ID: 945779891

View in Genome Browser
Species Human (GRCh38)
Location 2:214156207-214156229
Sequence TGATAGGTCTTATGTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945779887_945779891 1 Left 945779887 2:214156183-214156205 CCCTAGTATTATCTTCCAGGTTT 0: 1
1: 0
2: 3
3: 21
4: 195
Right 945779891 2:214156207-214156229 TGATAGGTCTTATGTGCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 93
945779888_945779891 0 Left 945779888 2:214156184-214156206 CCTAGTATTATCTTCCAGGTTTC 0: 1
1: 0
2: 1
3: 11
4: 186
Right 945779891 2:214156207-214156229 TGATAGGTCTTATGTGCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945779891 Original CRISPR TGATAGGTCTTATGTGCAAG AGG Intronic
900935658 1:5764899-5764921 TGGTAGATTTTATATGCAAGAGG - Intergenic
907776250 1:57518700-57518722 TGAGAGTTCTTGTGTGCAGGTGG - Intronic
908929662 1:69303619-69303641 TGATTTGTCTTTGGTGCAAGTGG + Intergenic
916773002 1:167932201-167932223 TGATAGGGCATATGTTCAAGAGG - Intronic
922804758 1:228379517-228379539 CAAAAGGTTTTATGTGCAAGAGG - Intergenic
1065431257 10:25659400-25659422 TGATCTGTCTAATGTGAAAGTGG + Intergenic
1074396661 10:113103705-113103727 TGGTATGTCTTTTGTGCGAGTGG + Intronic
1076193918 10:128501563-128501585 TCATAGGGCATATGTGCATGAGG + Intergenic
1076590020 10:131576586-131576608 TGCCAGGTTTTATGTGCCAGGGG + Intergenic
1082105741 11:48219439-48219461 TGATACTTCTTAAGTGCATGTGG + Intergenic
1086879216 11:92134132-92134154 TTAGAGGTCTTAGGTCCAAGAGG - Intergenic
1088022376 11:105135160-105135182 TGATAGGTGTTATGATCAGGAGG + Intergenic
1094171478 12:27497368-27497390 TGATAGATGATTTGTGCAAGTGG + Intronic
1094367484 12:29699540-29699562 TGCTATATCTTATGTGCAATAGG - Intronic
1097306121 12:58071128-58071150 TGATAGGTAGGATGTGCAACTGG + Intergenic
1098091380 12:66905582-66905604 TCAAAGGTTTTATGAGCAAGGGG + Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100012025 12:89964994-89965016 TGTTAGGTCTTCTGTGGATGAGG + Intergenic
1100615513 12:96228521-96228543 TGATAGGTCCTAAGTGAAAAGGG - Intronic
1107158149 13:37193843-37193865 TGATAGAGCTGATGTGAAAGAGG - Intergenic
1107802800 13:44126240-44126262 TGATACATCTTCTTTGCAAGGGG - Intergenic
1108467223 13:50728351-50728373 TAATAGGAGTTATGTGCAAAAGG + Intronic
1108855678 13:54789880-54789902 TGATTTGTCTTTGGTGCAAGTGG - Intergenic
1112299714 13:98218702-98218724 TGATTGGCCTTATGTGCGTGTGG + Intronic
1114410619 14:22497075-22497097 TGATATGTGTTATGTGTAATGGG + Intergenic
1115541159 14:34422591-34422613 TGAGAACTATTATGTGCAAGTGG - Intronic
1117750167 14:58913684-58913706 TGATATGTGTTATTTTCAAGTGG + Intergenic
1119104574 14:71912134-71912156 TGGTAGGTGTTATGTCAAAGTGG + Intergenic
1127842000 15:62839945-62839967 TGATAGGTATTGTGTGGAAAGGG - Intronic
1128077433 15:64836503-64836525 TGAGAGGTCTAATGAGGAAGAGG - Intergenic
1135523135 16:23192626-23192648 TGATAGGTCTTGGGAGCAAAAGG + Intronic
1135769930 16:25210016-25210038 TGATAGGACTTATCTCAAAGGGG + Intergenic
1135770433 16:25214038-25214060 TGATAGGACTTATCTCAAAGGGG + Intergenic
1163292224 19:16386399-16386421 TGATAGGTGCTATCTGCAGGAGG - Intronic
1166418803 19:42617601-42617623 TAAAAGGTCTTATCTGCAGGAGG + Intronic
1166609110 19:44173327-44173349 TGATAGGTCTGAAAAGCAAGAGG - Intronic
936900710 2:117479195-117479217 TGACAGTTATTATGTTCAAGGGG + Intergenic
937461741 2:122094805-122094827 TGATAGCTGTTTGGTGCAAGAGG + Intergenic
937825417 2:126363916-126363938 TTATAGGTCTTAGGTGTAAGTGG + Intergenic
939417515 2:141918971-141918993 TCATATGTCTTAAGTGTAAGAGG - Intronic
939432012 2:142121722-142121744 TGATAGGGCTTTAGTGCAAGAGG - Intronic
941211226 2:162642443-162642465 TACAAGGTCTTATGTGCAGGAGG + Intronic
941227483 2:162867128-162867150 TGCTAGGTCATATGTCCAAAGGG + Intergenic
941713040 2:168734918-168734940 GGATAGTGATTATGTGCAAGTGG - Intronic
