291 AGGATTAGGCTGGAGGAGTTGGG + Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1038837851 8:31148250-31148272 GTCATTAAGAAGGAGGAGGAAGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039954779 8:42198636-42198658 GTGAGCAAGCTAGAGGAGGAGGG + Intronic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1040425624 8:47282817-47282839 ATGATTAAGCTTAGGTAGGAAGG - Intronic
1040774104 8:51018243-51018265 ATGATTACGCTTAATGAGGAAGG - Intergenic
1041372534 8:57177939-57177961 ATCATTAAGCTTGGTGAGGAAGG - Intergenic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1041563565 8:59248695-59248717 ATGATGAAACTGTAGGAGGGTGG - Intergenic
1041770037 8:61463447-61463469 ATGATTAAGCTTGGGGAGGAAGG - Intronic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042441010 8:68826609-68826631 ATGATTAAGCTCGGTGAGGAAGG - Intergenic
1042466110 8:69131651-69131673 CTGATTAAACTGGATGATGAGGG + Intergenic
1042548029 8:69968219-69968241 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042962432 8:74318639-74318661 GACATTAAACTGGAGGAGGAAGG - Intronic
1043099024 8:76016341-76016363 ATGATTAAGCTGAGTGATGAAGG + Intergenic
1043800099 8:84598133-84598155 ATGATAAAGAGGGAGGAGTAAGG - Intronic
1044044121 8:87409075-87409097 ATGATTAAGCTTAATGAGGAAGG + Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045232925 8:100322650-100322672 ATGATTAAGCTTAATGAGGAAGG - Intronic
1045381131 8:101627633-101627655 ATAATTAAGCTTAGGGAGGAAGG + Intronic
1045728611 8:105206011-105206033 ATGATTAAGCTTAGGAAGGAAGG - Intronic
1046105972 8:109666903-109666925 ATCATTAAGATGGAGAAGGTGGG - Intronic
1046130328 8:109959730-109959752 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1046571739 8:115974800-115974822 ATGATTAAGCTTAATGAGGAGGG - Intergenic
1046665221 8:116994858-116994880 ATGTTTTAGCTGGTAGAGGAAGG + Intronic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1048824319 8:138409097-138409119 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049629102 8:143642559-143642581 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050418119 9:5435459-5435481 AGAGTGAAGCTGGAGGAGGATGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050755486 9:8997707-8997729 ATGATTAGGCTTGATGAGGAAGG + Intronic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051085008 9:13338284-13338306 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1051852987 9:21530514-21530536 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1052834819 9:33242398-33242420 ATGATTCGGCGGGAGGAGAACGG + Intronic
1053024213 9:34717049-34717071 ATGATCCAGCTAGAGGAGGGAGG + Intergenic
1053103390 9:35390311-35390333 CTAAATAAGCTGGAGGAGAAAGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054839431 9:69720116-69720138 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055902809 9:81260698-81260720 ATGTTTAAGATGGTGGGGGAGGG - Intergenic
1056060719 9:82883144-82883166 AAGATAAAGATGGAGGAGGCTGG - Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057631864 9:96725789-96725811 CTGATTTAGCTGGAATAGGATGG - Intergenic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058348764 9:103996713-103996735 ATGATTAAGCTTATTGAGGATGG - Intergenic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058742067 9:107953703-107953725 AGCATTAAGTGGGAGGAGGAAGG + Intergenic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059236415 9:112764139-112764161 ATGTTTGAGCTGGAGAATGAAGG + Intronic
1059264837 9:113017304-113017326 ATGATTAAGTTTGGAGAGGAGGG + Intergenic
1059290087 9:113215217-113215239 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1059811410 9:117859523-117859545 AAGATGAAGATTGAGGAGGATGG + Intergenic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1060973042 9:127749677-127749699 ATGGTTAGGCTGGAGTAGGGTGG + Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1186283487 X:8019261-8019283 ATCATTAAGCTGCAGAAGGCTGG - Intergenic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187760134 X:22574079-22574101 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1188501476 X:30831588-30831610 AGGATTAAGGGGGAGGGGGAAGG + Intronic
1188583316 X:31742341-31742363 ATGATTAAGATTGGTGAGGAAGG - Intronic
1188591418 X:31840994-31841016 ATGATTAAGCTTGGTTAGGAAGG + Intronic
1188855604 X:35191538-35191560 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1189942624 X:46141320-46141342 ATGATTAAACTTGATGAGGAAGG + Intergenic
1190715679 X:53101267-53101289 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
1190831573 X:54063577-54063599 GGAATCAAGCTGGAGGAGGATGG + Intergenic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192091681 X:68165298-68165320 ATGATTAAGCTTAATGAGGAAGG - Intronic
1192388635 X:70700689-70700711 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1192676357 X:73200852-73200874 ATGATTAAGCTTGGTGAGAAGGG + Intergenic
1193652177 X:84150411-84150433 ATTATTAAGCTTGGTGAGGAAGG - Intronic
1193971277 X:88057009-88057031 ATGATTAAGCTTTGTGAGGAAGG + Intergenic
1194120809 X:89961404-89961426 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1194940228 X:100000321-100000343 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1195377577 X:104242880-104242902 ATGATTCAGCTAGACGAGGAAGG + Intergenic
1195818975 X:108921914-108921936 ATGATTGAGCTTAGGGAGGAAGG + Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198883743 X:141310384-141310406 ATGATTAAGCTTAGGGAAGAAGG - Intergenic
1199260182 X:145764061-145764083 ATGATTAAGCTTAGGGAGGAAGG + Intergenic
1200367402 X:155681513-155681535 GTGATTAAGCTTAGGGAGGAAGG + Intergenic
1200473675 Y:3618909-3618931 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1201566887 Y:15374603-15374625 CTAAGTAAGCTAGAGGAGGAAGG + Intergenic
1202591109 Y:26484171-26484193 ATTTTTAAGCTGGAGCTGGATGG + Intergenic