ID: 945777915

View in Genome Browser
Species Human (GRCh38)
Location 2:214130345-214130367
Sequence ACAGCTCCCTCACTTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945777913_945777915 10 Left 945777913 2:214130312-214130334 CCTTTCTGAGAACATGGAGTACT 0: 1
1: 0
2: 0
3: 9
4: 149
Right 945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG 0: 1
1: 0
2: 2
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945777915 Original CRISPR ACAGCTCCCTCACTTGGCTG TGG Intronic
900319662 1:2076280-2076302 CCACCTCCCTCACATGGCAGGGG + Intronic
900405729 1:2492166-2492188 ACAGCACCCTCACTTGGCCAGGG - Intronic
901871831 1:12142886-12142908 ACCTCTCCCTCGCTGGGCTGTGG - Exonic
903347210 1:22694438-22694460 ACTGCTCCCTTACCAGGCTGAGG - Intergenic
903827928 1:26158706-26158728 TCAGCCCCCTCCCTGGGCTGTGG - Intergenic
904280503 1:29415198-29415220 ACATCTCCCTCACCTGGCACTGG - Intergenic
905246973 1:36621751-36621773 ACAGCTCACTCACATGGCTGTGG + Intergenic
907185610 1:52606972-52606994 ACACCTCCCTTAGCTGGCTGAGG + Intronic
910464182 1:87478847-87478869 CCAGCTCCCTCACTTGCGAGAGG - Intergenic
911047190 1:93638275-93638297 CCAGCTCCCTCCCTGGGGTGGGG + Intronic
913308245 1:117455522-117455544 CCAGATCCTACACTTGGCTGAGG + Intronic
914320728 1:146556808-146556830 ATAGCACCCTCACTTGCCTTAGG - Intergenic
914879944 1:151539525-151539547 ATGGCTTCTTCACTTGGCTGTGG - Intergenic
916899427 1:169204190-169204212 ACAGATCCCTCACTTGGACAAGG - Intronic
917745353 1:178001248-178001270 ACCGCTCCCTAACTAGGCTAGGG + Intergenic
920021100 1:202957667-202957689 ACAGTGCCCTCACTTTGATGGGG - Intronic
920168896 1:204057378-204057400 CAAGCTCACTCACCTGGCTGTGG + Intergenic
921167952 1:212520579-212520601 ACAGTTCACTCACTTCCCTGTGG + Intergenic
922020393 1:221698593-221698615 CCAGATCCCACACTTGCCTGAGG + Intergenic
923971104 1:239204251-239204273 ACAGCTCTCACACTGGGATGGGG + Intergenic
1064086134 10:12348390-12348412 ACAGCTCTGTCTCTTGACTGGGG - Intergenic
1064912021 10:20412832-20412854 AGAGCTCCATCACTTTTCTGTGG + Intergenic
1065814136 10:29469609-29469631 ACAGCGTCCTCCCTGGGCTGTGG + Intronic
1065969999 10:30798668-30798690 CCATCTCCCTCGCTTGCCTGAGG - Intergenic
1067426796 10:46216879-46216901 ACAGCTCCCTGAGATGTCTGAGG - Intergenic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1068737011 10:60425193-60425215 GCAGCTCCCTCACTTGCCCACGG - Intronic
1069374621 10:67781476-67781498 TCATCTCCCTCACTTTCCTGAGG + Intergenic
1071452377 10:85809922-85809944 ACAGCTCCCAGACTGAGCTGAGG - Intronic
1073345297 10:102778280-102778302 AGAGCTCACTCCCCTGGCTGTGG - Intronic