945779891 2:214156207-214156229 TGATAGGTCTTATGTGCAAGAGG + Intronic
947243588 2:228021923-228021945 TGCTTGGTCCAATGTGCAAGAGG - Exonic
948286657 2:236791358-236791380 TGATAAGTCCTGTGTGCATGGGG + Intergenic
1175555307 20:59849358-59849380 TGATAGTTGTGATGTGCAGGTGG - Intergenic
1177001823 21:15622516-15622538 TGGTAGATCTCATTTGCAAGAGG + Intergenic
1181932638 22:26415046-26415068 TCATAGGGCTTATATGCTAGTGG + Intergenic
949641921 3:6046107-6046129 TGATAGGTGATATGTGAAACAGG + Intergenic
952755797 3:36865464-36865486 TTTTATGTCTTATTTGCAAGTGG + Intronic
954649465 3:52151796-52151818 TGATAGGAATTATGTGGAATCGG - Intronic
957314944 3:78564877-78564899 TGCTAGGTTTGATGAGCAAGTGG + Intergenic
959575234 3:107926557-107926579 AGATAGGCCTTATTTGAAAGTGG + Intergenic
961138189 3:124531886-124531908 TGATAGGTCTCATATGTAGGGGG + Intronic
962635530 3:137327397-137327419 TGGTGGGTTTTATGAGCAAGGGG - Intergenic
963974159 3:151461666-151461688 ATATAGATCTAATGTGCAAGAGG - Intergenic
964320703 3:155493900-155493922 TGAGAGGTCGTGTGTGAAAGAGG - Intronic
965655763 3:170982809-170982831 TTATAGTTATTATGTGCAATAGG + Intergenic
966165564 3:177012673-177012695 TGATAGATGTTAAGGGCAAGAGG + Intergenic
967386594 3:188917656-188917678 TGAAAGGTATTAAGTGCAGGAGG - Intergenic
970611015 4:17725315-17725337 TTAGATGTGTTATGTGCAAGTGG + Intronic
972940865 4:44193339-44193361 TGACAGGTCATATTTGGAAGAGG + Intronic
973075550 4:45920760-45920782 TGATAGGTCTTGTTGGGAAGTGG + Intergenic
974689328 4:65275014-65275036 TCATAGGCCTTATATGCCAGGGG + Intergenic
974730227 4:65854412-65854434 TGAAATGTCTTATCTGCAACTGG - Intergenic
980515831 4:133859100-133859122 TGGTATTTCTTATGTGCAATTGG + Intergenic
985959927 5:3293653-3293675 TGATGGGTCTTCTGAGGAAGGGG - Intergenic
988563563 5:32302067-32302089 AGATAGGGCTTATGTATAAGTGG - Intronic
989008054 5:36837526-36837548 TCAGTGGTCTAATGTGCAAGTGG - Intergenic
993085211 5:83355344-83355366 TGATAGGGCTTATGTTCCACCGG - Intergenic
995573734 5:113508293-113508315 AAATAGGTCTTATGGGCCAGAGG + Intergenic
1001232997 5:170005847-170005869 TGATGTGTCTTATGTGTTAGGGG + Intronic
1007761719 6:44137239-44137261 TGTTAGGTCTGATATGAAAGGGG - Intronic
1007850438 6:44797752-44797774 TAATATGGCTTAAGTGCAAGGGG - Intergenic
1008338086 6:50330919-50330941 AAATAGGTCTCATGTGCAATCGG - Intergenic
1010158661 6:72825562-72825584 TGAGAAGTCTTATTTGCAAGAGG + Intronic
1016169572 6:140994640-140994662 TGATAGGATTTATGTGAATGGGG + Intergenic
1017611083 6:156186854-156186876 TAATAAGTTTTATGTGCCAGGGG - Intergenic
1021806273 7:24359047-24359069 TGATAGGTCTGAGATGCAAGAGG + Intergenic
1021979996 7:26044916-26044938 TGATAGGTATAATTTGAAAGGGG - Intergenic
1026608436 7:71836036-71836058 TGAGATGTCTTTGGTGCAAGAGG - Intronic
1030546974 7:110907982-110908004 GGATATGTCTCATGAGCAAGAGG + Intronic
1039363252 8:36903008-36903030 AGGTAGTTCTTAAGTGCAAGAGG + Intronic
1041053606 8:53960654-53960676 TGAAAGGTCTGATGAGAAAGGGG - Intergenic
1042738097 8:72011536-72011558 TAATAGTTATTATGTGCCAGGGG + Intronic
1047086010 8:121516428-121516450 TTATAGGTATTATTTGAAAGTGG + Intergenic
1049984502 9:936244-936266 TGATAAGTCTAATTTGCAAAAGG - Intronic
1051385512 9:16503899-16503921 TGATAGTTATTAAGTTCAAGAGG + Intronic
1052753992 9:32522615-32522637 TGATATGTCTTTGGTGGAAGCGG + Intronic
1055508136 9:76968892-76968914 TGATAGTTGCTGTGTGCAAGTGG - Intergenic
1055822935 9:80289624-80289646 CGATAGGGCTTATGTTCTAGTGG - Intergenic
1187046819 X:15655305-15655327 TGAGAGGTCTTCTGTGGTAGTGG + Intronic
1190030793 X:46971000-46971022 TAAGAGGTCTTATCTGCAAATGG + Intronic
1192150533 X:68709445-68709467 TGCTTGGTATTATGTGCCAGGGG + Intronic
1197084542 X:122456144-122456166 TGATAAGCCTTATTTGCCAGAGG - Intergenic
1197778521 X:130136978-130137000 TGATAGGGCTTATGTCAAGGGGG + Intronic
1198321825 X:135525707-135525729 TTATAGATCTTATTTGCAAAAGG + Intronic