ID: 945779363

View in Genome Browser
Species Human (GRCh38)
Location 2:214149245-214149267
Sequence GAGGTGAATTTTGATTCATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945779358_945779363 6 Left 945779358 2:214149216-214149238 CCATCGATATAGGTCCAAGTCCT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 945779363 2:214149245-214149267 GAGGTGAATTTTGATTCATCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
945779356_945779363 16 Left 945779356 2:214149206-214149228 CCAATTGTGTCCATCGATATAGG 0: 1
1: 0
2: 1
3: 2
4: 33
Right 945779363 2:214149245-214149267 GAGGTGAATTTTGATTCATCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
945779361_945779363 -8 Left 945779361 2:214149230-214149252 CCAAGTCCTGGCAATGAGGTGAA 0: 1
1: 0
2: 0
3: 26
4: 237
Right 945779363 2:214149245-214149267 GAGGTGAATTTTGATTCATCAGG 0: 1
1: 0
2: 0
3: 3
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945779363 Original CRISPR GAGGTGAATTTTGATTCATC AGG Exonic
900530292 1:3149696-3149718 GTGCTGAATTTTATTTCATCAGG + Intronic
903147029 1:21380772-21380794 GATGTGAATTTTGAGTTCTCAGG + Intergenic
908713532 1:67044905-67044927 GAGGTGCTTTTTAATACATCCGG - Intronic
911216137 1:95197709-95197731 AAGGTAAATTTTTATTCCTCAGG + Intronic
911563036 1:99429723-99429745 GAAGTGAATTTTCTTTCATTAGG - Intergenic
915901448 1:159849385-159849407 GAGCTGAATTCTGGTTCCTCAGG - Intronic
918982033 1:191574731-191574753 GAGGAAAAAATTGATTCATCAGG + Intergenic
919431869 1:197503853-197503875 CTGGGGAATTTTTATTCATCTGG + Intergenic
924457128 1:244227875-244227897 GGGCTGAATTGTGATTCACCTGG + Intergenic
1063740983 10:8819182-8819204 GAACTGAATTTTGATACATTGGG + Intergenic
1069499143 10:68934333-68934355 GAGGAGAACTTTGAATCACCAGG - Exonic
1071115775 10:82218309-82218331 GCGGTGAATTTTAATGCAGCTGG - Intronic
1071923823 10:90382236-90382258 GAGCTGAATTTTTTTTCCTCTGG - Intergenic
1074246465 10:111698632-111698654 GAGGTGAATTTCAACTCATGTGG - Intergenic
1074904812 10:117852323-117852345 GAAGAGGATTTTGAGTCATCCGG - Intergenic
1075486715 10:122828659-122828681 GAAGTGCATTTTGATCCATGAGG - Intergenic
1077945997 11:6899198-6899220 CAGGTGAATTCTGAATCATTAGG + Intergenic
1079285297 11:19124783-19124805 TAGGTAAATTCTGATTTATCTGG - Intronic
1080191493 11:29554815-29554837 AAGGTGAATTTTGAGACATTGGG - Intergenic
1089901146 11:121987006-121987028 AAGGTGCATTTTGAGTCACCTGG + Intergenic
1090574721 11:128088491-128088513 GAGATGAATTTTGAATTATAAGG + Intergenic
1093411402 12:18872577-18872599 GAGGTTCATTTGGGTTCATCTGG + Intergenic
1093980591 12:25471239-25471261 GATATGAATTTTGATGCATATGG + Intronic
1097268561 12:57760063-57760085 GAAGTGAATTTGGACTCATTTGG + Exonic
1097292562 12:57930685-57930707 GAGGTGAAAATTGATTCTTGAGG - Intergenic
1097750927 12:63351716-63351738 GAGCTGAACTTTGATTCCCCTGG + Intergenic
1098391064 12:69970687-69970709 GAGGTGAATTTTAATCTTTCCGG - Intergenic
1099692190 12:85970330-85970352 ATGGTAAATTTTGAATCATCTGG + Exonic
1100218043 12:92473651-92473673 AAGTTGAATTTCAATTCATCTGG + Intergenic