1077514895 11:2995504-2995526 AAAGCCCCCTCAGTAGGCTGGGG + Intergenic
1080897075 11:36455814-36455836 ACAGCTGACGCACTTGTCTGAGG + Intronic
1081963874 11:47157707-47157729 GCAGGTCCCTGGCTTGGCTGTGG + Intronic
1083664776 11:64268465-64268487 ACATCTCCCTCACAGGGATGAGG - Intronic
1084027759 11:66463266-66463288 ACAGATCCCTCACATGGATTTGG - Intronic
1084739292 11:71128621-71128643 ACAGCTCCCTTTTGTGGCTGAGG - Intronic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1090247281 11:125225326-125225348 TCAGATCCTTCACTAGGCTGGGG - Intronic
1090801323 11:130174230-130174252 CCGCCTCCCTCACCTGGCTGTGG - Intronic
1091249118 11:134127184-134127206 CTGGCTCCATCACTTGGCTGTGG + Intronic
1091410723 12:237505-237527 GCACCTCCTTCCCTTGGCTGGGG - Intronic
1092986998 12:13855394-13855416 AGAACTCCCTCACTTAACTGTGG + Intronic
1093895579 12:24571083-24571105 ACAGCTCCCACACTTGGAGAGGG + Intergenic
1096104300 12:48987416-48987438 ACAGGTCCCTCTCTGGCCTGAGG - Intergenic
1099816904 12:87661025-87661047 ACACCTCCCACACTGGCCTGTGG + Intergenic
1100853622 12:98739106-98739128 CCAGCTCCACCACTTGGCTGTGG - Intronic
1101299764 12:103467021-103467043 ATGGCTCCCTCACATGTCTGTGG - Intronic
1101721624 12:107355337-107355359 CCACCTGCCTCACTGGGCTGGGG - Intronic
1101883431 12:108641459-108641481 ACAGCTCCCTGTCATGGATGGGG + Intergenic
1102506455 12:113387476-113387498 ACGGGTGCCTCACCTGGCTGGGG + Intronic
1103878712 12:124149415-124149437 ACAGGTCCAGCACTTGGCTTTGG + Intronic
1106421219 13:29587836-29587858 ACAGCCCCAGGACTTGGCTGCGG + Intronic
1112502153 13:99951237-99951259 TCAGCTTTCTCACTTGGCTGTGG - Intergenic
1113294813 13:108947353-108947375 ACAGAACCCTCCCTAGGCTGAGG + Intronic
1114835973 14:26203503-26203525 TCAGCTACCCCACTAGGCTGAGG - Intergenic
1118590307 14:67395949-67395971 CCAGCTCTGCCACTTGGCTGTGG + Intronic
1119436080 14:74598730-74598752 TCAGCTCCACCACGTGGCTGAGG - Intronic
1119443042 14:74641588-74641610 AGAGCTCACTTGCTTGGCTGTGG + Intergenic
1119646528 14:76352591-76352613 AGAGGTCCCACACCTGGCTGGGG - Intronic
1119663334 14:76466462-76466484 TCAGATTCCTCACGTGGCTGGGG + Intronic
1119689266 14:76658078-76658100 ACTGCCTCCTCACTTGACTGAGG - Intergenic
1120781453 14:88489814-88489836 ACAGGTCACTGACTTGGCTCTGG + Intronic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1123124619 14:105937597-105937619 GCAGCTCCCAAACTTGGCTGAGG - Intergenic
1123841137 15:24248106-24248128 GCAGCTCCCTGCCTTGGTTGTGG + Intergenic
1123871375 15:24577503-24577525 GCAGCTCCCTGCCTTGGTTGTGG + Intergenic
1124040939 15:26103026-26103048 ACAGCTTCCTCCCCTGCCTGTGG - Intergenic
1124041716 15:26111492-26111514 ACAGCTACCTCACAGGGATGTGG + Intergenic
1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG + Exonic
1126748289 15:51849588-51849610 ACACTTTCCTCACTTGGCTTTGG - Intronic
1126923873 15:53560054-53560076 ACAGCTCAATAACTTGTCTGTGG - Intronic
1127148178 15:56047446-56047468 ACAGCTTCCTCACTGCTCTGAGG + Intergenic
1127291262 15:57573561-57573583 CCAGCTTCCTCACTTAGTTGTGG - Intergenic
1128369871 15:67032828-67032850 ACAGCTCCATCACTTGCTTTGGG + Intergenic
1128617790 15:69123720-69123742 ATGGCTCACTCACATGGCTGCGG + Intergenic
1128941230 15:71789365-71789387 CAAGTTCCCTCACCTGGCTGAGG - Intergenic
1129982727 15:79889116-79889138 ACATCACCCTCACCAGGCTGAGG + Exonic
1130073826 15:80671466-80671488 AGAGTTCCCTGACTTGGGTGTGG - Intergenic
1130923214 15:88366216-88366238 GCACCTCCCTCACGGGGCTGTGG - Intergenic
1131110346 15:89760917-89760939 GCAGCGCCCTCTGTTGGCTGTGG - Intronic
1132539186 16:500309-500331 ACAGCTCCCTCTCTGGGAGGAGG + Intronic
1132614893 16:835519-835541 ACAGCCACCTCACTTGGGCGGGG - Intergenic
1133771526 16:8869262-8869284 ACAGTTCCCCCACTTTGCAGGGG - Intergenic
1135427275 16:22349376-22349398 TCAGCTCCTCCACTTGGCTCTGG + Exonic
1138296815 16:55893167-55893189 ACAAGTCCCTCACTTCTCTGGGG - Intronic
1139375849 16:66495744-66495766 ACAGCTCTCCAGCTTGGCTGTGG - Intronic
1141346829 16:83254225-83254247 GCAGCTCCGTGACTTCGCTGTGG - Intronic
1141923144 16:87149709-87149731 GTGGCTCCCTCACATGGCTGTGG - Intronic
1142252859 16:89000706-89000728 ACACCTCCGTCCCTGGGCTGGGG + Intergenic
1142605293 17:1078046-1078068 GCAGCTCCCGCAGCTGGCTGGGG - Intronic
1145035861 17:19540159-19540181 ACATCTTTCTCACTTGGGTGGGG - Intronic
1145960255 17:28883046-28883068 ACACCTCCCTGCCTTGGCTTAGG + Intronic
1146596039 17:34169795-34169817 TCTGCTCCCACACTTGACTGAGG - Intronic
1146797056 17:35789368-35789390 AGAGTTCCTTCACTTGGCTGCGG - Intronic
1147021423 17:37537013-37537035 GAAGCCCCCTCACTTGGCTTAGG - Intronic
1148717067 17:49723414-49723436 ACAGCTTCCTCCCTTGGGTCGGG - Intronic
1148863577 17:50617399-50617421 ACAGCTCCCTGAGTTGGGGGAGG - Intronic
1149078736 17:52629413-52629435 CCAGCTTCCTCACTAGACTGGGG + Intergenic
1150502461 17:65664300-65664322 TGAGCACCCACACTTGGCTGAGG + Intronic
1151902716 17:77027571-77027593 ATGGCTCCCTCACATAGCTGTGG - Intergenic
1152191717 17:78892167-78892189 CCAGCTCCAGCGCTTGGCTGAGG - Exonic
1152298394 17:79481617-79481639 ACAGCTCAGTCACGTGGCTCGGG + Intronic
1152610033 17:81310893-81310915 ACCCCTCCCTCCCGTGGCTGTGG + Intergenic
1152637902 17:81437696-81437718 ACAGGCCCCTCTCTTGGCTAAGG - Intronic
1152839287 17:82556543-82556565 GCACCTCCCTCACCTTGCTGGGG + Intronic