1101822810 12:108196986-108197008 GAGTTTAAATCTGATTCATCTGG + Intronic
1103975022 12:124696833-124696855 GTGGTAACTTTTGAGTCATCAGG - Intergenic
1106998405 13:35515330-35515352 GAGCTGCATTTTAATGCATCTGG + Intronic
1107807162 13:44164243-44164265 GAGGAGAATTTGGCTTCATATGG - Intergenic
1108866354 13:54927880-54927902 AAGATGAATTTTTATTCATGTGG - Intergenic
1111779571 13:92704710-92704732 GAAGTCAATTTTGCATCATCGGG + Intronic
1114068808 14:19091764-19091786 GAGGTAATGTTTGATTCTTCAGG - Intergenic
1114093453 14:19308241-19308263 GAGGTAATGTTTGATTCTTCAGG + Intergenic
1115045787 14:28991486-28991508 GAGGTGAATTTTGCTAGAGCAGG - Intergenic
1117018622 14:51546437-51546459 GAAGTTTATTTTGATTGATCTGG + Intronic
1117098747 14:52323822-52323844 CAAGTGAATTTTAATTCCTCAGG - Intronic
1119489908 14:75022542-75022564 GAGATGAATTTTGAATGAGCTGG - Intronic
1120225188 14:81783077-81783099 CAGGTTAATTTTTATTCTTCTGG + Intergenic
1121099207 14:91238504-91238526 GGGCTGAATTCTGATTCATTGGG - Intronic
1122312435 14:100805667-100805689 GAGAGGAATTTTCAGTCATCAGG + Intergenic
1123185382 14:106511622-106511644 GAGGTAAATATGGATACATCTGG - Intergenic
1126183514 15:45809214-45809236 GATGTAAATTCTGATTCAGCAGG - Intergenic
1129641010 15:77377894-77377916 AAGGTGATTTTTGAATCAGCAGG - Intronic
1132038987 15:98508883-98508905 GAGGTCAGTTTTGTATCATCTGG - Intronic
1136990142 16:35147055-35147077 GATGTGAATGTTGAGTCATGAGG + Intergenic
1137728392 16:50672327-50672349 GGGGTGGATTTTCATTCATAAGG - Exonic
1138978987 16:62243315-62243337 GAGGGAAATTTTGCTTCACCAGG - Intergenic
1140431033 16:74903433-74903455 CAGGTGATTTTTGTATCATCTGG + Intronic
1140635895 16:76913243-76913265 GAGGAGAATTTGGATTCCTTTGG - Intergenic
1141229749 16:82154337-82154359 GTGTTGAATTTTGTTTCATTAGG - Intronic
1143474901 17:7196885-7196907 GAGGCGAATTGTGATCCACCGGG - Exonic
1143839751 17:9722842-9722864 GAGGGGAATTTTGATAAGTCTGG - Intronic
1144360281 17:14485655-14485677 AAGGTGCATTTTGTTTCCTCAGG + Intergenic
1145364477 17:22246098-22246120 AATGTTAATTTTGATTCAGCAGG - Intergenic
1147546873 17:41408573-41408595 GAGGTGAATTCAGGCTCATCTGG - Intergenic
1149135722 17:53360991-53361013 TAGGTGAATTTTGGTCCATTTGG + Intergenic
1151065558 17:71145466-71145488 GAAGTTCATTGTGATTCATCAGG - Intergenic
1154121722 18:11657687-11657709 GAGCTTTGTTTTGATTCATCTGG + Intergenic
1157784186 18:50467329-50467351 GAGCTGAATCTTGAAACATCAGG + Intergenic
1157889642 18:51403457-51403479 GAGGTGAAAATTGATTCTTAGGG + Intergenic
1158555313 18:58470183-58470205 GAAGAGAATTTTGCTTGATCCGG + Intergenic
1164388277 19:27794943-27794965 GATGTGAATTTTGAGACATGAGG + Intergenic
926758760 2:16257899-16257921 GATGTGGGTTCTGATTCATCGGG - Intergenic
926953505 2:18269718-18269740 GAAGTGCCTTTTGATACATCAGG - Intronic
927656755 2:24954602-24954624 GTGTTGATTTTTGATTCCTCAGG - Intronic
927671166 2:25070000-25070022 GTTGTAACTTTTGATTCATCAGG + Intronic
928097946 2:28416562-28416584 AAGGTGGATTTTCATTCCTCTGG + Exonic
929807240 2:45157188-45157210 GAGGTGAAATGAGATTCTTCAGG - Intergenic
929969365 2:46560554-46560576 GAGGAGATTTCTGTTTCATCTGG + Intronic