1153145222 18:2024030-2024052 ACAGTTCCTTTACTTGGATGTGG + Intergenic
1153824718 18:8864888-8864910 TCAGCACCCTCTCTGGGCTGTGG - Intergenic
1154356358 18:13625394-13625416 CCAGCAGCCTTACTTGGCTGAGG + Intronic
1158346899 18:56524964-56524986 ACAGCTGCCCCTCTTGGCAGAGG + Intergenic
1161014015 19:1974558-1974580 ACACCTCCCTCACTCACCTGTGG + Intronic
1162231485 19:9270627-9270649 ACAGCTGCCCCATCTGGCTGTGG + Intergenic
1162788952 19:13053323-13053345 GTAGCTCCCTCACAGGGCTGGGG + Intronic
1163812032 19:19439120-19439142 GCAGCTCCCTCCCATGTCTGAGG + Intronic
1164853165 19:31501205-31501227 ACAGCACCAACACATGGCTGAGG - Intergenic
1166213583 19:41322207-41322229 CCAGCTTACTCAGTTGGCTGAGG - Intronic
1167671263 19:50855087-50855109 CCAGCTCCCTGTCTGGGCTGGGG - Intronic
1167837358 19:52085169-52085191 ACAGCCCCCTCACCTCCCTGTGG + Intronic
1167896753 19:52587916-52587938 ACAGCCCCCTCACCTCCCTGTGG - Intergenic
1167906016 19:52661427-52661449 ACAGCCCCCTCACCTCCCTGTGG + Intronic
1167921862 19:52788705-52788727 ACAGCCCCCTCACCTCCCTGTGG + Intronic
1167942130 19:52956391-52956413 ACAGCCCCCTCACCTCCCTGTGG + Intronic
926292607 2:11542587-11542609 ACTGCACCCTCACTGGGCTCTGG - Intronic
929936894 2:46299373-46299395 AGGGCTCCCTCACTTGTCTTGGG - Intronic
931114657 2:59151426-59151448 ACAGCTCTCTCTCTGAGCTGTGG + Intergenic
931223227 2:60307018-60307040 ACAGCACCCTCACTTACCTTCGG - Intergenic
932428795 2:71660702-71660724 ACATCTCCCCCACTAGACTGTGG - Intronic
934738802 2:96704223-96704245 ACACCTCTTTCACGTGGCTGCGG + Intergenic
935837863 2:107074932-107074954 ACAGATCCCACACTTGGCTCTGG - Intergenic
936934167 2:117822358-117822380 ACAACTACCTCACTTGGCTATGG - Intronic
937285722 2:120750002-120750024 ACAGCTCCCTCTCCTCCCTGGGG + Intronic
939213829 2:139211954-139211976 ACACATTCCTCACTTGGGTGTGG + Intergenic
944536770 2:200718003-200718025 CCAGCTCCCTCTCTTGACAGGGG - Intergenic
944953079 2:204775580-204775602 AAACCTCCATGACTTGGCTGAGG + Intronic
945140940 2:206685618-206685640 ACAGGTCCCTCAGGTGGGTGAGG + Intronic
945165366 2:206937536-206937558 CCAGTCCCCTCACTTGGGTGAGG + Intergenic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
948387957 2:237593358-237593380 TCAGTTCCCTCAGTAGGCTGAGG + Intronic
1169292360 20:4363715-4363737 ACTTCTCCCTCCCTTGCCTGTGG - Intergenic
1169859083 20:10132748-10132770 ACAGCTCCCTCACCAGCCAGTGG - Intergenic
1171386991 20:24777094-24777116 ACAGCATCCTCCCTTGGCCGAGG - Intergenic
1173245568 20:41335262-41335284 ACTGCTCACTGACATGGCTGGGG + Intergenic
1175317507 20:58059304-58059326 ACAGTTCTCTCACTGGGCAGAGG + Intergenic
1175678026 20:60963832-60963854 ACAAAACTCTCACTTGGCTGTGG + Intergenic
1178222189 21:30672414-30672436 CAAGCTCACTCACATGGCTGTGG - Intergenic
1178919786 21:36731168-36731190 CCAGCTACCTCCCGTGGCTGGGG - Intronic
1178981822 21:37270726-37270748 ATGGCTCCCTCACATGGCTGAGG + Intergenic
1180706816 22:17815328-17815350 CCACCTCCCTCACGTTGCTGTGG - Intronic
1182594481 22:31408252-31408274 CCAGCTCCCTCAGGAGGCTGAGG - Intronic
1182706511 22:32284460-32284482 TTACCTCCCTCACATGGCTGGGG + Intergenic
1183986954 22:41575322-41575344 ACATCTCCCTCCCTTGGCTGAGG + Exonic
1184394831 22:44227534-44227556 CGACCTCCCTCACATGGCTGGGG + Intergenic
1185107723 22:48883749-48883771 CCAGCTCCGTCACTGGGCAGTGG + Intergenic
1185110328 22:48896939-48896961 AGAGCGACCACACTTGGCTGCGG - Intergenic
950453324 3:13078037-13078059 ACAGCTCCCTCACTCATCCGCGG - Intergenic
950568455 3:13785732-13785754 ACAGCTGTCCCACTTGGGTGGGG - Intergenic
951516662 3:23567271-23567293 ACTGCCCACTTACTTGGCTGAGG + Intronic
954697894 3:52437165-52437187 ACAGCCCCCTCCCCTGCCTGGGG + Intronic
954961517 3:54569496-54569518 CCAGCTCCTTCCCTTGGCTAGGG - Intronic
956776070 3:72566615-72566637 GCTGCTCACTCACATGGCTGTGG + Intergenic
956860575 3:73319855-73319877 ACGACTCCCTCATTTGGTTGGGG - Intergenic
958787588 3:98614536-98614558 GCAAGTCCCTCAGTTGGCTGTGG - Intergenic
958890654 3:99778943-99778965 ACAGCTCACTCAAGTGTCTGGGG - Intronic
960278928 3:115759142-115759164 CCATCTCCTTCACTTGGCTGAGG + Intergenic
962566379 3:136664750-136664772 ACAGGTCTTTCTCTTGGCTGTGG - Intronic
963942401 3:151108211-151108233 ACAGCTGCCTCAGTTGGTAGGGG + Intronic
964848561 3:161069616-161069638 ACAGCTCTGTCTCTTGGCAGAGG - Exonic
966414418 3:179674228-179674250 ACTGGTCACACACTTGGCTGTGG - Intronic
967848649 3:194064923-194064945 AAATGTCCCTCACTTGTCTGTGG + Intergenic
968367540 3:198198355-198198377 TCAGCTGCCACACCTGGCTGAGG - Intergenic
968628287 4:1637750-1637772 ACAGCTCCCTTCCTGCGCTGGGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969456241 4:7301315-7301337 GCAGCTCCCCCACCAGGCTGTGG - Intronic
969725802 4:8917438-8917460 ACAGCTCGCTGACAAGGCTGCGG + Intergenic
972653255 4:41040574-41040596 CCAGCTCCATCACTTGCCTCTGG - Intronic
975138801 4:70900235-70900257 ACTGCTCCCTGATTTGGCTTAGG - Intergenic
976679720 4:87743254-87743276 TCAGCTCCCTTACTTGACTTGGG + Intergenic
981600417 4:146481691-146481713 GCAGTTCTCTCACTAGGCTGGGG - Intronic
985810870 5:2083648-2083670 TGACCTCCCTCACCTGGCTGAGG - Intergenic
986216556 5:5724843-5724865 ACAGCTCCTTCTGTTGGCTGCGG - Intergenic
987538428 5:19218831-19218853 AGAAATCCCACACTTGGCTGGGG + Intergenic
988865958 5:35335296-35335318 ATGGCTCACTCACTTGCCTGTGG + Intergenic