932036174 2:68249265-68249287 GATGTGAATTTTAATTCCGCTGG + Intronic
932314702 2:70772181-70772203 GAGGTGAACTTTCATTTATTGGG - Intergenic
933083791 2:78028903-78028925 GAGGTGAAGATTGAATCATAGGG + Intergenic
935031182 2:99324167-99324189 CCAGAGAATTTTGATTCATCTGG - Intronic
935170293 2:100606283-100606305 CAGGTGACTTTTTATTCTTCTGG - Intergenic
935505562 2:103897748-103897770 GAGGTGAATTTTGCCTAATTAGG - Intergenic
936728311 2:115350007-115350029 GAGTTGAATTTATATTCATGAGG + Intronic
937851170 2:126637834-126637856 GAGGTGAATGGTGTTCCATCGGG + Intergenic
940686700 2:156859428-156859450 GGGGTGAATTTTCATTTACCTGG + Intergenic
941228615 2:162880660-162880682 GCTGTGAATTTTGATTAACCAGG + Intergenic
941540166 2:166772132-166772154 AAGATGAACATTGATTCATCTGG - Intergenic
943534518 2:189131094-189131116 GAGCTTAATTTTGAATAATCAGG + Intronic
945476861 2:210293800-210293822 AAGGAGAGTTTTGTTTCATCAGG - Exonic
945779363 2:214149245-214149267 GAGGTGAATTTTGATTCATCAGG + Exonic
946377808 2:219324246-219324268 GAGGAGAATTTAGATTTTTCAGG + Intergenic
948037907 2:234873972-234873994 GGGGAGAATTTTGGTGCATCCGG + Intergenic
1170343819 20:15360339-15360361 GATGTAAATTTTCATTTATCTGG + Intronic
1177278632 21:18949813-18949835 GATGTGAATTTTCATTTCTCTGG + Intergenic
1178890043 21:36513605-36513627 GAGGGGAAGTTTGAGTCCTCAGG + Intronic
1178926444 21:36779247-36779269 CAGTTGACCTTTGATTCATCAGG - Intronic
1179374369 21:40836677-40836699 AAGGTGAATTATGGTTCATGTGG + Intronic
1180487280 22:15814324-15814346 GAGGTAATGTTTGATTCTTCAGG - Intergenic
1181890093 22:26054885-26054907 GATGTGATTTTTAACTCATCTGG + Intergenic
952194360 3:31057329-31057351 GTGGTGACTTTTGGGTCATCAGG - Intergenic
954837103 3:53479489-53479511 AAGGTGAACTTTGCTTCAGCAGG + Intergenic
957492826 3:80951597-80951619 GATCTGCATTTTGATTCACCAGG - Intergenic
957493057 3:80954481-80954503 AACCTGAATTTTGATTCACCAGG - Intergenic
959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG + Intronic
959922440 3:111883610-111883632 AATGTGAATTTTGTTTCCTCAGG + Intronic
962490580 3:135890118-135890140 GAGGTGAATTTAGATGAATTTGG - Intergenic
962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG + Intronic
964221587 3:154352939-154352961 GAGGAGAATGTTGAATCACCAGG + Intronic
965721173 3:171664234-171664256 GAGCTGCATTATTATTCATCAGG + Intronic
966813146 3:183866191-183866213 GTGGTGATTTTTGATGCATGTGG + Intronic
971697253 4:29922214-29922236 GAGGTGAAAATTGGTTCAACAGG + Intergenic
971944194 4:33253054-33253076 AAGGTGAAATTTGGCTCATCTGG - Intergenic
974095232 4:57356263-57356285 GAGGTGAATTTTTTTTGATGGGG + Intergenic
974901161 4:68000218-68000240 TTGGTGAATTTTGATTCCACAGG - Intergenic
977232625 4:94469650-94469672 TAGATGGATTTTGATTCCTCTGG + Intronic
978171758 4:105679839-105679861 GAGGAGAACTTTGAATCACCAGG + Exonic
978198344 4:105996146-105996168 TAGGTGAATTTTTATTTATTTGG + Intronic
979630468 4:122896207-122896229 GTAGTGAATTTTTAATCATCTGG + Exonic
981142987 4:141292128-141292150 GAAGGAAATTTTGATTCATTTGG + Intergenic