989131965 5:38115592-38115614 ACAGCTGCCTCACTTGCCAGTGG - Intergenic
989782107 5:45279931-45279953 CCAACTCCCTCACTTTCCTGAGG + Intronic
990027768 5:51216155-51216177 ATACATCACTCACTTGGCTGTGG - Intergenic
990974650 5:61548780-61548802 CCAGCTCCCTCACTTCCCTCAGG - Intergenic
991477682 5:67040687-67040709 CCAGCTCCATCTCTTAGCTGTGG + Intronic
991530037 5:67604922-67604944 AAAGCTCCCTCACTCTGCTGTGG - Intergenic
992035572 5:72771602-72771624 AAGGCTCACTCACCTGGCTGTGG + Intergenic
995196787 5:109379464-109379486 TCATCTCCCTCACATGGCTTTGG + Intronic
995246932 5:109945405-109945427 ACAACTCCCTCATTCCGCTGTGG + Intergenic
997529795 5:134574951-134574973 ACATCTCAGGCACTTGGCTGTGG + Intronic
998078362 5:139254810-139254832 ACAGCTCATTCATATGGCTGTGG - Intronic
998153696 5:139771988-139772010 ACCTCTCCCTCACCTGGCTGGGG - Intergenic
999125855 5:149245252-149245274 TCACCTCCCTCTCATGGCTGGGG - Intronic
999293067 5:150440313-150440335 TCAGCTCCCTCACTTTGTTTGGG + Intergenic
999826609 5:155279533-155279555 AGAGCTCCCTAAATGGGCTGGGG + Intergenic
1000770825 5:165351499-165351521 ACAGCTTCATCACTGGCCTGAGG + Intergenic
1001803212 5:174561166-174561188 ATTGCTCCCTCACTAGACTGTGG - Intergenic
1002505399 5:179675865-179675887 ACAGGGCCCGCACTGGGCTGTGG + Intergenic
1003325449 6:5086726-5086748 TAAGCTCGCTCACTTGTCTGCGG - Exonic
1006019722 6:31111005-31111027 ACAGCTCTCCCACCTGGCCGGGG + Intergenic
1006299624 6:33186614-33186636 CCAGCTCCCTCACCTGGCTCTGG + Exonic
1006517574 6:34553376-34553398 ACAGGCCACTCGCTTGGCTGGGG + Intronic
1006531485 6:34658836-34658858 TCAGCTCCAACTCTTGGCTGTGG + Intronic
1007436762 6:41818627-41818649 ACAGTTCCCTCACTAACCTGGGG + Intronic
1007592365 6:43030103-43030125 ACAACTCCCCTACTTGGCTTTGG + Intronic
1008348177 6:50455166-50455188 CCTGCTCCCACTCTTGGCTGCGG + Intergenic
1010665824 6:78629192-78629214 GGAGCTCCATCACGTGGCTGGGG + Intergenic
1013400336 6:109789018-109789040 ACATCTACCTCATTAGGCTGAGG - Intronic
1014166850 6:118234459-118234481 CAAGCTCACTCACATGGCTGTGG - Intronic
1015022282 6:128491082-128491104 ATAGCTACCTCACATGACTGTGG + Intronic
1015278248 6:131405559-131405581 CCAGTTCCCTCATTAGGCTGAGG + Intergenic
1016026692 6:139294580-139294602 ACTGCACCCTCACATGGCAGAGG - Intergenic
1016398050 6:143647866-143647888 ACGCCTCCCTGAGTTGGCTGTGG - Intronic
1017595955 6:156028687-156028709 AGATCTTCTTCACTTGGCTGTGG - Intergenic
1019866962 7:3721170-3721192 ACTGTTCCCTCTCTTGGTTGTGG + Intronic
1020028202 7:4914523-4914545 CCAGCTCCCTCTCTTTGTTGGGG - Intronic
1023339738 7:39207353-39207375 ACAGCTAGCTCACTTTCCTGTGG - Intronic
1023744989 7:43314942-43314964 ACAGCTGCCTCCCCTGGCTCAGG + Intronic
1024298577 7:47866260-47866282 TCAGCTCCCATACATGGCTGTGG - Intronic
1024894509 7:54242257-54242279 ACAGTTCCACCACGTGGCTGGGG - Intergenic
1025702900 7:63836265-63836287 GGAGCTCCCTCACATGGCTGAGG + Intergenic
1026339379 7:69422208-69422230 ACAGCTCCCAGGCTGGGCTGGGG + Intergenic
1027052592 7:75029304-75029326 AAAGCCCCCTCTCTTAGCTGGGG - Intronic
1028934964 7:96454770-96454792 ACACTTCCCTCATTTGGGTGTGG + Intergenic
1029117366 7:98244253-98244275 AGAGGTGCCTCCCTTGGCTGAGG + Intronic
1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG + Intronic
1032442803 7:131955033-131955055 ACAGCTCCCACCCTCTGCTGAGG - Intergenic
1033265614 7:139884193-139884215 CCAGCTCCCGCACCTGACTGTGG + Intronic
1034982765 7:155489358-155489380 ACAGCTGCCTCACAGAGCTGTGG - Intronic
1035101415 7:156400548-156400570 ACACCTGCCTCACTGGGCTGAGG + Intergenic
1037899804 8:22681237-22681259 CCAGCTCCCTCTTTTGTCTGTGG - Intergenic
1039582854 8:38681201-38681223 CCAGCTCCCTCACCCGGCTATGG + Intergenic
1041500567 8:58534566-58534588 ACATCTCCCTCATTTGGCCAGGG + Intergenic
1042289108 8:67149090-67149112 ATGGCTCCCTCACATGGCTCAGG + Intronic
1043496496 8:80806700-80806722 ACAGCTCCCACTCTTGGTTGTGG - Intronic
1044656868 8:94557645-94557667 ACAGCTCCCTCTCTTGAAGGGGG + Intergenic
1045311632 8:101008207-101008229 ACAGGTCAGTCACTGGGCTGGGG - Intergenic
1045720633 8:105106369-105106391 GGAGCTTCCTCATTTGGCTGTGG - Intronic
1049037016 8:140084719-140084741 ACAGATGCATCACCTGGCTGAGG - Intronic
1052973882 9:34398158-34398180 TCAGCTCCCTCCCTGGGGTGTGG - Intergenic
1053111188 9:35461179-35461201 ACAGCTACCTCATATGGCTTAGG - Intergenic
1057200575 9:93137668-93137690 ACAGCTCCTTCAGGTGGGTGGGG - Intergenic
1057828927 9:98392473-98392495 ACAGCTCCCTCAGTTGGGATAGG + Intronic
1057882299 9:98801733-98801755 ACAGATGGCACACTTGGCTGAGG + Intergenic
1061190409 9:129079511-129079533 ACTGGCCCCTCACTTGACTGTGG + Intergenic
1186170053 X:6867360-6867382 ACAGCACCCTCACTTTCATGGGG + Intergenic
1189255701 X:39637293-39637315 GCAGCTTCCTTGCTTGGCTGTGG - Intergenic
1192549538 X:72042925-72042947 AAAGCTACCTGACTTGGGTGTGG - Intergenic
1194826873 X:98575695-98575717 ACAGGTTCCTCCCTGGGCTGAGG + Intergenic
1195478802 X:105319116-105319138 AAAGCTCCTTTACTGGGCTGTGG - Intronic
1197302863 X:124802514-124802536 CCAACTGCCTCCCTTGGCTGGGG + Intronic
1197752470 X:129974903-129974925 ACAGCTCTCTCATCTGGGTGTGG - Intergenic
1198812198 X:140547371-140547393 ACAATTCCCTCACATGGCTATGG - Intergenic
1200591703 Y:5083200-5083222 ATAACTCCCTCCCTTGGCTGAGG + Intronic