981253255 4:142628944-142628966 GAGGTGGATTTTGTTTCTTATGG - Intronic
981325332 4:143440141-143440163 GTGGTGAATTGGGATTCATTGGG - Exonic
983633356 4:169872565-169872587 GAGGTGAGTTTTGAGTGATGTGG + Intergenic
984980153 4:185272779-185272801 GAGGAGAATATTGACTGATCGGG + Intronic
985993241 5:3580755-3580777 GGGGTGAAAGGTGATTCATCTGG + Intergenic
993055222 5:82972784-82972806 AAGGTGAAATTTAGTTCATCTGG - Intergenic
993120005 5:83763477-83763499 GATTTGAATTTTGATTCATTTGG + Intergenic
993196846 5:84759642-84759664 GAGGTAAAATTTAATTCATTTGG + Intergenic
996567008 5:124891160-124891182 GAGGTGAAATATGAACCATCAGG + Intergenic
1002881503 6:1256669-1256691 CAGGTGGATGTTGGTTCATCTGG - Intergenic
1007068796 6:39019593-39019615 GGGGGGCATTTGGATTCATCTGG + Intronic
1008405377 6:51113033-51113055 GAAGTGGCTTTTGATTCCTCAGG - Intergenic
1011118576 6:83924552-83924574 TAAGTGAATTATGATTCTTCAGG - Exonic
1011890369 6:92151747-92151769 GAAGGGAATCTTGATTAATCTGG - Intergenic
1016520692 6:144943492-144943514 GAGTTGATTTTTCATTTATCCGG + Intergenic
1016663160 6:146604537-146604559 AAGGTGCACTTTTATTCATCTGG - Intronic
1020351534 7:7224816-7224838 GAGGTGAATTGTGTGTCATGGGG + Intronic
1024097079 7:45990751-45990773 GAGCTGAACCTTGATTAATCTGG + Intergenic
1025156298 7:56609372-56609394 TAGGTTAATTTTGCTTAATCTGG - Intergenic
1028590735 7:92491336-92491358 ATATTGAATTTTGATTCATCTGG + Exonic
1028724410 7:94071084-94071106 GAGGTGTGATTTGATTCTTCCGG - Intergenic
1029871541 7:103698147-103698169 GAGATGAATTTTGTTTCTTAAGG + Intronic
1031344809 7:120652023-120652045 TAGGAGAATTTTGGTTCATTTGG - Intronic
1032273694 7:130435745-130435767 GATGTTAATTTTCATTTATCTGG - Intronic
1033536491 7:142317049-142317071 GAGGTGAAAATGGATTCATTTGG + Intergenic
1034729617 7:153375001-153375023 GAAGTGATTTCTTATTCATCTGG + Intergenic
1035982432 8:4388040-4388062 GAGGTGGACATTCATTCATCAGG - Intronic
1037152373 8:15653560-15653582 CAGGTTAATTTTGATTCAGCAGG + Intronic
1038392952 8:27222143-27222165 GAAGTGAATTTGGATTCCTTGGG + Intergenic
1042778848 8:72467689-72467711 AAGGTGCACTTTGATTTATCAGG - Intergenic
1048131477 8:131702471-131702493 GAAATGAATATTGACTCATCTGG + Intergenic
1048825040 8:138416086-138416108 GAGCTGAATTTTGATACATGAGG - Intronic
1050572995 9:6960849-6960871 GAGGTGATTTTTGCTTCCTAGGG - Intronic
1052397870 9:27962785-27962807 AAGATGAATTTTGTTTCATTAGG + Intronic
1055862044 9:80763219-80763241 GAGATGACTTTTCATTCAGCAGG + Intergenic
1056552695 9:87664492-87664514 GAGGTGAATGTTGATGGATGAGG - Intronic
1057051686 9:91928577-91928599 ATGGTGAATCTGGATTCATCTGG - Intronic
1186998129 X:15145859-15145881 TAGGTGTATTTTTAATCATCTGG + Intergenic
1191228595 X:58074294-58074316 AACCTGAATTTTGATTCAGCAGG - Intergenic
1194115821 X:89896124-89896146 CAGGTGTATTTTGATTGATAAGG - Intergenic
1197524524 X:127545481-127545503 GTGGTGTACTTTGATGCATCTGG + Intergenic
1197689404 X:129481308-129481330 GAGGTAAATTGTGATTTATAAGG - Intronic
1199527549 X:148809305-148809327 GACTTGAATCTTGATTCATTAGG + Intronic
1200468622 Y:3553251-3553273 CAGGTGTATTTTGATTGATAAGG - Intergenic